ID: 947316997

View in Genome Browser
Species Human (GRCh38)
Location 2:228870833-228870855
Sequence CAATTCCACTGAAGTTTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947316997 Original CRISPR CAATTCCACTGAAGTTTAGT TGG (reversed) Intronic
904950793 1:34236975-34236997 CAAGGGCACTGAAGTTTAGCTGG + Intergenic
905537110 1:38730831-38730853 TAATTCCACTGAACATTAATAGG + Intergenic
910726298 1:90343397-90343419 CATTTCCACTGAAGTTGATGGGG - Intergenic
911293599 1:96086637-96086659 CAATGGCACTGAAGTTAAATAGG - Intergenic
912887634 1:113491972-113491994 CTATTCCAATGAAGTTAAGGAGG + Intronic
914327482 1:146634520-146634542 CATTTCCACTGAGGTATTGTGGG + Intergenic
915706492 1:157848838-157848860 CAGGTCCACTGAAGTTTAGAGGG + Intronic
916421000 1:164637686-164637708 AAGTTCCACTGACGTTTGGTTGG + Intronic
917049476 1:170903490-170903512 CAATTCCATTGAAGTCAAATTGG + Intergenic
918436984 1:184525323-184525345 CAATCACACTGAAATATAGTAGG - Intronic
918629750 1:186702512-186702534 AAATTACACTGATCTTTAGTGGG + Intergenic
918994735 1:191742745-191742767 TAATTTCCCTGAAGTTCAGTCGG - Intergenic
1063239662 10:4154714-4154736 AAATTACACTGATGTTTTGTAGG - Intergenic
1068977902 10:63031458-63031480 TAATTCATCTGAAGTTTATTTGG + Intergenic
1069022494 10:63504532-63504554 CAATAGGACTGAAGCTTAGTGGG + Intergenic
1079442707 11:20531510-20531532 CCATTCCACTGCAGTCTAGGAGG - Intergenic
1081186926 11:40054706-40054728 CCATTCCACTGAAGTTTTGTGGG - Intergenic
1085370246 11:75996643-75996665 CAATTCCAGTAAAGCTTACTGGG + Intronic
1086177086 11:83903834-83903856 CATTTCCACTGAAGATAAGAAGG - Intronic
1086581514 11:88405149-88405171 AAATTCAACTGAAGTGTTGTTGG + Intergenic
1087737177 11:101847548-101847570 TAATTTTACTGAAATTTAGTTGG - Intronic
1089171844 11:116517491-116517513 CAATTCAACCAAAGTTTATTGGG + Intergenic
1091297501 11:134484117-134484139 CAGTTCAACTGAACTTTATTAGG - Intergenic
1101225458 12:102683782-102683804 CAATCCCACGGAAGATCAGTGGG + Intergenic
1104587159 12:130056661-130056683 CAGTTCAACTGAGGTTTAGAAGG + Intergenic
1105257989 13:18757436-18757458 CAATTCCACATGAGTTTGGTAGG + Intergenic
1105260645 13:18776743-18776765 CAATTCCACATGAGTTTGGTAGG + Intergenic
1106787758 13:33124002-33124024 CAATTCCACAGAAGTGCTGTTGG + Intronic
1122442412 14:101741137-101741159 CAAATCCTCTGAAATTTAGGCGG + Intergenic
1123773143 15:23549217-23549239 CCATGCCTCTGAGGTTTAGTGGG + Intergenic
1124084301 15:26532230-26532252 CAGTTCCGCTGAAGTTTGCTGGG - Intergenic
1125798812 15:42425985-42426007 CACTTCCACAGAAGTTTTTTAGG + Intronic
1131716224 15:95113730-95113752 CTATTCCACTGAGGCTGAGTTGG - Intergenic
1132242926 15:100274951-100274973 TAATGCCACTGAAGTTAAGCTGG - Intronic
1135312688 16:21418607-21418629 AAATTCCAATAAAGATTAGTCGG - Intronic
1135365605 16:21850877-21850899 AAATTCCAATAAAGATTAGTCGG - Intronic
1135446203 16:22520275-22520297 AAATTCCAATAAAGATTAGTCGG + Intronic
1136119699 16:28124452-28124474 CATTTGCACTGAGGTTTAGCAGG - Intronic
1136322808 16:29499122-29499144 AAATTCCAATAAAGATTAGTCGG - Intronic
1136437490 16:30239090-30239112 AAATTCCAATAAAGATTAGTCGG - Intronic
1140006079 16:71076420-71076442 CATTTCCACTGAGGTATTGTGGG - Intronic
1143960032 17:10709259-10709281 CATCTCCACTGATGTCTAGTAGG - Intronic
1144592645 17:16537420-16537442 AAATTTCAGTGAAGTTTTGTTGG - Intergenic
1150965316 17:69961140-69961162 CAATTACACTGAATTTGAGATGG + Intergenic
1151691098 17:75686007-75686029 CATTTACATTGAAGTCTAGTTGG + Intronic
1153893646 18:9540294-9540316 CAATTCAACTGCAGTTGCGTGGG - Intergenic
1154425370 18:14268049-14268071 CAATTCCACATGAGTTTGGTAGG - Intergenic
1155629854 18:27880021-27880043 CAAGCCCACTAAACTTTAGTTGG - Intergenic
1157243641 18:46034490-46034512 TAAGAACACTGAAGTTTAGTGGG - Intronic
1163497319 19:17654516-17654538 CAATCCCACTGCAGTTTGGAGGG + Intronic
927598452 2:24418915-24418937 AGATTCCAATGAAATTTAGTGGG + Intergenic
929992661 2:46802854-46802876 CAATACCACTGCAGACTAGTTGG - Intergenic
931782296 2:65589224-65589246 CAAGCCCACTCAAGTGTAGTTGG + Intergenic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
934492721 2:94772644-94772666 CAATTCCACATGAGTTTGGTAGG + Intergenic
934900166 2:98153714-98153736 GAATTCAACTGAATTTTAGCTGG - Intronic
936835223 2:116701648-116701670 CAATTTAACTTAAGTTTAGGTGG - Intergenic
939497999 2:142947203-142947225 GAACTCCACTGAAGTTTTCTTGG - Intronic
942577863 2:177383968-177383990 CAATTACACTGAAGTGTACAGGG - Intronic
942942738 2:181638681-181638703 CAACTCCTCTGAAGTTGAGGTGG - Intronic
942987845 2:182163545-182163567 GAAGGCCCCTGAAGTTTAGTTGG - Intronic
944130391 2:196341316-196341338 CTTTTCCCCTGAAGTTCAGTTGG + Intronic
944537606 2:200726361-200726383 TAATTCCACTGTGGTTTTGTAGG + Intergenic
947316997 2:228870833-228870855 CAATTCCACTGAAGTTTAGTTGG - Intronic
948328366 2:237144646-237144668 CAATTCCAGTGAAGTTATGTAGG - Intergenic
1171048981 20:21838136-21838158 CAAATCCACAGATGTCTAGTTGG - Intergenic
1171883797 20:30636884-30636906 CAATTCCACATGAGTTTGGTAGG + Intergenic
1173357557 20:42308237-42308259 CAAGTCCACGCAAGTTTATTAGG - Intronic
1173442713 20:43092621-43092643 CACTTTCACTTCAGTTTAGTGGG - Intronic
1179347839 21:40577718-40577740 CAATTTTACAGAAGTTAAGTAGG + Intronic
1182349220 22:29689497-29689519 CAATTCCACTGCATTTTTATGGG + Intronic
1184638768 22:45857477-45857499 GAAGTCCCCTGAATTTTAGTTGG + Intergenic
951976104 3:28510888-28510910 CATGTCCACTGAGGATTAGTAGG + Intronic
951981016 3:28567207-28567229 CAATTTCACTGAACTATTGTAGG - Intergenic
952116150 3:30183994-30184016 GGGTTCCACTGGAGTTTAGTTGG + Intergenic
952477818 3:33729316-33729338 CAATTGCATTGAACTTTTGTAGG - Intergenic
956354324 3:68374256-68374278 CCAATCCACTGAGGTTTGGTAGG + Intronic
956848397 3:73205241-73205263 CATCTCCACTGAATTTTAATGGG + Intergenic
958169478 3:89919906-89919928 CAATTCAATTGAAATTTAATTGG - Intergenic
958179915 3:90046940-90046962 GAATTCCCCTGAATTTTTGTTGG + Intergenic
959474698 3:106795274-106795296 CAATGCCATTGAAGCGTAGTGGG + Intergenic
961379104 3:126485916-126485938 TAATTCCTCTGCAGTTTTGTTGG - Intronic
962630159 3:137267662-137267684 CAAATCCACTGAAATTTGTTGGG + Intergenic
963478806 3:145841265-145841287 CAGTTCCACTGTAATTTAGAGGG - Intergenic
963480754 3:145870581-145870603 CCATTACACTGAAATTTAGCTGG - Intergenic
968242545 3:197103907-197103929 AAATTCCACTGAGGTTTTATTGG + Intronic
971576698 4:28283932-28283954 CAATTTCACTGATTTTTATTGGG - Intergenic
974947942 4:68551008-68551030 CAATTTCAATGCAGTTTTGTGGG - Intronic
974957025 4:68654368-68654390 CAATTTCAATGCAGTTTTGTGGG - Intronic
975947450 4:79724641-79724663 CAATTCTACTGAAATAGAGTAGG - Intergenic
980177597 4:129365771-129365793 CAAAAACACTAAAGTTTAGTGGG + Intergenic
981698929 4:147586688-147586710 CAAGTCTGCTGAAGTTTTGTGGG + Intergenic
982222095 4:153133775-153133797 CAATTGCCCTTAAGTTTAGAAGG + Intergenic
982617627 4:157660328-157660350 AAATTTCAGTGAATTTTAGTAGG - Intergenic
983005540 4:162480093-162480115 CAATTCCAGTGAATGTTTGTTGG + Intergenic
983223273 4:165063246-165063268 CAATTTCACTGAGTTTTAGACGG - Intergenic
991443874 5:66679591-66679613 CAAATACACTGATATTTAGTGGG - Intronic
992317493 5:75572610-75572632 TAAAACCAATGAAGTTTAGTTGG + Intronic
992666678 5:79016656-79016678 CAATTCCAATAAAGTCTAGCAGG + Intronic
993318580 5:86443098-86443120 CAATTCCACTGAAGGGAAGCTGG + Intergenic
993584033 5:89701117-89701139 CATGTGCACTGAAGTTTAATGGG + Intergenic
993830267 5:92747954-92747976 AAATTCCAATGATGTTTAATTGG - Intergenic
995346401 5:111124358-111124380 CAATACCATTTGAGTTTAGTGGG - Intronic
995359368 5:111277255-111277277 CACTTACACTGGAGTCTAGTAGG + Intronic
995569545 5:113465029-113465051 AAATTCCATTGAATTTTAATTGG - Intronic
996505974 5:124267955-124267977 GCATTCCACTGATGTTTTGTAGG - Intergenic
997815301 5:137011219-137011241 CAATTGCACTAAAGTTTCTTTGG - Intronic
999551311 5:152690214-152690236 CAATTTCCCTGAAGTTAAGGAGG - Intergenic
1000398681 5:160802553-160802575 CAGTTCTACTGATGTTTTGTTGG - Intronic
1000595391 5:163209701-163209723 CAATTTACCTTAAGTTTAGTAGG + Intergenic
1000780483 5:165474134-165474156 CAATCACAGTGAAGTTTATTTGG + Intergenic
1001952215 5:175824154-175824176 CAAATCCACTGAAGTCAAGAGGG - Intronic
1003911868 6:10750460-10750482 CAATTTTACTGAAGTAAAGTAGG + Intronic
1004701890 6:18087306-18087328 CATTTCCACTGCATTTTACTAGG + Intergenic
1005114594 6:22321653-22321675 AAATTCCACTGTAATTGAGTTGG + Intergenic
1005561330 6:27044845-27044867 CAAATCTACTAAAGTTTTGTTGG + Intergenic
1007184971 6:39962459-39962481 AAATAACACTGAACTTTAGTGGG - Intergenic
1008063679 6:47025485-47025507 CTAGTCCCCTGAAGTTAAGTGGG + Intronic
1008264282 6:49404973-49404995 CAATTTTGCTGAAGATTAGTTGG + Intergenic
1008348036 6:50453702-50453724 CACTTCCCCTGAAGTGTATTTGG + Intergenic
1009515782 6:64615312-64615334 CATTTGCACTAAAGATTAGTGGG + Intronic
1010534057 6:77003749-77003771 TAATGCCATTGAAGTTTAGTGGG - Intergenic
1011410895 6:87065060-87065082 CAATTCCACACAAGTTTAGCTGG - Intergenic
1013417217 6:109935818-109935840 GTATGCCACTGAAGTTTTGTGGG - Intergenic
1015162592 6:130169889-130169911 CAATTCCGTTGAATTTTGGTGGG + Intronic
1018535088 6:164810950-164810972 GAATGTCTCTGAAGTTTAGTTGG + Intergenic
1022948508 7:35313241-35313263 GAATGCCACAGAAGTTTATTTGG + Intergenic
1023332067 7:39128874-39128896 GAATTCAACTGAAATTCAGTGGG + Intronic
1023491362 7:40746063-40746085 CATTTCCAATGAAGTTTAGAGGG + Intronic
1025606989 7:63046541-63046563 CAATTCCACAGAGGCTAAGTGGG - Intergenic
1028044855 7:86105647-86105669 CAATTACAGTGATGTTTAGTTGG - Intergenic
1031041911 7:116847436-116847458 CAATTTCACTGATGTTTAGAAGG + Intronic
1032130517 7:129224404-129224426 CAAAGCCACTGAAGTTTGGAAGG + Intergenic
1033225790 7:139561072-139561094 CAATTCCCATGCAGTTGAGTGGG - Intergenic
1033852458 7:145514221-145514243 CCACTTCACTGAAGTTTAGGGGG - Intergenic
1036580279 8:10067707-10067729 CTATTCCACAGACATTTAGTGGG + Intronic
1038131138 8:24732824-24732846 CAATTCCACTGAAGATTTTCAGG + Intergenic
1040485802 8:47870001-47870023 CTATTCCACTGCAGTTGAGCTGG - Intronic
1041791834 8:61704850-61704872 CAATTCCACACATGGTTAGTGGG + Intronic
1045603311 8:103744382-103744404 CAATTCCACTGACATATATTTGG - Intronic
1048311241 8:133323870-133323892 CAATTCCACTGAATGCTAGAGGG + Intergenic
1052032399 9:23643657-23643679 CACTTCCACTGCATTTTTGTTGG - Intergenic
1053191317 9:36072373-36072395 CAATCACACTGAAGCTTAGGAGG - Intronic
1054899198 9:70349825-70349847 CCATTCTATTCAAGTTTAGTAGG - Intronic
1059041791 9:110822770-110822792 CTATTCTACTGAAGATTAGCTGG - Intergenic
1059091387 9:111362441-111362463 TAATTACACTGAAGCATAGTAGG + Intronic
1059093298 9:111384977-111384999 CAATTCCTCTGAATTTTTCTTGG - Intronic
1060429911 9:123542104-123542126 CAAATTCACTGAAGTTTGGGGGG + Intronic
1185833945 X:3328284-3328306 CAAATCCAATGATGTTGAGTTGG + Intronic
1186101065 X:6157219-6157241 TTCTTCCACTGAAGTTTAATGGG + Intronic
1194189767 X:90820684-90820706 AAGTTCCCCTGAATTTTAGTTGG - Intergenic
1200313142 X:155100593-155100615 TAATGCCACTGAAGTTATGTTGG + Intronic
1200536349 Y:4402568-4402590 AAGTTCCCCTGAATTTTAGTTGG - Intergenic
1201497540 Y:14604634-14604656 TTCTTCCACTGAAGTTTAATGGG - Intronic
1201735466 Y:17256038-17256060 CAATTCCACTGAAGAGAACTAGG + Intergenic