ID: 947319851

View in Genome Browser
Species Human (GRCh38)
Location 2:228904927-228904949
Sequence GTCTCAAGACTGTTAATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947319851_947319854 23 Left 947319851 2:228904927-228904949 CCAGCTATTAACAGTCTTGAGAC 0: 1
1: 0
2: 2
3: 5
4: 59
Right 947319854 2:228904973-228904995 GAGCTAGTGGCTTAGAGAGATGG 0: 1
1: 0
2: 2
3: 14
4: 181
947319851_947319855 26 Left 947319851 2:228904927-228904949 CCAGCTATTAACAGTCTTGAGAC 0: 1
1: 0
2: 2
3: 5
4: 59
Right 947319855 2:228904976-228904998 CTAGTGGCTTAGAGAGATGGTGG 0: 1
1: 0
2: 0
3: 20
4: 164
947319851_947319856 30 Left 947319851 2:228904927-228904949 CCAGCTATTAACAGTCTTGAGAC 0: 1
1: 0
2: 2
3: 5
4: 59
Right 947319856 2:228904980-228905002 TGGCTTAGAGAGATGGTGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 295
947319851_947319852 10 Left 947319851 2:228904927-228904949 CCAGCTATTAACAGTCTTGAGAC 0: 1
1: 0
2: 2
3: 5
4: 59
Right 947319852 2:228904960-228904982 CACTTTCACCAGAGAGCTAGTGG 0: 1
1: 0
2: 2
3: 45
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947319851 Original CRISPR GTCTCAAGACTGTTAATAGC TGG (reversed) Intronic
901008583 1:6184205-6184227 GTCTTAAGACAGTTGATATCTGG - Intronic
906028349 1:42695546-42695568 TTCTCCAGACTGTTAAGAGAAGG - Intronic
908213898 1:61931127-61931149 GTCTAAAGCATGTTAAGAGCTGG + Intronic
908429376 1:64041006-64041028 GTCTCAAGTCAATTAATAGTGGG + Intronic
910994739 1:93092238-93092260 TTCTAAAGAATGTTAATAGTTGG - Intronic
918581539 1:186136670-186136692 GGCTCAAGAGTGATAATAGGAGG - Exonic
920543364 1:206795812-206795834 GTTTTAAGGCTGTTAATAGAAGG - Intergenic
1068021495 10:51590952-51590974 GTCTCAGGTCTGTTAATTGCAGG - Intronic
1075112750 10:119600942-119600964 GACACAAGAATGTTCATAGCTGG - Intergenic
1075757261 10:124822954-124822976 GTCTCAAAACAGTTAAAAGTTGG + Intronic
1082014997 11:47478805-47478827 CTCCCAAGACTGTTGTTAGCTGG + Intronic
1092904289 12:13087973-13087995 GTAGCAAGTCTGTTAGTAGCAGG + Exonic
1103233827 12:119355128-119355150 GTTTCAAGACTTTTAAAAGTAGG - Intronic
1106788911 13:33134878-33134900 CTCTCAAGACTATTAATAGCAGG - Intronic
1108534424 13:51359089-51359111 TTCTCAAGATTGTTTATAGGTGG - Intronic
1113419326 13:110158102-110158124 GTCTCAAAACAGTCAATATCTGG + Intronic
1116318892 14:43434259-43434281 GTCTCAAGCCTTTTAAGAACAGG - Intergenic
1121551677 14:94807523-94807545 GTCTCAAGGCTCGTAGTAGCAGG + Intergenic
1129671594 15:77610821-77610843 GCCTCAAGGCTGGTAAGAGCAGG - Intergenic
1133003709 16:2865469-2865491 GTCTCATGCCTGTAAAGAGCTGG + Intergenic
1143617271 17:8060038-8060060 CTCTCAGGACTGTAAATTGCAGG - Intergenic
926119115 2:10231951-10231973 GTCTCATAACTGTTGATGGCAGG - Intergenic
926880457 2:17539288-17539310 GTCTCAAGTTTGTTCAAAGCTGG + Intronic
929782774 2:44967957-44967979 GTCTCCTGATTGTAAATAGCTGG - Intergenic
931270285 2:60695525-60695547 TTCTCAAAAGTGTTGATAGCTGG - Intergenic
938637174 2:133241063-133241085 GTTTCAAGCCTGTGACTAGCAGG + Intronic
942718500 2:178922408-178922430 GTGTCAAGACTGAGAAGAGCTGG - Intronic
943783295 2:191848118-191848140 GTCTCAAAATTGTTCATAGAAGG - Intergenic
945622476 2:212157892-212157914 GTGTCAAGACTGTTAAGAGCAGG - Intronic
946175545 2:217919974-217919996 GTCTCAAGGTTGGAAATAGCAGG + Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
1170064437 20:12295225-12295247 GTCTCAAAGGTATTAATAGCAGG - Intergenic
1170847542 20:19974965-19974987 GTGTGGAGACTATTAATAGCGGG - Exonic
1171475321 20:25404239-25404261 GTCTAAAGACTGTCAATAGAAGG - Intergenic
1173898049 20:46565830-46565852 GTTTCAACACTGTTGATAGTTGG - Intronic
1178751319 21:35306250-35306272 CTCTGTAAACTGTTAATAGCAGG - Intronic
1182158571 22:28099092-28099114 GTCTCTAGTCTGTAAACAGCTGG - Intronic
1183419638 22:37703799-37703821 GTATCAAGACTGGTAGAAGCTGG - Intronic
951986277 3:28625162-28625184 GACTCAGGGCTGTTAATAGATGG + Intergenic
959153400 3:102635567-102635589 ATCTCAAGACTGTTGATTCCAGG - Intergenic
960255346 3:115505719-115505741 GTCTCAAGGCTGCACATAGCAGG - Intergenic
960747416 3:120905681-120905703 GTCTCATTGCTGTTAATAGATGG + Intergenic
960899303 3:122538592-122538614 GACTCAAAATTGTCAATAGCTGG + Intronic
962896299 3:139718052-139718074 TTCTCAAGACTGTTTTTATCTGG - Intergenic
966736407 3:183190388-183190410 GACTGAAGACCGTTAGTAGCAGG - Intronic
968416209 4:436546-436568 CTCTCAAGACTGTTTCCAGCTGG + Intronic
979896685 4:126166571-126166593 GTCTCAAAACTGCTAATAAAGGG + Intergenic
988401977 5:30774822-30774844 GTCTAAAGACTGTCAATACAGGG + Intergenic
994808222 5:104479216-104479238 GTCTCAAGGCTGTACAGAGCAGG - Intergenic
995695574 5:114875365-114875387 ATCTCCAGACTTTAAATAGCAGG - Intergenic
1000697754 5:164409813-164409835 CTCTCATGACTGATAATACCAGG - Intergenic
1011513693 6:88128824-88128846 GTATCTAGGCTGTAAATAGCAGG + Intergenic
1017918185 6:158849006-158849028 GTCTTAATACTGTTAATAGAGGG - Intergenic
1020862154 7:13507320-13507342 ATTTCAAGACTATTAATAGACGG - Intergenic
1021479775 7:21103393-21103415 TTCTCAGAACTGTTAAAAGCAGG + Intergenic
1029182506 7:98713587-98713609 GTCACCAGATTATTAATAGCTGG + Intergenic
1034218357 7:149424786-149424808 GTTTCAAGACTCTGAAGAGCTGG + Intergenic
1037157710 8:15725392-15725414 CTCTCAAGGCTGATAATATCAGG + Intronic
1046541590 8:115590495-115590517 ATATCAAGACTGTAAATACCAGG + Intronic
1057166366 9:92929992-92930014 GTTTTAAGACATTTAATAGCAGG - Intergenic
1060099178 9:120823112-120823134 GTCTCAAGAATTTTAATAATTGG + Intronic
1060664729 9:125426020-125426042 GTGTCAAGACTGTAAATGGGAGG - Intergenic
1187181659 X:16948022-16948044 GTGATAAGACTGTTAATATCAGG + Intronic
1194026193 X:88753835-88753857 ATCTCATGACTGTTAATAAATGG - Exonic
1196080511 X:111625473-111625495 GTCTCTAGACTTTTAATTGCAGG - Intergenic
1199458741 X:148059536-148059558 GTCCCAAGACTGCACATAGCAGG + Intergenic
1199776144 X:151013527-151013549 GTCTCAAGGCTGTAAACAGCAGG + Intergenic