ID: 947310447

View in Genome Browser
Species Human (GRCh38)
Location 2:228796013-228796035
Sequence ATTTCAAAGGGGAAATGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947310440_947310447 23 Left 947310440 2:228795967-228795989 CCATAATTACTAATTGTTATAAC No data
Right 947310447 2:228796013-228796035 ATTTCAAAGGGGAAATGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947310447 Original CRISPR ATTTCAAAGGGGAAATGGTG AGG Intergenic
No off target data available for this crispr