ID: 947319852

View in Genome Browser
Species Human (GRCh38)
Location 2:228904960-228904982
Sequence CACTTTCACCAGAGAGCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 552}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947319851_947319852 10 Left 947319851 2:228904927-228904949 CCAGCTATTAACAGTCTTGAGAC 0: 1
1: 0
2: 2
3: 5
4: 59
Right 947319852 2:228904960-228904982 CACTTTCACCAGAGAGCTAGTGG 0: 1
1: 0
2: 2
3: 45
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947319852 Original CRISPR CACTTTCACCAGAGAGCTAG TGG Intronic
901872046 1:12143845-12143867 CACTTCCTCCAGAGAGCACGTGG - Exonic
902664629 1:17928810-17928832 CACGTTTTCCAGAGAGCTGGAGG + Intergenic
903154193 1:21432987-21433009 CACTTGAACCAGAGAGGCAGAGG - Intergenic
903341507 1:22657803-22657825 CACTTTGTCCTGAGAGCTAATGG + Intronic
904227423 1:29035063-29035085 CACTTGAACCTGAGAGGTAGAGG - Intronic
904996178 1:34633384-34633406 CACTTTCACTAGATAAGTAGAGG - Intergenic
906547868 1:46634529-46634551 CACTTGAACCAGGGAGGTAGAGG + Exonic
907292934 1:53428574-53428596 CACTTTCACTAGATAAGTAGAGG + Intergenic
908204742 1:61834810-61834832 CACTTGAACCAGGGAGATAGAGG - Intronic
908905808 1:69007612-69007634 CACTTGAACCAGGGAGCTGGAGG - Intergenic
909792673 1:79697768-79697790 CACTTTCACTAGATAGGTAGAGG - Intergenic
910742964 1:90541404-90541426 CACTTAAACCTGAGAGCTGGAGG + Intergenic
911404366 1:97418382-97418404 CACTTGAACCTGAGAGGTAGAGG - Intronic
911484333 1:98486717-98486739 CATTTTCTCCAGAGAGCTGAAGG + Intergenic
911510289 1:98802477-98802499 CACTTTCACTGGATAGGTAGAGG - Intergenic
911570692 1:99513904-99513926 CACTTTCACTGGATAGGTAGAGG + Intergenic
912478151 1:109955721-109955743 CACTTGAACCAGGGAGCTGGAGG - Intergenic
912811724 1:112800222-112800244 CACTTAAACCAGGGAGGTAGAGG - Intergenic
912939271 1:114030696-114030718 CACTTTCACTGGATAGGTAGAGG + Intergenic
914171677 1:145231072-145231094 CACTTGAACCAGGGAGCTGGAGG - Intergenic
914526785 1:148475033-148475055 CACTTGAACCAGGGAGCTGGAGG - Intergenic
916018899 1:160776023-160776045 CACTTTCCCCAGATATCCAGGGG + Intergenic
916680633 1:167101715-167101737 CACTTGAACCAGAGAGGTGGAGG + Intronic
919266722 1:195277235-195277257 CACTTTAACAAGACAGCTAAAGG + Intergenic
919425402 1:197424015-197424037 AATGTTCACCAGAGAGCAAGAGG - Intronic
920841509 1:209559300-209559322 CACTTGAACCTGAGAGCCAGAGG - Intergenic
921579532 1:216879640-216879662 CAATATCACCAGAGAGTTAATGG + Intronic
922048710 1:221970221-221970243 CACTTTCACTAGTTAGGTAGAGG + Intergenic
922845029 1:228677970-228677992 CACTTTCACTAGATGGGTAGAGG - Intergenic
922877383 1:228950528-228950550 CACCTTCACTAGATAGGTAGAGG + Intergenic
922935196 1:229417210-229417232 CACTTTCACTGGATAGGTAGAGG + Intergenic
922974981 1:229777067-229777089 CAGTCTCACCAGAGAGTAAGGGG + Intergenic
923075530 1:230605678-230605700 CACTTTCACTAGATAAGTAGAGG + Intergenic
923377267 1:233377009-233377031 CACTTGCACCTGGGAGCCAGAGG + Intronic
923461459 1:234213090-234213112 CACTTCTGCCAGAGAGCTGGGGG + Intronic
923770439 1:236933693-236933715 CACTTTCACTAGATAGGTAGAGG - Intergenic
923963098 1:239105644-239105666 CACTTTCACTGGATAGGTAGAGG + Intergenic
924181004 1:241438465-241438487 CACTTTCACTGGATAGGTAGAGG + Intergenic
924376323 1:243413287-243413309 CACTTCAACCTGAGAGGTAGAGG - Intronic
924901702 1:248408041-248408063 CACTATCTCCAGATAGATAGTGG + Intergenic
1063704620 10:8419048-8419070 CACTTGAACCAGGGAGGTAGAGG - Intergenic
1064886688 10:20120597-20120619 CACTTTCACTGGATAGGTAGAGG - Intronic
1065006737 10:21387291-21387313 CACTTGAACCAGAGAGGCAGAGG + Intergenic
1065438028 10:25721502-25721524 CACTTTCACTAGATAGGTAGAGG + Intergenic
1066373792 10:34839381-34839403 CACTTAAGCCAGGGAGCTAGAGG - Intergenic
1067514650 10:46927839-46927861 CACTTCCACAAGAGAGGGAGAGG + Intronic
1067647610 10:48123974-48123996 CACTTCCACAAGAGAGGGAGAGG - Intergenic
1069316165 10:67105811-67105833 CACTTACACCAGAGAGGTCTAGG + Intronic
1069371818 10:67755716-67755738 CACTTGAACCAGGGAGCTGGAGG + Intergenic
1069863131 10:71483561-71483583 CACTTGCACGTGGGAGCTAGTGG - Intronic
1070603077 10:77879199-77879221 ATCTTTCCCCAGAGACCTAGAGG + Intronic
1074019377 10:109566846-109566868 CACTTTCACTGGATAGGTAGAGG + Intergenic
1074741113 10:116485094-116485116 CACTTTCACTGGATAGGTAGAGG + Intergenic
1074786814 10:116849117-116849139 CACTAACAGCAGAGAGCAAGGGG + Intergenic
1075004792 10:118822107-118822129 CACTTGAACCAGGGAGGTAGAGG + Intergenic
1075517305 10:123119223-123119245 CCCTATGACCAGAGAGCCAGAGG + Intergenic
1075908159 10:126100629-126100651 CACTTAAACCAGGGAGCTGGAGG + Intronic
1076632804 10:131861677-131861699 CGCTTTCACCAGGGAGTCAGAGG + Intergenic
1076647215 10:131961576-131961598 CACTGTCACCAGAGATCTGAGGG - Intergenic
1077588435 11:3472715-3472737 CACTTTCACTGGATAGGTAGAGG - Intergenic
1077732445 11:4746748-4746770 CACTTGAACCAGAGAGGTGGAGG + Intronic
1077945538 11:6893526-6893548 TACTTTCACCAGACAGTTAAAGG - Intergenic
1077966393 11:7138297-7138319 CAATTTCATCAGAGACCTTGGGG + Intergenic
1078136586 11:8657123-8657145 CACGGACACCAGAGAGGTAGGGG + Intronic
1079022683 11:16922849-16922871 CCCTTTCCCCTGAGAGCAAGGGG + Intronic
1079251424 11:18790801-18790823 CAAGGTCACCAGAGAGTTAGTGG - Intronic
1079481467 11:20885158-20885180 CACTTTCCCCACAGAGTTTGTGG + Intronic
1080541488 11:33270059-33270081 CACTTTCACCTGAGATTCAGAGG - Intronic
1080616740 11:33950962-33950984 CACTTGAACCCGAGAGGTAGAGG + Intergenic
1081092291 11:38887371-38887393 CACTTGAACCAGAGAGGCAGAGG - Intergenic
1083692303 11:64417335-64417357 CACTTTAACCTGGGAGCTGGAGG - Intergenic
1083901437 11:65645423-65645445 CCCTTCCACCAGGGAGGTAGGGG - Intronic
1083996856 11:66277124-66277146 CACATTCCCCAGAGAAGTAGCGG - Exonic
1084244139 11:67844344-67844366 CACTTTCACTGGATAGGTAGAGG - Intergenic
1084354614 11:68629414-68629436 CACTTTCACTAGATAAGTAGAGG + Intergenic
1084828549 11:71750219-71750241 CACTTTCACTGGATAGGTAGAGG + Intergenic
1085274334 11:75288697-75288719 CACTTTAACCCGGGAGGTAGAGG - Intronic
1086550613 11:88048214-88048236 CACTTTCACTGGATAGGTAGAGG + Intergenic
1086558709 11:88142202-88142224 GGCTTTTACCAGATAGCTAGGGG + Intronic
1087167669 11:95021269-95021291 CACTTTCACTGGATAGGTAGAGG - Intergenic
1087509724 11:99076249-99076271 CACTTGAACCTGGGAGCTAGAGG + Intronic
1087764273 11:102133072-102133094 CACTTGAACCAGAGAGTTAGAGG + Intronic
1088433404 11:109783275-109783297 CAATTACACCAGGGAGCTTGCGG - Intergenic
1088555293 11:111054682-111054704 CACTTTCACTGGATAGGTAGAGG + Intergenic
1088699423 11:112398679-112398701 CACTTTCCCCAGGGAGCTTGTGG + Intergenic
1089608746 11:119657529-119657551 CACTTGAACCAGAGAGTCAGAGG + Intronic
1089942927 11:122438607-122438629 CACTTGAACCTGAGAGGTAGAGG - Intergenic
1090107239 11:123866708-123866730 CACTTTCACTGGATAGGTAGAGG - Intergenic
1090300277 11:125630392-125630414 CACCTGAACCAGAGAGGTAGAGG - Intronic
1090526467 11:127543956-127543978 CACTTTCACTAGCTAGGTAGAGG - Intergenic
1090546156 11:127770298-127770320 CACTTTCACTGGATAGGTAGAGG - Intergenic
1091184016 11:133631280-133631302 CACTTTCACTGGATAGGTAGAGG + Intergenic
1091960139 12:4687051-4687073 CAATTTCAGCAGACAGCCAGCGG - Exonic
1092414700 12:8281481-8281503 CACTTTCACTGGATAGGTAGAGG - Intergenic
1092739019 12:11611138-11611160 CACTTTCACTAGATAAGTAGAGG - Intergenic
1092790019 12:12062666-12062688 CACTTTCACTAGATAGGAAGAGG + Intronic
1092924479 12:13261019-13261041 CACTTTCACTGGATAGGTAGAGG - Intergenic
1093321678 12:17721637-17721659 CACTTTCACTGGATAGGTAGAGG - Intergenic
1093584221 12:20818442-20818464 CACTTTCACTAGATAGGTAGAGG - Intronic
1093812495 12:23507256-23507278 CACTTTCACTGGATAGGTAGAGG - Intergenic
1094315707 12:29136203-29136225 CACTTTCACTGGATAGGTAGAGG - Intergenic
1096980741 12:55727241-55727263 CACTGGCAACAGAGAGCCAGGGG + Exonic
1097398888 12:59106122-59106144 CACTTTCACTAGATAGGTAGAGG + Intergenic
1097780742 12:63701752-63701774 CACTTGAACCAGGGAGGTAGTGG - Intergenic
1098629683 12:72710116-72710138 CACTTTCACTGGATAGGTAGAGG - Intergenic
1098931685 12:76424082-76424104 CACTTGAACCCGAGAGGTAGAGG - Intronic
1100336836 12:93639545-93639567 CCCTTTCTCCTGAGAGCTGGTGG + Intergenic
1102997196 12:117360234-117360256 CACTGTGACCAGAGAGCTCATGG - Intronic
1104975979 12:132552169-132552191 CACGGTCCCCAGAGAGCTGGAGG + Intronic
1105001276 12:132690627-132690649 CACTTGAACCAGAGAGGCAGAGG - Intronic
1105887031 13:24650864-24650886 CACTTGAACCAGAGAGGTGGAGG + Intergenic
1107219952 13:37970403-37970425 CACTTTCACTGGATAGGTAGAGG - Intergenic
1107485768 13:40825918-40825940 CACTTGCACCCGAGAGGCAGAGG - Intergenic
1108455166 13:50605793-50605815 CACTTGAACCAGGGAGCTGGAGG - Intronic
1108637776 13:52352392-52352414 CACTTACACCAGGGAGTTGGAGG + Intergenic
1108803533 13:54128810-54128832 CACTTTCACTGGATAGGTAGAGG - Intergenic
1109996006 13:70127625-70127647 TACTTTCACCAGATATCTGGAGG + Intergenic
1110612145 13:77501058-77501080 CACTTGAACCAGGGAGCTGGAGG - Intergenic
1110650148 13:77934550-77934572 CACTTTCACTAGATGGGTAGAGG - Intergenic
1110845714 13:80188517-80188539 CACTTTCACTGGATAGGTAGAGG + Intergenic
1110978848 13:81871017-81871039 CACTTTCACTGGATAGGTAGAGG + Intergenic
1111302354 13:86362690-86362712 TACTTTCACTAGATAGGTAGAGG + Intergenic
1111787915 13:92814575-92814597 CACTTTAACCTGGGAGCCAGAGG + Intronic
1112237167 13:97646789-97646811 CACTTTCACTAGATAAGTAGAGG + Intergenic
1112888973 13:104208991-104209013 CACTTTCACTGGATAGGTAGGGG - Intergenic
1113324646 13:109269699-109269721 CATTTTCACTAGATAGGTAGAGG + Intergenic
1113798416 13:113073829-113073851 CACTTGAACCAGAGAGGCAGAGG + Intronic
1114305650 14:21420387-21420409 CACTTTCACCACAGGGCCAAAGG + Intronic
1114326562 14:21595003-21595025 CACTTGAACCTGAGAGGTAGAGG - Intergenic
1116359105 14:43970772-43970794 CACTTGAACCAGGGAGTTAGAGG - Intergenic
1116490221 14:45496276-45496298 CACTTTCACTGGATAGGTAGAGG - Intergenic
1116702053 14:48256598-48256620 CACTTTCACTGGATAGGTAGAGG - Intergenic
1116702987 14:48263797-48263819 CACTTTCACTGGATAGGTAGAGG - Intergenic
1117219234 14:53585623-53585645 CACTTTGGTCACAGAGCTAGAGG + Intergenic
1117801482 14:59448361-59448383 CACTTTCACTGGATAGGTAGAGG + Intronic
1117957571 14:61134638-61134660 CACTTTCACTGGATAGGTAGAGG - Intergenic
1119026194 14:71154816-71154838 CACTTGAACCAGAGAGGCAGAGG + Intergenic
1119065582 14:71522775-71522797 CACTTGAACCTGAGAGGTAGAGG - Intronic
1119098088 14:71853063-71853085 CACTTTAACCTGGGAGCCAGAGG - Intergenic
1119818368 14:77591805-77591827 CACTTGAACCAGAGAGGTGGAGG - Intronic
1120046327 14:79811237-79811259 CACTTTGACCAAAGAGATAATGG + Intronic
1121019048 14:90567812-90567834 GACACTCACCAGAGAGTTAGAGG - Intronic
1121703995 14:95977445-95977467 CACTTTCACTGGATAGGTAGAGG + Intergenic
1121980231 14:98448154-98448176 CACTTTCACTGGATAGGTAGAGG - Intergenic
1123026970 14:105429838-105429860 CACTTGAACCCGAGAGCTGGAGG - Intronic
1124445451 15:29727258-29727280 CACTTGAACCTGAGAGGTAGAGG + Intronic
1125212911 15:37237621-37237643 CACTTTCACTGGATAGGTAGAGG - Intergenic
1126237922 15:46407281-46407303 CACTTTTACCAGAGAGGTAGGGG - Intergenic
1126610186 15:50521123-50521145 CACTTGCACCAGGGAGGTGGAGG - Intronic
1126844176 15:52743767-52743789 CACTTTCACTGGATAGGTAGAGG + Intergenic
1127454399 15:59144015-59144037 CACTGTCAACATAGAGCTTGAGG - Intronic
1129222836 15:74143091-74143113 CACTTGAACCAGGGAGCTGGAGG - Intergenic
1129317252 15:74752407-74752429 AACTTTCTCCTGAGAGCTGGGGG - Intronic
1130175265 15:81562380-81562402 CACTTGAACCTGAGAGCTGGAGG + Intergenic
1130308978 15:82736084-82736106 CACTTGAACCAGAGAGGTTGAGG + Intergenic
1130556313 15:84924982-84925004 CGCTTGAACCAGGGAGCTAGAGG - Intronic
1130781414 15:87044123-87044145 CACTTTCACTGGATAGGTAGAGG + Intergenic
1130945607 15:88548718-88548740 CACTTTCACTGGATAGGTAGAGG - Intergenic
1131172850 15:90190857-90190879 CACTTGAACCTGAGAGGTAGAGG - Intronic
1131644354 15:94325901-94325923 CACTTGAACCAGAGAGGCAGAGG - Intronic
1131684494 15:94755051-94755073 CACTTTCACTGGATAGGTAGAGG + Intergenic
1131685058 15:94758962-94758984 CACTTTCACTGGATAGGTAGAGG + Intergenic
1131882201 15:96873249-96873271 CACTTTCACTGGATAGGTAGAGG - Intergenic
1132070066 15:98768529-98768551 CACTTTAACCAGAGAGTTGGAGG + Intronic
1132263360 15:100444784-100444806 CACTTTCACTGGATAGGTAGAGG + Intronic
1132340736 15:101076824-101076846 CACTTTCACTGGATAGGTAGAGG + Intronic
1133042886 16:3069888-3069910 CACTTGAACCAGAGAGACAGAGG - Intronic
1133765417 16:8834459-8834481 CACTTTCACTAGATAAGTAGAGG - Intronic
1133766423 16:8841356-8841378 CACTTTCACTAGATAAGTAGAGG - Intronic
1133815896 16:9197217-9197239 CACTTGCACCAGGGAGGCAGAGG - Intergenic
1133881170 16:9783895-9783917 CACTTTCAAGGGAGAGCTAAAGG + Intronic
1133889956 16:9869347-9869369 CACTTTAACCCGAGAGGAAGAGG + Intronic
1134868429 16:17629839-17629861 CACTTGAACCAGGGAGGTAGAGG + Intergenic
1135029711 16:19028737-19028759 CACTTGAACCCGAGAGGTAGAGG - Intronic
1135144283 16:19948099-19948121 CACTTGAACCCGGGAGCTAGAGG + Intergenic
1135336638 16:21607156-21607178 CACTTGAACCAGAGAGGCAGAGG - Intronic
1135473837 16:22756025-22756047 CACTTCCACCAAGGAGTTAGGGG - Intergenic
1135634899 16:24067168-24067190 AAGTTTCACCAGAGAACTATTGG - Intronic
1136989523 16:35143555-35143577 CGCTTGCACCAGAGAGGTGGAGG - Intergenic
1139479318 16:67220368-67220390 CACTTGAACCAGAGAGGTGGAGG - Intronic
1140095190 16:71869175-71869197 CTCATTCACCAGACAGCAAGAGG + Intronic
1140990599 16:80207738-80207760 CACTTGAACCAGGGAGGTAGAGG - Intergenic
1141124641 16:81392499-81392521 CAAGTTCTCCAGAGAGGTAGAGG - Intergenic
1141155789 16:81596107-81596129 CACTTTTACCAGGGAGAAAGTGG + Intronic
1141437496 16:84008728-84008750 CACTGGCAGCAGAGAGCAAGAGG - Intergenic
1141764292 16:86048404-86048426 CACTTCCTCCAGGGAGCCAGCGG - Intergenic
1142385825 16:89763847-89763869 CACTTGAACCAGAGAGGCAGAGG + Intronic
1142951364 17:3483744-3483766 CACTTGAACCAGAGAGGTAGAGG - Intronic
1143168014 17:4908310-4908332 CGCATTCACCTGAGAGCCAGGGG + Intergenic
1143857046 17:9859733-9859755 CACTTGAACCAGGGAGCTGGAGG + Intronic
1144817467 17:18045809-18045831 CACTTGAACCAGAGAGGCAGAGG + Intronic
1147354663 17:39885298-39885320 CACTTGAACCAGAGAGGCAGAGG - Intergenic
1147803374 17:43111015-43111037 CACTTGAACCAGAGAGGCAGAGG + Intronic
1148250981 17:46079891-46079913 CACTTGAACCTGAGAGGTAGAGG + Intronic
1148357197 17:46983378-46983400 CACTTGAACCTGAGAGCTGGAGG - Intronic
1149023718 17:52000009-52000031 CATTTTCACCATAGAGCCAGAGG - Intronic
1150770015 17:68033001-68033023 CACTTACACCTGGGAGGTAGAGG - Intergenic
1151239236 17:72744923-72744945 CACTTGAACCAGGGAGGTAGAGG - Intronic
1151378151 17:73705781-73705803 GACTTTCCCCAGGGAGCCAGGGG - Intergenic
1151742315 17:75991961-75991983 CACTTGCACCAGGGAGGTACAGG + Intronic
1151839444 17:76607388-76607410 CACTTTCACTGGATAGGTAGAGG - Intergenic
1151907612 17:77059048-77059070 CACTTGAACCAGAGAGGCAGAGG + Intergenic
1152980864 18:274856-274878 CATTTTCTCCAGTGAGCTTGGGG - Intergenic
1153467669 18:5407109-5407131 CATTTTCACCAGAGTGTTTGTGG - Intronic
1155006528 18:21734610-21734632 CACTTGAACCAGAGAGGTAAAGG - Intronic
1155477502 18:26249086-26249108 CACTTGAACCAGGGAGCTGGAGG + Intronic
1155941926 18:31808638-31808660 CACTTTCACTGGATAGGTAGAGG + Intergenic
1156991318 18:43411424-43411446 CACTGCCACCAGAGAGCTGGTGG - Intergenic
1157254552 18:46126916-46126938 CACTTGCACCAGGGAGGTGGAGG - Intronic
1157350844 18:46883922-46883944 CACTTGAACCTGAGAGGTAGAGG + Intronic
1157906084 18:51571467-51571489 CACTTTCACTGGATAGGTAGAGG - Intergenic
1158264672 18:55648988-55649010 CACTTTCTGCTGAGAGCCAGTGG + Intronic
1158463971 18:57672780-57672802 CACTTGAACCAGGGAGGTAGAGG + Intronic
1158576424 18:58642584-58642606 CACTTTCACTGGATAGATAGAGG - Intergenic
1158660832 18:59386086-59386108 CACTTGAACCAGAGAGGCAGAGG - Intergenic
1158916392 18:62135708-62135730 CACTTGAACCAGAGAGGCAGAGG - Intronic
1159087633 18:63811911-63811933 CACTTGAACCAGAGAGGCAGAGG - Intergenic
1159164797 18:64685911-64685933 CACTTTCACTGGATAGGTAGAGG + Intergenic
1159929540 18:74296814-74296836 CACTTTCACCAGATAGGTAGAGG + Intergenic
1160114461 18:76064488-76064510 CCTTGTCACCAGAGAGCCAGAGG + Intergenic
1160993267 19:1870014-1870036 CACTTGAACCAGAGAGTCAGAGG - Intergenic
1161708993 19:5837119-5837141 CACTTTAGCCCGGGAGCTAGAGG - Intronic
1161921855 19:7272220-7272242 CACTTGAACCAGAGAGTTGGAGG + Intronic
1162083915 19:8236917-8236939 CGCTTGAACCAGAGAGGTAGAGG + Intronic
1162792467 19:13070147-13070169 CCCTTTCACCATGGACCTAGTGG + Intronic
1162869848 19:13577566-13577588 CACTTGCACCTGGGAGGTAGAGG + Intronic
1163487599 19:17597707-17597729 CACTTTCACTGGATAGGTAGAGG + Intergenic
1164774862 19:30845029-30845051 CACTTGAACCAGGGAGATAGAGG - Intergenic
1164857135 19:31533823-31533845 CACTTGAACCCGAGAGGTAGAGG - Intergenic
1165297209 19:34937093-34937115 CACTTTAACCAGGGAGGCAGAGG - Intronic
1165382044 19:35488543-35488565 CACCTTCTCCAGAGGGCTGGGGG - Intronic
1165484154 19:36085197-36085219 CACTTGAACCAGAGAGGTGGAGG - Intronic
1165496696 19:36156851-36156873 CACTTTCACTAGATAGGGAGAGG - Intergenic
1165510019 19:36260921-36260943 CACTTTCACTAGATAAGTAGAGG - Intergenic
1165609772 19:37141268-37141290 CACTTGAACCCGAGAGGTAGAGG + Intronic
1165693954 19:37886082-37886104 CACTTCCACCAGGCACCTAGTGG + Exonic
1166556108 19:43700763-43700785 CACTTTCAGCAGAAAGCAAATGG - Intergenic
1167114730 19:47482403-47482425 CACTTGAACCAGGGAGGTAGAGG + Intronic
1167234864 19:48308256-48308278 CACTTGAACCAGGGAGCTGGAGG - Intronic
1167875432 19:52408247-52408269 CACTTGGACCAGAGAGGCAGAGG - Intronic
1202645793 1_KI270706v1_random:140099-140121 CACTTTGACCAGTGGGCTGGTGG + Intergenic
926408068 2:12574047-12574069 CACTTTCACTAGATAGGTAGAGG + Intergenic
927306968 2:21584568-21584590 CACTTGAACCAGAGAGTCAGAGG + Intergenic
928070009 2:28205417-28205439 CACTTGAACCCGAGAGGTAGAGG + Intronic
928150660 2:28825819-28825841 CACTTTAACCCTAGAGGTAGAGG - Intronic
928779404 2:34802398-34802420 CACTTTCACTAGATGGGTAGAGG - Intergenic
928827322 2:35438317-35438339 CACTTTCACTGGATAGTTAGAGG - Intergenic
929076363 2:38082196-38082218 CACTTTCACTGGATAGGTAGAGG - Intronic
930009904 2:46928825-46928847 CAGTTACACCAGAGGGGTAGGGG + Intronic
930487010 2:52023324-52023346 CACTTTCACTGGATAGGTAGAGG - Intergenic
931127149 2:59290688-59290710 CTATTTCACCACAGAGCCAGAGG + Intergenic
931596012 2:63944317-63944339 TACCTTTACTAGAGAGCTAGAGG - Intronic
931608634 2:64076610-64076632 CACTTTCACTGGATAGGTAGAGG - Intergenic
932206254 2:69885552-69885574 CACGTGCAACAGAGAGCAAGAGG - Intergenic
933179415 2:79212727-79212749 CACTTTCACTGGATAGGTAGAGG - Intronic
933488859 2:82958995-82959017 CACTTGAACCTGAGAGATAGAGG + Intergenic
933937173 2:87216263-87216285 CACTTGCCCCAGAGAGCTCCAGG - Intergenic
935286413 2:101567634-101567656 CACTTGCACCTGAGAGGCAGAGG + Intergenic
936355970 2:111749561-111749583 CACTTGCCCCAGAGAGCTCCAGG + Intergenic
938173775 2:129105542-129105564 CACTTTAACCCGAGAGGTGGAGG + Intergenic
940309836 2:152266707-152266729 CACTTGAACCTGAGAGCTGGAGG - Intergenic
940675512 2:156721490-156721512 CACTTTCACTAGATAGGTAGAGG - Intergenic
941184887 2:162309381-162309403 CACTTCCACCACAGACCCAGAGG - Intronic
941935547 2:170978854-170978876 CACTTTCACTAGATAGGGAGAGG - Intergenic
942654854 2:178204675-178204697 CACTTTCAACAGATATCTGGGGG - Intronic
943420864 2:187667461-187667483 CACTTTAACCAGAGAGGCAGAGG + Intergenic
943806941 2:192134708-192134730 CACTTTCACTAGATAAGTAGAGG + Intronic
943835706 2:192511752-192511774 CACTTTCACTAGATAAGTAGAGG + Intergenic
943950964 2:194132103-194132125 CACTTTCACTGGATAGGTAGAGG - Intergenic
944541563 2:200758319-200758341 CATTTTCACCAGCGTGCCAGAGG + Intergenic
944656263 2:201879461-201879483 CACTTGCACCTGGGAGGTAGAGG - Intronic
945057256 2:205879846-205879868 CCCTTCCAGCAGAGAGCAAGAGG - Intergenic
945173809 2:207021901-207021923 CACTTTCACTAGATAAGTAGAGG + Intergenic
945301113 2:208217287-208217309 CACTTTCACTAGATAAGTAGAGG - Intergenic
945862756 2:215142629-215142651 CACTTGAACCTGAGAGGTAGAGG - Intergenic
946214728 2:218175444-218175466 CACTTTCACTAGATAAGTAGAGG - Intergenic
946780563 2:223190116-223190138 CACTTTCACTGGATAGGTAGAGG - Intronic
947319852 2:228904960-228904982 CACTTTCACCAGAGAGCTAGTGG + Intronic
948415889 2:237803181-237803203 CACTTTGACCTGGGAGGTAGGGG + Intronic
1169267902 20:4178123-4178145 CGCTTGAACCAGAGAGGTAGAGG - Intronic
1169499958 20:6149573-6149595 CACTTGAACCAGGGAGGTAGAGG - Intergenic
1170325150 20:15149043-15149065 CACTTTCACTAGATAGGTAGAGG - Intronic
1170642636 20:18168442-18168464 CACTTGAACCAGAGAGGCAGAGG + Intronic
1171353125 20:24520607-24520629 CACTTGAACCAGGGAGCCAGAGG + Intronic
1172517566 20:35545481-35545503 CACTTGAACCAGAGAGGCAGAGG + Intronic
1172918922 20:38465193-38465215 CACTTGAACCAGGGAGGTAGAGG - Intergenic
1172932108 20:38593803-38593825 CACTTTCACTGGATAGGTAGAGG - Intergenic
1173102209 20:40097624-40097646 CACTTTCACTAGATAGGTAGAGG + Intergenic
1174811959 20:53653687-53653709 CACTTGAACCAGGGAGGTAGAGG - Intergenic
1175348470 20:58300690-58300712 CACTTTGACCACTGAGCTACTGG + Intergenic
1175993208 20:62799773-62799795 CACGTTCACCTGAGAGCCTGAGG - Exonic
1176606089 21:8832650-8832672 CACTTTGACCAGTGGGCTGGTGG - Intergenic
1176955466 21:15097630-15097652 CACTTGAACCAGGGAGGTAGAGG + Intergenic
1177030829 21:15981015-15981037 CACTTTCACTGGATAGGTAGAGG - Intergenic
1177103020 21:16918482-16918504 CACTTTCACTGGACGGCTAGAGG + Intergenic
1177119953 21:17126331-17126353 CACTTTCACTGGATAGGTAGAGG + Intergenic
1177840404 21:26229242-26229264 CACTTTCACTGGATAGGTAGAGG - Intergenic
1178001507 21:28165485-28165507 CACTTTCACTGGATAGGTAGAGG + Intergenic
1179421393 21:41239459-41239481 CACTTGAACCCGGGAGCTAGAGG - Intronic
1179468140 21:41591720-41591742 CACTTGAACCTGAGAGGTAGAGG - Intergenic
1179650017 21:42802258-42802280 CACTTTCACTGGATAGGTAGAGG - Intergenic
1179721281 21:43317381-43317403 CACTTTAACCTGGGAGGTAGAGG - Intergenic
1179813892 21:43890819-43890841 CACTTTAACCTGGGAGGTAGAGG - Intronic
1180348387 22:11724256-11724278 CACTTTGACCAGTGGGCTGGTGG - Intergenic
1180356160 22:11842348-11842370 CACTTTGACCAGTGGGCTGGTGG - Intergenic
1180382097 22:12149979-12150001 CACTTTGACCAGTGGGCTGGTGG + Intergenic
1181028597 22:20139345-20139367 CACTTTCACTAGAGTGTGAGTGG + Intronic
1181098635 22:20523669-20523691 CACTTTCAGGCGAGACCTAGGGG + Intronic
1182629200 22:31671608-31671630 CACTTGAACCAGGGAGGTAGAGG + Intergenic
1183611531 22:38910275-38910297 CACTTGAACCAGGGAGGTAGAGG + Intergenic
1184330463 22:43823955-43823977 GAATTTCACCTGAGACCTAGAGG + Intergenic
949490505 3:4584536-4584558 CTCTTTGCCCAGAGAGTTAGTGG + Intronic
949725067 3:7034824-7034846 CACTTTCACTCCTGAGCTAGTGG - Intronic
950821604 3:15765754-15765776 CACTTGAACCAGGGAGCTGGAGG + Intronic
951315978 3:21190413-21190435 CACTTTCACTGGATAGATAGAGG - Intergenic
951341814 3:21497763-21497785 CACTTGAACCTGAGAGGTAGAGG + Intronic
952111976 3:30134488-30134510 TACTTTCAACAGTTAGCTAGTGG + Intergenic
952297310 3:32072791-32072813 CACTTTCACTGGATAGGTAGAGG + Intronic
952895749 3:38077705-38077727 CACTTTCACTAGATAAGTAGAGG - Intronic
953633422 3:44640459-44640481 CACTTGAACCAGGGAGGTAGAGG - Intronic
953825404 3:46247723-46247745 CACTTTCACTAGATAGGTAGAGG - Intronic
954233122 3:49234254-49234276 CACTTGAACCAGGGAGCTGGAGG - Intronic
954327591 3:49872011-49872033 CACATACACCAGAGATCAAGGGG - Intergenic
954731101 3:52662740-52662762 CACTTGAACCAGAGAGGCAGAGG + Intronic
955253722 3:57308159-57308181 CACTTTCACTGGATAGGTAGAGG + Intronic
955401154 3:58592462-58592484 CACTTTCACTGGATAGGTAGAGG + Intronic
955704388 3:61713242-61713264 CACTTGAACCAGGGAGCTGGAGG - Intronic
956548652 3:70436078-70436100 CACTTTCACTGGATAGGTAGAGG - Intergenic
956709565 3:72027482-72027504 CACTTTCACTGGATAGGTAGAGG + Intergenic
957059578 3:75471297-75471319 CACTTTCACCGGATAGGTAGAGG - Intergenic
957689285 3:83546405-83546427 AACTCTCACCAGAGAGCTACTGG + Intergenic
958742195 3:98088190-98088212 CCATTTCATCAGAGGGCTAGTGG + Intergenic
960005061 3:112773254-112773276 CACTTGAACCAGAGAGGCAGAGG + Intronic
960074362 3:113467373-113467395 TACTTTCACCAGGGAGTTGGAGG - Intronic
960309818 3:116106747-116106769 CACTTTCACTAGATAGGTAGAGG - Intronic
961293820 3:125868088-125868110 CACTTTCACTGGATAGGTAGAGG + Intergenic
961711321 3:128830628-128830650 CACTTTCACTAGATAAGTAGAGG - Intergenic
961892246 3:130140097-130140119 CACTTTCACTGGATAGGTAGAGG - Intergenic
962193241 3:133333114-133333136 AACTTTCATCATAGAACTAGAGG - Intronic
963424819 3:145112668-145112690 CACTTTCACTGGATAGGTAGAGG - Intergenic
963468914 3:145714677-145714699 CACTTTCACTGGATAGGTAGAGG + Intergenic
963521963 3:146366549-146366571 CACTTTCACTGGATAGGTAGAGG + Intergenic
964263716 3:154870764-154870786 CGCTTGAACCAGGGAGCTAGAGG - Intergenic
964299855 3:155275841-155275863 CACTTTCACTGGATAGGTAGAGG - Intergenic
964380333 3:156092323-156092345 CACTTGAACCAGGGAGGTAGAGG - Intronic
964940543 3:162154807-162154829 CACTTTCACTGGATAGGTAGAGG - Intergenic
965070713 3:163912565-163912587 CACTTTCACTGGATAGGTAGAGG + Intergenic
965104936 3:164343560-164343582 CACTTTCACTGGATAGGTAGAGG - Intergenic
965286430 3:166825527-166825549 CACTTTCACTGGATAGGTAGAGG - Intergenic
965336673 3:167435712-167435734 CACTTTCACTGGATAGGTAGAGG + Intergenic
965848987 3:172999495-172999517 CACTTGAACCAGGGAGGTAGAGG - Intronic
966085784 3:176065915-176065937 CACTTTCACTGGATAGGTAGAGG + Intergenic
966089688 3:176117975-176117997 CACTTTAACCAGGGAGATGGAGG + Intergenic
966232547 3:177667281-177667303 CACTTTCACTAGATAAGTAGAGG - Intergenic
966590185 3:181673945-181673967 CACTTTAACCCGAGAGGCAGAGG + Intergenic
967152438 3:186662299-186662321 CACTTTCACTGGATAGGTAGAGG + Intronic
967243870 3:187467701-187467723 CACTTTCACTGGATAGGTAGAGG - Intergenic
967561689 3:190924392-190924414 CACTTTCACTGGATAGGTAGAGG + Intergenic
967643514 3:191896771-191896793 CACTTTCACTGGATAGGTAGAGG - Intergenic
968466838 4:756294-756316 CACTTCAACCAGGGAGGTAGAGG - Intronic
968676569 4:1884475-1884497 CACTTGAACCAGGGAGCTGGAGG - Intronic
968719679 4:2192029-2192051 CACTTGAACCAGGGAGATAGAGG + Intronic
968958625 4:3731450-3731472 CACTTTGACTGGAGAGCCAGTGG + Intergenic
968986980 4:3880814-3880836 CACGTTCACCTGAGAGCTTGGGG + Intergenic
969651179 4:8469244-8469266 CACTCTCGCCAGATGGCTAGAGG - Intronic
969728851 4:8941328-8941350 CAAGTTCACCTGAGAGCTTGGGG - Intergenic
969752967 4:9126180-9126202 CACTTTCCACAGAAATCTAGTGG - Intergenic
970028890 4:11654960-11654982 CACTTTCACTGGATAGGTAGAGG - Intergenic
970042370 4:11810561-11810583 CACTTTCACTGGATAGGTAGAGG + Intergenic
970421045 4:15906018-15906040 CACTTGCCCCAGCGAGCTGGCGG - Intergenic
971329072 4:25667426-25667448 CACTTTAACCTGGGAGGTAGAGG + Intronic
971423683 4:26495928-26495950 CACTTGCACCAGGGAGGTGGAGG + Intergenic
972270071 4:37502473-37502495 CACTACCACCAGAGTGGTAGTGG - Intronic
972290233 4:37684867-37684889 CACTTGAACCAGAGAGCTGGAGG + Intronic
973167670 4:47097350-47097372 CACTTTCTCCAGAGAGCTGCAGG + Intronic
973372019 4:49258517-49258539 CACTTTGACCAGTGGGCTGGTGG + Intergenic
973388986 4:49536801-49536823 CACTTTGACCAGTGGGCTGGTGG - Intergenic
973702092 4:53547514-53547536 CACCTTCAGCAGAGAGCTACTGG + Intronic
974788315 4:66651370-66651392 CACTTGAACCAGAGAGGCAGAGG + Intergenic
975645771 4:76544498-76544520 CACTTGAACCTGGGAGCTAGAGG - Intronic
975861970 4:78686986-78687008 CACTTGCACCAGGGAGGCAGTGG + Intergenic
976558912 4:86479075-86479097 CACTTTCACTGGATAGGTAGAGG + Intronic
976648670 4:87411998-87412020 CACTTGAACCCGAGAGCTGGAGG + Intergenic
976719192 4:88153722-88153744 CACTTTCACTGGATAGGTAGAGG - Intronic
976739528 4:88344257-88344279 CACTTTCACTGGATAGGTAGAGG - Intergenic
977010613 4:91628358-91628380 CACTTTCACTGGATAGGTAGAGG + Intergenic
977012620 4:91656049-91656071 CACTTTCACTGGATAGGTAGAGG - Intergenic
977074898 4:92440399-92440421 CACTTTCACTGGATAGGTAGAGG - Intronic
977075851 4:92448256-92448278 CACTTGAACCCGAGAGGTAGAGG - Intronic
978031826 4:103945624-103945646 CACTTTCACTGGATAGGTAGAGG + Intergenic
978438927 4:108713432-108713454 CACTTTCACTAGATAGGTAGAGG + Intergenic
979894866 4:126146564-126146586 CACTTTCACTAGATAGGTAGAGG - Intergenic
980058807 4:128106105-128106127 CACTTGAACCAGGGAGCTGGAGG - Intronic
980327557 4:131367963-131367985 CACTTTGGCCTGGGAGCTAGAGG - Intergenic
980528224 4:134016958-134016980 CACTTTCACTGGATAGGTAGAGG + Intergenic
981291781 4:143084744-143084766 GAGTTTCACCACAGACCTAGAGG + Intergenic
981852465 4:149246984-149247006 CATTTTCAGCAGATAGCTGGAGG + Intergenic
981938511 4:150257837-150257859 CACTTGAACCAGGGAGGTAGAGG + Intergenic
982210391 4:153029971-153029993 CACTTTCACCACAGTGTCAGTGG + Intergenic
982396358 4:154919727-154919749 CACTTTCACTAGATAGGTAGAGG - Intergenic
983345900 4:166525016-166525038 CACTTTCACTGGATAGGTAGAGG + Intergenic
983448365 4:167880608-167880630 CACTTTCACTAGTTAGGTAGAGG + Intergenic
983659880 4:170120730-170120752 CACTTTCACTGGATAGGTAGAGG + Intergenic
983879928 4:172921709-172921731 CACTTTCACCTGGGAGGCAGAGG + Intronic
983883360 4:172957037-172957059 CACTTTCACTGGATAGGTAGAGG - Intronic
984389179 4:179106588-179106610 CACTCTCTCCAGAGAGTAAGTGG - Intergenic
985174314 4:187185312-187185334 CATTTTCAGCAGGGAGATAGAGG + Intergenic
985436062 4:189930441-189930463 CACTTTCACTAGATAGGTAAAGG + Intergenic
985738478 5:1600016-1600038 CACTTGAACCAGAGAGTTGGAGG - Intergenic
986549820 5:8940066-8940088 CACTTGAACCTGAGAGGTAGAGG + Intergenic
986554707 5:8999762-8999784 CACTTTCACTGGATAGGTAGAGG - Intergenic
987080294 5:14419771-14419793 CACAGCCACCAGAGAGCTGGGGG - Exonic
987487792 5:18542593-18542615 CACTTTCAGTAGACAGGTAGAGG + Intergenic
988988910 5:36650178-36650200 CACCCTCACCTGAGAGTTAGAGG - Intronic
990408828 5:55519664-55519686 CACTTGAACCAGGGAGCTGGCGG + Intronic
990593269 5:57287436-57287458 CACTTGAACCAGGGAGGTAGAGG - Intergenic
991148769 5:63340689-63340711 CATTTACACCAAAGAGCTAAAGG - Intergenic
991580476 5:68149478-68149500 CACTTTCGCCTGAGAACCAGGGG - Intergenic
991769900 5:70030634-70030656 CACTTGCACCCGAGAGGTGGAGG - Intronic
991849195 5:70906053-70906075 CACTTGCACCCGAGAGGTGGAGG - Intronic
992561886 5:77960468-77960490 CATTGTCACCAGACAGCCAGTGG + Intergenic
993027108 5:82660066-82660088 AGCTTTGACCAGAAAGCTAGTGG + Intergenic
993294220 5:86114131-86114153 CACTTGAACCAGGGAGGTAGAGG - Intergenic
993836990 5:92828241-92828263 CACTTTCACTAGATAGGTAGAGG + Intergenic
994532252 5:100985675-100985697 CACTTTCACTAGATAGGTAGAGG - Intergenic
994761727 5:103862434-103862456 CACTTGAACCAGGGAGGTAGAGG + Intergenic
994778581 5:104065072-104065094 CACTTTCACTAGATGGGTAGAGG - Intergenic
994985799 5:106932266-106932288 CACTTTCAGCAGAGAGGGAATGG - Intergenic
995296972 5:110534115-110534137 CACTTTCACTAGATAAGTAGAGG + Intronic
995479989 5:112583991-112584013 CACTTGAACCACAGAGCAAGAGG - Intergenic
995899066 5:117047804-117047826 CACTTTCACTAGATAGGTAGAGG - Intergenic
996179573 5:120401906-120401928 CACTTGAACCAGAGAGGCAGAGG + Intergenic
996528350 5:124501329-124501351 CACTTTCACTGGATAGGTAGAGG + Intergenic
997576349 5:134980512-134980534 CACTTGAACCAGGGAGCTGGAGG - Intronic
997897196 5:137729721-137729743 CAGTTTGACCAGAGTGCCAGGGG - Intronic
998693389 5:144612745-144612767 CACTTTCACTGGATAGGTAGAGG - Intergenic
998717175 5:144897639-144897661 CACTTGAACCAGAGAGGCAGAGG - Intergenic
998966222 5:147543293-147543315 CACTTGAACCTGAGAGGTAGAGG + Intergenic
999225575 5:150020821-150020843 CACTTGAACCAGGGAGGTAGAGG - Intronic
999920801 5:156318677-156318699 CACTTGAACCCGAGAGGTAGAGG - Intronic
1000935334 5:167299353-167299375 CACTTTCACTGGATAGGTAGAGG - Intronic
1002170452 5:177371524-177371546 CACCTTCACCAGAGAACTGGGGG - Exonic
1003866797 6:10370811-10370833 CACTTGAACCTGAGAGTTAGAGG + Intergenic
1004106567 6:12671639-12671661 CACTTTCACTAGATAGGTAGAGG + Intergenic
1004188967 6:13447655-13447677 CACTTGCACCCGGGAGGTAGAGG + Intronic
1004753872 6:18590554-18590576 CATTTTCATCAGAGAGCTCATGG + Intergenic
1004837346 6:19543397-19543419 CACTTTCACTGGATAGGTAGAGG + Intergenic
1005154771 6:22792214-22792236 CACTTGAACCAGAGAGGCAGGGG - Intergenic
1005689814 6:28293024-28293046 CACTTGAACCAGGGAGCCAGAGG - Intronic
1005707627 6:28470849-28470871 CACTTGAACCAGAGAGGCAGAGG + Intergenic
1005732625 6:28713477-28713499 CACTTGAACCCGAGAGGTAGAGG - Intergenic
1005995305 6:30927313-30927335 CACTTGTACCAGAGAGGTAGAGG - Intergenic
1006080533 6:31563074-31563096 CACTTGAACCCGAGAGGTAGAGG + Intergenic
1006286301 6:33097063-33097085 CTCTGTCACCAGAGAAGTAGGGG - Intergenic
1006856302 6:37135711-37135733 CACTTGAACCAGGGAGCTGGAGG + Intergenic
1006890852 6:37426879-37426901 CACTTCAACCAGAGGGCAAGAGG + Intergenic
1007643088 6:43358635-43358657 CACTTGAACCAGGGAGGTAGAGG - Intronic
1007702878 6:43774717-43774739 CACTCTCCCCTGGGAGCTAGGGG - Intronic
1007760434 6:44130137-44130159 CACTTCCACCAGGGAGCCGGAGG - Intronic
1007805747 6:44444545-44444567 AACTTGCATCAGAGAGCTAATGG - Intronic
1008476942 6:51942995-51943017 CACTTTCACTGGATAGGTAGAGG + Intronic
1008524920 6:52398288-52398310 CACTTGAACCAGAGAGGTGGAGG - Intronic
1008750456 6:54727730-54727752 CACTTTCACCATATAGCAACAGG - Intergenic
1010071379 6:71749772-71749794 CACTTTCACTGGATAGGTAGAGG - Intergenic
1010438976 6:75871331-75871353 CACTTTAACCAGAGAGGCGGAGG - Intronic
1011367560 6:86599592-86599614 CACTTTCACTGGATAGGTAGAGG - Intergenic
1011494481 6:87925005-87925027 CCCTATCCCCAGAGAGCTGGCGG + Intergenic
1012239786 6:96859077-96859099 CACTTGAACCAGAGAGTCAGAGG + Intergenic
1013407585 6:109857181-109857203 CACTTTCACTGGATAGGTAGAGG - Intergenic
1013738949 6:113260515-113260537 AACTTTCCCCAGAGAGTTTGGGG - Intergenic
1014362337 6:120494916-120494938 CACTTGAACCAGAGAGACAGAGG + Intergenic
1014396376 6:120929451-120929473 CACTTTCACTGGATAGGTAGAGG + Intergenic
1014543587 6:122705647-122705669 CACTTGAACCAGGGAGCTGGAGG - Intronic
1015165544 6:130196808-130196830 CACTTTCACTGGATAGGTAGAGG + Intronic
1015267050 6:131299729-131299751 CACTTTCACTGGATAGGTAGAGG + Intergenic
1015269951 6:131327674-131327696 CACTTTCACTGGATAGGTAGAGG + Intergenic
1016204861 6:141457308-141457330 CACTTTCACTAGATGGGTAGAGG + Intergenic
1016519109 6:144927452-144927474 CACTTTCACTAGATAGGTAGAGG + Intergenic
1016649990 6:146451852-146451874 CACTTTCACTAGATAGGTAGAGG - Intergenic
1017346655 6:153391093-153391115 CACTTGAACCTGAGAGGTAGAGG - Intergenic
1018241419 6:161779021-161779043 CACTTGAACCAGAGAGGTGGAGG - Intronic
1018521165 6:164653587-164653609 CACTTTCACTAGATAGGTACAGG - Intergenic
1019679725 7:2340144-2340166 CACTTGAACCAGGGAGGTAGAGG - Intronic
1019992527 7:4702424-4702446 CACTTGAACCAGGGAGGTAGAGG - Intronic
1020322452 7:6949589-6949611 CACTTTCACTGGATAGGTAGGGG - Intergenic
1021393977 7:20125097-20125119 CACTTTCACTGGATAGGTAGAGG + Intergenic
1021430215 7:20550277-20550299 CATTTTCACTAGATAGGTAGAGG + Intergenic
1021576500 7:22110094-22110116 CACTTTCTCCTGAGGGCCAGCGG + Intergenic
1021656619 7:22880148-22880170 CACCTTCCCCACAGAGCTGGGGG + Intergenic
1022373177 7:29789115-29789137 CACTTTCACTAGATAAGTAGAGG + Intergenic
1022447790 7:30484057-30484079 CGCTTTCACTAGATAGGTAGAGG + Intergenic
1022709409 7:32836856-32836878 CACTTTCACTAGATAGGTAGAGG + Intergenic
1024197876 7:47077299-47077321 CTCTTTAACCAGGGAGGTAGAGG + Intergenic
1024461843 7:49667551-49667573 CACTTTCAGCACTGTGCTAGGGG - Intergenic
1026744546 7:73000919-73000941 CACTTGAACCCGAGAGGTAGAGG - Intergenic
1027030652 7:74885584-74885606 CACTTGAACCCGAGAGGTAGAGG - Intergenic
1027099191 7:75364173-75364195 CACTTGAACCCGAGAGGTAGAGG + Intergenic
1028337291 7:89673454-89673476 CACTTGAACCAGGGAGGTAGAGG + Intergenic
1028690473 7:93644135-93644157 CACTTTCACTAGACAGGTAGAGG + Intronic
1029345111 7:99972728-99972750 CACTTGAACCAGAGAGGCAGAGG + Intronic
1029378440 7:100196705-100196727 CACTTGAACCCGAGAGGTAGAGG + Intronic
1030233020 7:107227790-107227812 CACTTTAACCCGGGAGCTGGAGG - Intronic
1030441351 7:109593257-109593279 CACTTTCACTGGATAGGTAGGGG - Intergenic
1031004969 7:116459798-116459820 CACTTTCACTAGATAAGTAGAGG + Intronic
1031122079 7:117733382-117733404 AATTTTTATCAGAGAGCTAGCGG + Intronic
1031364462 7:120887063-120887085 CACTTTCACTGGATAGGTAGAGG - Intergenic
1031400284 7:121319837-121319859 CACTTTCACTGGATAGGTAGAGG + Intergenic
1031422108 7:121565042-121565064 CACTTTCACTGGATAGGTAGAGG - Intergenic
1031637933 7:124123685-124123707 CACTTGAACCTGAGAGGTAGAGG + Intergenic
1032281002 7:130501259-130501281 CACTTTCACAAGGGACCCAGAGG + Intronic
1032699361 7:134365176-134365198 CACCTCCACCAGAGTCCTAGAGG - Intergenic
1033464631 7:141579487-141579509 CACTTTCACTAGATGGGTAGAGG - Intronic
1033964618 7:146959634-146959656 CACTTGAACCCGAGAGGTAGTGG + Intronic
1035870790 8:3134086-3134108 CACTTGAACCAGGGAGTTAGAGG + Intronic
1037382574 8:18303051-18303073 CACTTTTACCAAAGAGCTGCTGG + Intergenic
1038206057 8:25466602-25466624 CACCTTTACCATAGAGCTTGTGG + Intronic
1038525439 8:28269050-28269072 CACTTCTACCAGACACCTAGAGG - Intergenic
1042760727 8:72268965-72268987 CACTTTCACCAGGTGGATAGAGG + Intergenic
1043838089 8:85067751-85067773 CACTTTCACTGGATAGGTAGAGG + Intergenic
1044922296 8:97179354-97179376 CACTTTCACTAGATAAGTAGAGG + Intergenic
1045092636 8:98762337-98762359 CACTTGAACCCGAGAGGTAGAGG - Intronic
1045291933 8:100841180-100841202 CACTTGAACCAGAGAGGCAGAGG - Intergenic
1045543992 8:103111939-103111961 CAGTTTCAGCAGAGACCCAGAGG + Intergenic
1046294428 8:112200105-112200127 CACTTTCACTGGATAGGTAGAGG + Intergenic
1046698702 8:117375195-117375217 CACCTTCACCATAAATCTAGTGG + Intergenic
1047673249 8:127171719-127171741 CACTTGAACCAGGGAGCTGGAGG + Intergenic
1047856713 8:128918896-128918918 CACTTTCACTGGATAGGTAGAGG + Intergenic
1048135791 8:131745209-131745231 CACTTTCACTAGATAAGTAGAGG + Intergenic
1048585126 8:135768569-135768591 CACTTTCACTAGATAGGTAGAGG - Intergenic
1048728090 8:137409497-137409519 CACTTTCACTGGATAGGTAGAGG - Intergenic
1048763897 8:137826038-137826060 CACTTTCACTGGATAGGTAGAGG - Intergenic
1049790627 8:144470861-144470883 CACTTTCCCCTGAGAGATAAGGG - Intronic
1050257730 9:3812292-3812314 CACTTTCACTAGGTAGGTAGAGG - Intergenic
1050749584 9:8921575-8921597 CACTTTAACCAGGGAGGCAGAGG - Intronic
1050992274 9:12169697-12169719 CACTTTTACCAGATGGATAGAGG - Intergenic
1051316009 9:15833069-15833091 CACTTGAACCAGAGAGGTGGAGG - Intronic
1051953086 9:22659916-22659938 CACTTTCACTGGATAGGTAGAGG - Intergenic
1053379243 9:37635787-37635809 CACATTCCCCAGAGAAGTAGCGG + Intronic
1054807136 9:69405970-69405992 CACTTTCACTGGATAGGTAGAGG - Intergenic
1055627088 9:78185397-78185419 CACTTTCACTGGATAGGTAGAGG + Intergenic
1055882101 9:81013857-81013879 CACTTTCACTGGATAGGTAGAGG + Intergenic
1056522750 9:87415207-87415229 CACTTTCACTAGATAGGTAGAGG + Intergenic
1056641121 9:88371321-88371343 CACTTTTACCAGGGAGGCAGAGG + Intergenic
1056654723 9:88499649-88499671 CACTTGAACCAGAGAGGCAGAGG + Intergenic
1056848914 9:90064418-90064440 AACTTCCACCAGTGAGCCAGTGG - Intergenic
1056883277 9:90416858-90416880 TACTTTCACTAGATAGGTAGAGG + Intergenic
1057235146 9:93351880-93351902 TACTTTCACTAGATAGGTAGAGG + Intergenic
1057812234 9:98267037-98267059 CACTTTCACTGGATAGGTAGAGG - Intergenic
1058400185 9:104607470-104607492 CACTTGAACCAGGGAGGTAGAGG - Intergenic
1059159235 9:112018492-112018514 CACTTGAACCAGGGAGGTAGAGG - Intergenic
1059235004 9:112753465-112753487 CACTTTGACCAGGGAGGTGGAGG - Intronic
1059484844 9:114618577-114618599 CACTTGAACCAGAGAGGCAGAGG + Intronic
1059545868 9:115176054-115176076 CACTTTCACTAGATAGGTAGAGG - Intronic
1059574917 9:115477624-115477646 CACTTTCACTAGATAGGTAGAGG + Intergenic
1059575496 9:115483951-115483973 CACTTGAACCCGAGAGGTAGAGG - Intergenic
1060318122 9:122531882-122531904 CACTTTCACTGGATAGGTAGAGG - Intergenic
1060324726 9:122602950-122602972 CACTTTCAGCAGGGAGCTCTGGG + Intergenic
1060621259 9:125069132-125069154 CACTTTAACCCGAGAGGCAGAGG + Intronic
1060737529 9:126075842-126075864 CACTTTCACTGGATAGGTAGAGG - Intergenic
1060947246 9:127577222-127577244 CACTTGAACCAGAGAGGCAGGGG + Intronic
1061424183 9:130488931-130488953 CCCTTCCACCAGGGAGCCAGGGG - Intronic
1061536523 9:131253628-131253650 CACTTGAACCTGAGAGGTAGAGG - Intergenic
1061882940 9:133577105-133577127 CACTTTCCTCAGGGAGCCAGCGG + Intergenic
1062692402 9:137849319-137849341 CACTTTCACTGGATAGGTAGAGG + Intronic
1185858116 X:3554561-3554583 CACTTTCACTGGATAGGTAGAGG - Intergenic
1187005517 X:15229159-15229181 CACTTGAACCCGAGAGGTAGAGG + Intergenic
1188332630 X:28893503-28893525 CACTTTCACTGGATAGTTAGAGG - Intronic
1188463052 X:30450336-30450358 CACTTTCACTAGATAAGTAGAGG - Intergenic
1188553008 X:31381992-31382014 CACTTTCACTGGATAGGTAGAGG + Intronic
1189252295 X:39610863-39610885 AATTTTCACAAGAGACCTAGTGG - Intergenic
1189268500 X:39734229-39734251 CAATTTCTCCAGATAGCCAGAGG - Intergenic
1189481386 X:41394744-41394766 CACTTGAACCAGAGAGGCAGAGG - Intergenic
1190260588 X:48794369-48794391 CACTGTCATCAGAGAGCCACAGG - Intergenic
1191082623 X:56529656-56529678 CACTTTAACCAAGGAGCCAGAGG + Intergenic
1191222219 X:58001930-58001952 CACTTGAACCTGGGAGCTAGAGG + Intergenic
1192262668 X:69516324-69516346 CACAGTCACCAGAAAGTTAGTGG + Intronic
1192408918 X:70915157-70915179 CACTTGAACCAGAGAGGTGGAGG - Intergenic
1193081748 X:77412987-77413009 GACTTTCACAAGAGAGCGATAGG - Intergenic
1193331791 X:80243202-80243224 CACTTGAACCAGAGAGCCAGTGG - Intergenic
1193537489 X:82731884-82731906 CACTTTCACTGGATAGGTAGAGG + Intergenic
1193886231 X:86986083-86986105 CACTTTCACTGGATAGGTAGAGG + Intergenic
1194367406 X:93027209-93027231 CACTTTCACTAGATAGGTAGAGG + Intergenic
1195805478 X:108760937-108760959 CACTTTAACCAGGGAGGTGGAGG - Intergenic
1196780114 X:119376130-119376152 CACTTTCCCCAGGGTTCTAGGGG - Intergenic
1196943553 X:120801546-120801568 CACTTTGACCAGAGAAGAAGGGG + Intergenic
1197090847 X:122534661-122534683 CACTTTCACGAGAGCGGTATAGG - Intergenic
1198598753 X:138263084-138263106 CACTTTCACTGGATAGGTAGAGG + Intergenic
1198599091 X:138265749-138265771 CACTTTCACTGGATAGGTAGAGG - Intergenic
1198650399 X:138857363-138857385 CACTTTCACCAGCCAGCCAGGGG + Intronic
1198809348 X:140519899-140519921 CGCTTGAACCAGAGAGCTGGAGG - Intergenic
1199222307 X:145331473-145331495 CACTGTAACAAGAAAGCTAGAGG - Intergenic
1199433563 X:147787485-147787507 CCCTTAAGCCAGAGAGCTAGAGG + Intergenic
1199664276 X:150084161-150084183 CACTTGGGCCACAGAGCTAGAGG - Intergenic
1200675617 Y:6143468-6143490 CACTTTCACTAGATAGGTAGAGG + Intergenic
1201484460 Y:14477349-14477371 CACTTGAACCTGAGAGCTGGAGG + Intergenic
1201800925 Y:17954707-17954729 CTCTGTCACCAGAGAGCTTCTGG - Intergenic
1202076120 Y:21039524-21039546 CACTTTCACTGGATAGTTAGAGG - Intergenic
1202256548 Y:22927563-22927585 CAGCTTCAGCAGAGTGCTAGTGG + Intergenic
1202409539 Y:24561316-24561338 CAGCTTCAGCAGAGTGCTAGTGG + Intergenic
1202461243 Y:25108761-25108783 CAGCTTCAGCAGAGTGCTAGTGG - Intergenic