ID: 947318592

View in Genome Browser
Species Human (GRCh38)
Location 2:228892382-228892404
Sequence TGCACAGCACACTCCCATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947318592_947318596 29 Left 947318592 2:228892382-228892404 CCTCAATGGGAGTGTGCTGTGCA 0: 1
1: 0
2: 0
3: 14
4: 106
Right 947318596 2:228892434-228892456 ATATTTTAGCCAGGTAAAATTGG 0: 1
1: 0
2: 1
3: 28
4: 333
947318592_947318594 20 Left 947318592 2:228892382-228892404 CCTCAATGGGAGTGTGCTGTGCA 0: 1
1: 0
2: 0
3: 14
4: 106
Right 947318594 2:228892425-228892447 CACCTTCTCATATTTTAGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 104
947318592_947318597 30 Left 947318592 2:228892382-228892404 CCTCAATGGGAGTGTGCTGTGCA 0: 1
1: 0
2: 0
3: 14
4: 106
Right 947318597 2:228892435-228892457 TATTTTAGCCAGGTAAAATTGGG 0: 1
1: 0
2: 2
3: 25
4: 255
947318592_947318593 -5 Left 947318592 2:228892382-228892404 CCTCAATGGGAGTGTGCTGTGCA 0: 1
1: 0
2: 0
3: 14
4: 106
Right 947318593 2:228892400-228892422 GTGCAAAGATATTTACACTGTGG 0: 1
1: 0
2: 0
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947318592 Original CRISPR TGCACAGCACACTCCCATTG AGG (reversed) Intronic
900467799 1:2834226-2834248 TCCACAGCACAGTCCCCTTCGGG - Intergenic
906272563 1:44492205-44492227 TGCAAAGCAGACTCTCATTGTGG - Intronic
912687540 1:111779092-111779114 TGCAGAGCACCTTCCCATTTTGG + Intronic
923392665 1:233529734-233529756 TGCAGAGCATACTCCCCATGGGG - Intergenic
924758281 1:246961933-246961955 TGCAAAGCACAGTGCCATTGAGG - Intronic
1063474571 10:6317157-6317179 TGCACTTCATACTCCCATGGGGG + Intergenic
1064382365 10:14857650-14857672 TGCACAGCAGTCTTCCTTTGAGG + Intronic
1064774321 10:18758624-18758646 TGCACAGCAGCCACCCAATGAGG - Intergenic
1065341093 10:24706538-24706560 TGCACAACAAACTCCAATTGTGG + Intronic
1066301909 10:34104776-34104798 TGCACAGCAAATTCACTTTGAGG + Intergenic
1069712903 10:70501193-70501215 TCCAGACCACACTCCAATTGTGG + Intronic
1070659209 10:78292926-78292948 TCCACAGCTCCCTCCCACTGTGG + Intergenic
1074478769 10:113798759-113798781 TGCACATCACATTTCCATTTGGG + Intergenic
1081683397 11:45024640-45024662 TGTACTGCAGACTCCCATGGAGG - Intergenic
1088846288 11:113671010-113671032 TGCACAACAGCCTGCCATTGAGG - Intergenic
1091326304 11:134690895-134690917 TGCCCATCACACTCACACTGGGG + Intergenic
1091355023 11:134930740-134930762 TGCAAAGCCCATTCCCCTTGCGG - Intergenic
1093858697 12:24136743-24136765 TGAACAGCAAATTCCCATTTTGG + Intergenic
1096502812 12:52075419-52075441 TGCAGTGCACACACCCTTTGAGG - Intronic
1097565904 12:61267899-61267921 TGCAAATCACAAGCCCATTGTGG - Intergenic
1098015830 12:66103667-66103689 TTCACAGCGCCCTCCCACTGTGG + Intergenic
1099620947 12:85002372-85002394 AGGACAACACACTCCCATTGTGG + Intergenic
1100161135 12:91862160-91862182 TGCACAGAACACTCTGATTGAGG - Intergenic
1102618712 12:114176785-114176807 TGCCCCCCACACTCCCATTGAGG + Intergenic
1107058926 13:36134791-36134813 TGCACAGCCCACTCCCCTGCTGG + Intergenic
1110164813 13:72428383-72428405 AGCACAGGGCAATCCCATTGTGG - Intergenic
1113721835 13:112563241-112563263 TGCACAGCACACCCACATACGGG + Intronic
1115763866 14:36602909-36602931 TGTACAGCACAATCCTATTTGGG + Intergenic
1121985591 14:98502133-98502155 TGCACAGCACACATCCAGTTGGG - Intergenic
1122228604 14:100293660-100293682 TGCACAGTGCACTGCCAGTGGGG + Intronic
1129066418 15:72908093-72908115 TGCACAGCCCACTGACACTGTGG - Intergenic
1129523141 15:76198307-76198329 TGCACAGCACAGTCCCTTGGGGG + Intronic
1130575768 15:85092082-85092104 TGCACAGCACCCTGCCCCTGTGG - Intronic
1132804273 16:1768493-1768515 TGTCCAGCACACTCCCATTCAGG - Exonic
1135567244 16:23520737-23520759 AGCACAGCACACTTCACTTGAGG + Intronic
1136112920 16:28076087-28076109 TGCACGGCACAGTCCTAATGGGG + Intergenic
1138298403 16:55906649-55906671 TCCCCAGCACACTCCAATTCTGG - Intronic
1144836392 17:18158664-18158686 AGCCCAGCACCCTCCCACTGTGG - Intronic
1147726413 17:42568489-42568511 TGGACACTACACTCCCCTTGCGG - Exonic
1148360082 17:47004465-47004487 GGCACTGCACAGTCCCACTGGGG + Intronic
1151885253 17:76919809-76919831 GGCAAAGCACACTCGCATTGTGG + Intronic
1153560849 18:6370512-6370534 AGCACAGCACAGTCCCTTGGGGG + Intronic
1154038078 18:10825890-10825912 TGCACAGCCCACACTCAATGGGG + Intronic
1163812607 19:19443245-19443267 AGCACAGGACACTCTCCTTGGGG - Intronic
1164826162 19:31286541-31286563 TCCACAGCACACTTGCACTGAGG + Intronic
1166878177 19:45910925-45910947 TGCACCTCACACTCCCACAGTGG - Intergenic
1167068208 19:47203042-47203064 GGCAGAGCACACTTCCTTTGGGG + Intronic
925355524 2:3238532-3238554 TGCACACCCCACTGCCACTGTGG + Intronic
928095329 2:28401212-28401234 TGCACAACAGACTCTCCTTGGGG + Intronic
930564053 2:52997389-52997411 TGCACAGCACATTTCAACTGTGG + Intergenic
931023826 2:58084521-58084543 TACACAGCAAACTCTCCTTGTGG - Intronic
937439254 2:121902890-121902912 TGCACAGCAAAGCCCCCTTGGGG - Intergenic
938170185 2:129069242-129069264 TGCAAGGCACCCTCCCAGTGGGG - Intergenic
939582480 2:143967144-143967166 TGCTCATGATACTCCCATTGAGG - Intronic
944215751 2:197253984-197254006 TGTACAGAATACTCCCATTGTGG - Intronic
945185783 2:207138081-207138103 GGCACACCAGACTCTCATTGAGG + Intronic
945619094 2:212111011-212111033 TGCAAAGCACATTTCCAATGAGG + Intronic
946002414 2:216493554-216493576 GGCACATCTCACTCCCTTTGTGG + Intergenic
946025860 2:216671304-216671326 TGCACAGCACACTGCCCCTTAGG - Intergenic
947318592 2:228892382-228892404 TGCACAGCACACTCCCATTGAGG - Intronic
1171522452 20:25786284-25786306 TGCACAGCACTGTGCCATGGTGG - Intronic
1171554375 20:26069599-26069621 TGCACAGCACTGTGCCATGGTGG + Intergenic
1172097530 20:32467665-32467687 TGGACAGCACAGGCCCATTGGGG - Intronic
1172658252 20:36549735-36549757 TCCTGAGCACACTCCCATGGCGG - Exonic
1173559414 20:43992167-43992189 TGCCAGGCACACTCCCACTGCGG - Intronic
1174427050 20:50439249-50439271 TGCACAGGAGGCTCCCACTGGGG - Intergenic
1176656258 21:9591262-9591284 TGCACAGCACTGTGCCATGGTGG - Intergenic
1180240179 21:46498256-46498278 TTCACAGAACACCCCCACTGAGG + Intronic
1181320052 22:21997649-21997671 TGCAGGGCACACTCTCATGGTGG - Intergenic
1181492271 22:23268040-23268062 TGCTCAGCACTTTCCCATTCTGG - Intronic
1181966377 22:26658904-26658926 TGCAAAGCGCATTCCCATTTGGG + Intergenic
1182110419 22:27719096-27719118 TGCAGAGCACACACCCCTTGGGG + Intergenic
1182704871 22:32270812-32270834 TGAAAAGCACACTCCTATAGTGG + Intergenic
1183260648 22:36793267-36793289 TGCACAGCAAAATCACAATGAGG - Intergenic
954320652 3:49830129-49830151 GGCTCAGCACACGCCCCTTGGGG + Intronic
955690836 3:61589231-61589253 TACACAGCATTCTTCCATTGTGG - Intronic
955888776 3:63628421-63628443 TGCAAAACACAGTCACATTGAGG - Intergenic
964933364 3:162052064-162052086 TGCACAGCAGGCCCCCATGGAGG - Intergenic
968909947 4:3472619-3472641 GGCACAGCACAGTCCCTGTGTGG - Intronic
969122667 4:4921344-4921366 TGCACAGCAGACAGCCACTGGGG + Intergenic
969688093 4:8688152-8688174 TGCACAACACACTCACACGGAGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
974975675 4:68888163-68888185 TTAACAGCAGACTCCCAGTGAGG + Intergenic
979972246 4:127149829-127149851 TGCACAGCACATTTCCCTTTTGG + Intergenic
984459252 4:180012105-180012127 TGCACAGAACACTGCTATGGAGG - Intergenic
985833913 5:2256953-2256975 TGCACAGCCCTCACCCATGGGGG + Intergenic
987524430 5:19029868-19029890 TGCACTACACACGCCCACTGGGG - Intergenic
991072789 5:62503250-62503272 AGCACAGGACAATCCCCTTGAGG - Intronic
993452788 5:88093165-88093187 TGCACAGGTCACTCCACTTGAGG + Intergenic
993490751 5:88544576-88544598 TGCACAGCATTCTCTAATTGAGG - Intergenic
1001768776 5:174276702-174276724 TGCACAGCATACCACCAGTGGGG - Intergenic
1003308650 6:4950040-4950062 TGCTCAGCACTCACTCATTGCGG - Intronic
1006413694 6:33891107-33891129 TTCCAAGCACACTCCCATTTGGG + Intergenic
1006578050 6:35060272-35060294 TGAGCAGCACCCTGCCATTGAGG - Intronic
1006899469 6:37490636-37490658 TGCACAGAACACCCCCTCTGTGG - Intronic
1011664661 6:89622530-89622552 GGCACAGGCCACTTCCATTGAGG + Intronic
1013174394 6:107664852-107664874 TTCACTGCACACTCCCATTTGGG + Intergenic
1016423847 6:143913374-143913396 TGCCCACCACTCTCCCCTTGAGG + Intronic
1017290638 6:152731691-152731713 TGAAGAGCCCACTCCCAGTGAGG + Intergenic
1018626826 6:165787987-165788009 TATACATCACACTCTCATTGAGG - Intronic
1025282942 7:57641488-57641510 TGCACAGCACTGTGCCATGGTGG - Intergenic
1025301774 7:57823950-57823972 TGCACAGCACTGTGCCATGGTGG + Intergenic
1033306249 7:140227897-140227919 TGCACGGCACAGACCCAATGGGG - Intergenic
1038195767 8:25365954-25365976 TGCACAGCTCAATTCCATTTTGG - Intronic
1039279545 8:35968713-35968735 TCCTCAGCACACTCCCACAGAGG - Intergenic
1041069844 8:54117020-54117042 TGCACAGCATACTGACATTTTGG - Intergenic
1046672311 8:117069771-117069793 TGCACAGGACACTGCTACTGTGG - Intronic
1046853779 8:119005983-119006005 TGCACACCACAGACCCAGTGAGG - Intronic
1049411031 8:142474144-142474166 TGCAGTCCACACTCCCACTGAGG + Intronic
1055072968 9:72186344-72186366 TGCCAAGCACACTCCCATTTTGG + Intronic
1055926970 9:81520384-81520406 TGCATAGCAAAATCCCAGTGTGG - Intergenic
1056373854 9:85987419-85987441 TGCACAATACACTGCCATGGTGG - Intronic
1057792492 9:98133350-98133372 TGCACATCATCCTCCCACTGAGG - Intronic
1061406226 9:130394380-130394402 TGCAGAGCCCCCTCACATTGAGG + Intronic
1203633974 Un_KI270750v1:94744-94766 TGCACAGCACTGTGCCATGGTGG - Intergenic
1187671036 X:21665982-21666004 TGCACATCACAATCCCCTGGAGG - Intergenic
1189369261 X:40414780-40414802 TGCACAGAAAACTCCCCTAGGGG - Intergenic
1194977120 X:100407439-100407461 GGCACTGCACACGTCCATTGAGG + Exonic
1195858554 X:109356750-109356772 TGCAAAGCACACAGCCAGTGAGG + Intergenic
1198146514 X:133862824-133862846 TGCTCTGCACATTCACATTGTGG - Intronic
1199708177 X:150449259-150449281 TGGAAAGCACACTGCCCTTGGGG - Intronic