ID: 947319854

View in Genome Browser
Species Human (GRCh38)
Location 2:228904973-228904995
Sequence GAGCTAGTGGCTTAGAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947319851_947319854 23 Left 947319851 2:228904927-228904949 CCAGCTATTAACAGTCTTGAGAC 0: 1
1: 0
2: 2
3: 5
4: 59
Right 947319854 2:228904973-228904995 GAGCTAGTGGCTTAGAGAGATGG 0: 1
1: 0
2: 2
3: 14
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947319854 Original CRISPR GAGCTAGTGGCTTAGAGAGA TGG Intronic
900606926 1:3527882-3527904 GGACTAGTGGCTGAGAGAGGTGG - Intronic
902778821 1:18691706-18691728 AAGGCAGGGGCTTAGAGAGATGG - Intronic
903233215 1:21934235-21934257 GAGCCAGTGGCTTATGGGGAAGG - Intronic
903263826 1:22144734-22144756 GAGCTGGTGGCACAGGGAGAGGG + Intergenic
903651206 1:24923401-24923423 TATCTAGAGGCTGAGAGAGAGGG - Intronic
905733396 1:40311338-40311360 GAGCACGGGGCTTGGAGAGATGG - Intronic
906808997 1:48807431-48807453 GAGATTGTGGCTCAGGGAGATGG + Intronic
920205454 1:204287774-204287796 GAGACAATGGCTCAGAGAGAAGG + Intronic
920769398 1:208866696-208866718 GAGCAAGAGACTGAGAGAGAAGG - Intergenic
921749336 1:218774801-218774823 GGGCTTGTGCCTTAGGGAGAAGG - Intergenic
921924117 1:220697661-220697683 GACATAGGGGCTGAGAGAGATGG + Exonic
922947654 1:229530778-229530800 GAGGCAGTGGCATAGAGAGAAGG - Intronic
1063472675 10:6300860-6300882 AAGCTACTGCCTTTGAGAGAAGG + Intergenic
1066118011 10:32257291-32257313 GAGCAAGAGGCTTGGGGAGAGGG - Intergenic
1068768449 10:60792448-60792470 GCACTAGTGGCTTTGAGAGGAGG + Intronic
1071059023 10:81548290-81548312 GCTCAAGTGGCTTAGAGAGCTGG - Intergenic
1071531333 10:86392157-86392179 GAGTCAGGGGTTTAGAGAGAGGG + Intergenic
1076182358 10:128420039-128420061 GAGTTAATGGCAGAGAGAGAGGG - Intergenic
1079263853 11:18911098-18911120 AGGCTAGAGGATTAGAGAGATGG + Intergenic
1081872678 11:46390729-46390751 GTGCTAGGGGCTTGGAGGGAGGG - Intergenic
1085541691 11:77276395-77276417 GAGTCAGTGGCATAGGGAGAGGG - Intronic
1088813595 11:113407285-113407307 GAGCCAGTGGCACACAGAGAGGG + Intergenic
1090608947 11:128452979-128453001 GAGCTCTTGGCTTAGAGGAATGG - Intergenic
1091700259 12:2654323-2654345 AAGCTAATGGCTGAGAGGGAGGG + Intronic
1092244628 12:6856638-6856660 GAGGGAGTGGCAGAGAGAGAGGG - Intronic
1094396984 12:30017567-30017589 GTGTTAGTGGATTACAGAGATGG - Intergenic
1102905558 12:116672029-116672051 GAGCTTGTGCTTTAGAGAGGGGG + Intergenic
1103446292 12:120997270-120997292 GAGCTAAAGGCTCAGAGAGGGGG + Intronic
1106550025 13:30762979-30763001 GATTTAGTGCCTTGGAGAGAAGG + Intronic
1107049596 13:36032951-36032973 CAGCTACTGCCTTACAGAGAAGG - Intronic
1108731783 13:53242830-53242852 GAGCTAAGGGATTTGAGAGAAGG - Intergenic
1109131940 13:58597937-58597959 GAACTACTGGGTTAGAGTGATGG - Intergenic
1110842986 13:80163636-80163658 GAGCTTGTGGCTGAGATAAAAGG - Intergenic
1112010442 13:95289572-95289594 CAGCCAGTGGCTGAGGGAGAAGG - Intronic
1112824795 13:103379983-103380005 GAGCTAGGAGCTTGGAGAGATGG + Intergenic
1113136748 13:107099091-107099113 GAGCTTGTGTCATTGAGAGAAGG - Intergenic
1116874441 14:50097071-50097093 GAGCTAGAGGTCTAGAGAGGGGG + Intergenic
1117206716 14:53451108-53451130 GATATAGCTGCTTAGAGAGAGGG + Intergenic
1117317697 14:54589900-54589922 GGGCAAGAGGTTTAGAGAGATGG - Intronic
1118982276 14:70726492-70726514 GAGGTTGTGTCTTACAGAGAAGG - Intronic
1120749718 14:88186406-88186428 GAGATGGTGACTTAAAGAGAGGG + Intronic
1125927384 15:43573826-43573848 CAGCCAGTGCCTTAGAGAGACGG + Exonic
1125940527 15:43673391-43673413 CAGCCAGTGCCTTAGAGAGACGG + Intergenic
1126168203 15:45671751-45671773 GAGAAAGAGGCTAAGAGAGATGG - Intronic
1126451192 15:48811035-48811057 GAGCTAGTGGACTAGAGCCAGGG - Exonic
1127393039 15:58522220-58522242 GAGGCAGTGGCTGGGAGAGAAGG - Intronic
1129916387 15:79276624-79276646 GAGATAGTGGGTGAGAGGGAGGG + Intergenic
1130821552 15:87501488-87501510 GAGCTTGTGGGTAAGAAAGATGG - Intergenic
1131042398 15:89283043-89283065 CAGCTAGTTGCATACAGAGAAGG - Intronic
1135378693 16:21974387-21974409 GAGCAAGTGGCTAAGAAAAATGG + Intronic
1137842792 16:51655463-51655485 GAGCAAGAGGGTTAGTGAGAGGG + Intergenic
1138370600 16:56523602-56523624 CAGCTAGTGGCTGATGGAGAAGG - Intergenic
1138511175 16:57509290-57509312 GATCCAGGGGCTCAGAGAGATGG - Intergenic
1138511957 16:57513870-57513892 GATCTTGTGGCTTAGAGAATGGG - Intronic
1138572761 16:57886140-57886162 GAGCTAGTGGGTGACAGAGCTGG + Intronic
1139579174 16:67862047-67862069 GAGGGAATGGCTTAGGGAGATGG + Intronic
1140469022 16:75204546-75204568 GAGCTGGAGGTTTGGAGAGATGG - Intronic
1142638784 17:1272930-1272952 GAACTAGAGGCTGAGAGAGGCGG - Intergenic
1142656865 17:1400164-1400186 GAGCGAGAGGCTGAGAGAGTCGG - Exonic
1142809056 17:2386827-2386849 GAGCTGGTGGGTGAGAGAGTGGG + Exonic
1146666902 17:34711235-34711257 CAGATGGGGGCTTAGAGAGATGG - Intergenic
1150533868 17:66014570-66014592 GAGAGAGTTGCTTAGAGAGATGG - Intronic
1151397811 17:73835981-73836003 GTGCAAGTGGATTTGAGAGAAGG + Intergenic
1156497679 18:37536760-37536782 GAGCCTGTGGCTTTGGGAGATGG - Intronic
1156962321 18:43047709-43047731 AAGCCAGGGGCTCAGAGAGATGG + Intronic
1160832701 19:1111137-1111159 GAGCTAGGGGCTTCGAGGGAGGG - Intronic
1161288207 19:3479458-3479480 GAGGCAGAGGCTTAGAGGGAGGG + Intronic
1165392139 19:35545019-35545041 GAGCTGGAGACTTAGAGGGAGGG + Intronic
1165862661 19:38917439-38917461 GAGGCAGTGGCCCAGAGAGAGGG + Intronic
1166852530 19:45767450-45767472 GGGCGAGTGGCCTGGAGAGAGGG + Intronic
1167505987 19:49871340-49871362 GTCCTAGTGCCTTATAGAGAAGG - Intronic
1167613566 19:50518725-50518747 GAGCTGGTGGCTCAAGGAGACGG - Exonic
1168449196 19:56450009-56450031 GAGTTAGTGGCTTAAAGAGAAGG + Intronic
1168713426 19:58514252-58514274 CAGGTAGTCGCGTAGAGAGAAGG + Exonic
925167065 2:1722703-1722725 TAGCTAGAGGGTTATAGAGAAGG - Intronic
925568028 2:5277768-5277790 GACATTGTGGCTTAGAGAGATGG - Intergenic
925728268 2:6895604-6895626 GAGCTGGTTGAGTAGAGAGATGG + Intronic
929221028 2:39465331-39465353 GACCTAGTGGAACAGAGAGAAGG + Intergenic
931844895 2:66193430-66193452 GAGCTCCTGCCTTAGAGAGCAGG + Intergenic
932889005 2:75574240-75574262 GAGCTGCTGGCTGAGATAGATGG - Intergenic
933290020 2:80427485-80427507 CAGCTAGTGGATGTGAGAGAGGG + Intronic
934584704 2:95480959-95480981 GAGGTAGTCGGTTTGAGAGATGG - Intergenic
934788026 2:97029874-97029896 GAGGTAGTCGGTTTGAGAGATGG - Intergenic
935047374 2:99494207-99494229 GAGTTAGTGGCTGAGATACAAGG + Intergenic
936550252 2:113431980-113432002 TAGCTACTGGTTTAGAGAAAAGG - Intergenic
937742984 2:125377651-125377673 GTGTGAGTGGCTGAGAGAGAGGG - Intergenic
938036600 2:128039843-128039865 GACATAGGGGCTGAGAGAGATGG + Intergenic
938555392 2:132418730-132418752 GACCTAGTGGCTGGGAGACAAGG + Intronic
939331058 2:140761538-140761560 GAGCTAGTGAATAAGAGAGTGGG - Intronic
939546600 2:143562051-143562073 TAGATATTGGCTTAAAGAGATGG + Intronic
940547324 2:155103992-155104014 GAGTTATTGCCATAGAGAGAAGG + Intergenic
941303647 2:163833128-163833150 TTGCTAGTGGTGTAGAGAGAAGG - Intergenic
944583490 2:201153381-201153403 GAGCTGGAGGCCTAGGGAGATGG - Intronic
944936303 2:204572432-204572454 GAGCTACTGGTGTAGGGAGAGGG - Intronic
945849184 2:214984820-214984842 GAGTTAGGAGCTTAGAGTGATGG - Intronic
945943823 2:215975220-215975242 TAGATAGTGACTTAGAAAGACGG - Intronic
945990861 2:216394217-216394239 GAGGCAGTGGCTCAGAGATAAGG + Intergenic
946408474 2:219505109-219505131 GAGAGAGGGGCTTAGAGAGGTGG + Intronic
946871969 2:224092535-224092557 GTGCTAGAGACATAGAGAGAAGG + Intergenic
947319854 2:228904973-228904995 GAGCTAGTGGCTTAGAGAGATGG + Intronic
947442065 2:230132092-230132114 GGTCCAGTGGCTTAGAGAGTGGG + Intergenic
948722668 2:239911370-239911392 GAGCTGGTGGCAGGGAGAGAGGG - Intronic
1168794310 20:601155-601177 GAGCTGGTGGCTGGGAGAGAAGG + Intergenic
1170694616 20:18647340-18647362 GAGCTTGTCCCTTAGTGAGATGG + Intronic
1171243023 20:23586748-23586770 GTGCTAGTGTCCTGGAGAGAGGG + Intergenic
1171385767 20:24768497-24768519 GAGCGACTGGCTTGGAGATAAGG - Intergenic
1173401271 20:42728185-42728207 GAGGCACTGGCTTAGAGATAAGG - Intronic
1174480537 20:50828239-50828261 GAGCTAGGTGCCCAGAGAGATGG + Intronic
1177096958 21:16847793-16847815 CAGCTAGTGTCTCAGAAAGAAGG - Intergenic
1179038582 21:37782089-37782111 GAGTTAGTGTCAGAGAGAGACGG + Intronic
1180106145 21:45619299-45619321 CACCTAGTGGCTTAGAGCAATGG + Intergenic
1180608909 22:17083325-17083347 GAGCTAGGAGCTCAGAGGGAGGG + Intergenic
1183967146 22:41448492-41448514 GAGCTAGGGGAAAAGAGAGAAGG - Intergenic
1184452361 22:44590731-44590753 GAGACAGGGGCTTTGAGAGAGGG + Intergenic
953156885 3:40383708-40383730 AAGATGGTGGCTGAGAGAGAAGG + Intergenic
953915516 3:46917965-46917987 AAGCAAGTGGCTGAGAGACATGG - Intergenic
954283480 3:49601224-49601246 CAGCTAGTGGCTTAGAAATATGG + Intronic
955194305 3:56790799-56790821 AAGCTAGTGGCAGAAAGAGATGG - Intronic
955931566 3:64062645-64062667 GAGCTGGTGACCTAGAGATAGGG - Intergenic
956107526 3:65836410-65836432 GGACTAGTGGCTTAGTGATAAGG + Intronic
956410569 3:68974142-68974164 GAGTTAGTGTGTTAGAGATAAGG + Intergenic
958498007 3:94870134-94870156 GAGCTAGTGGTTTTCAGAGCTGG + Intergenic
958925122 3:100149274-100149296 GAACCAGAGGCTCAGAGAGATGG + Intronic
966299218 3:178460211-178460233 GTGCAAGTGGCTGACAGAGAAGG + Intronic
967368657 3:188717533-188717555 CAATAAGTGGCTTAGAGAGAAGG + Intronic
968748562 4:2373953-2373975 GAGCCAGGGGCTGGGAGAGATGG - Intronic
970970126 4:21973169-21973191 GAACTAGTGGTTTAGTGAAAAGG - Intergenic
973553403 4:52057738-52057760 GAGCCAGTGGCTTAGGAATAAGG - Intronic
977876005 4:102150812-102150834 GAGGCAGTGGCATAGTGAGAAGG - Intergenic
980714267 4:136611493-136611515 GAGCTAGGGGTTTAGACTGAAGG - Intergenic
982056827 4:151558848-151558870 GAGCTAGTCACTTAGACTGAAGG + Intronic
984260195 4:177435819-177435841 GAACTACTGGCTTGGAAAGAAGG - Intronic
986844688 5:11738841-11738863 GAGGTCATGGCTTATAGAGAGGG - Intronic
989661237 5:43799972-43799994 GTGCTATTGTCTTTGAGAGAGGG - Intergenic
990180198 5:53152413-53152435 GAGCTAGAGAGTAAGAGAGATGG - Intergenic
990366049 5:55071000-55071022 GGGCTGGAGGCTTCGAGAGAGGG - Intergenic
991471431 5:66973061-66973083 CATCTAGGGGCTAAGAGAGAAGG - Intronic
991659289 5:68934034-68934056 GAGCTAGAAGCTTGGACAGAAGG + Intergenic
992743148 5:79793951-79793973 TAGCTAGTGGGTAAGAGATAGGG + Intronic
993147682 5:84116506-84116528 GAGGTTGTGACTTAGAGAGCAGG - Intronic
995299287 5:110558764-110558786 GAGATAGTTGCTTGGAGAGTTGG - Intronic
996755094 5:126926974-126926996 GAGCTATTGGCTTGGGAAGATGG - Intronic
997743510 5:136278600-136278622 GAGCTAGGGGTTTAAAGAGATGG + Intronic
998725607 5:145009969-145009991 GAGCTAGTTACTAAGAGAGTAGG + Intergenic
999311682 5:150555595-150555617 GAGCCAGGGGCTTATAGAGAGGG + Exonic
1001572209 5:172737147-172737169 GAGTTAGTGACCTGGAGAGAAGG + Intergenic
1002402943 5:179002236-179002258 GAGCAAGAGGAGTAGAGAGAAGG + Intergenic
1004174182 6:13324602-13324624 GTGCGAGTGGCTGAGTGAGAAGG - Intronic
1004527561 6:16423596-16423618 GAGGTGGAGGCCTAGAGAGAGGG + Intronic
1004999124 6:21223323-21223345 GGGCAAGTGACTTAAAGAGAGGG + Intronic
1005125912 6:22446586-22446608 GTGCCAGTTGCTTAGAAAGAAGG + Intergenic
1006877076 6:37306978-37307000 GAGCTGGTCTCTGAGAGAGATGG - Intronic
1007369688 6:41418169-41418191 GTGCAAGTGGGTTAAAGAGAGGG - Intergenic
1008491154 6:52088581-52088603 AAGCTAGTGGTGTAGAGAGAGGG + Intergenic
1011465701 6:87654572-87654594 GAACTAGTGGTTAAGAGAGATGG - Intronic
1015011284 6:128351794-128351816 GTAGTAGGGGCTTAGAGAGATGG + Intronic
1015480884 6:133707563-133707585 TAGCAAGTGGCTTTGACAGATGG + Intergenic
1020174097 7:5868562-5868584 GAGCAAGTGTCTAAGAGTGAGGG + Intergenic
1021142619 7:17046090-17046112 TAGCCAGTAGCTTTGAGAGAAGG + Intergenic
1021412912 7:20348438-20348460 GAGCCAGAGGCTGAGACAGAAGG - Intronic
1022602232 7:31772261-31772283 AAGCTGTTGGCCTAGAGAGATGG - Intronic
1023396735 7:39758506-39758528 GACATAGAGGCTGAGAGAGATGG + Intergenic
1027216195 7:76185517-76185539 GATCTGGTGGCTTAGGGAGGAGG - Intergenic
1029084659 7:98001835-98001857 GAGCAAGTGTCTAAGAGTGAGGG - Intergenic
1029987135 7:104932530-104932552 GAGCTGGTGGGTGAGTGAGATGG - Intergenic
1031779389 7:125942291-125942313 GATCCAGAGGCTTAGGGAGATGG - Intergenic
1032951159 7:136914970-136914992 GTGCTAGTGAACTAGAGAGAGGG + Intronic
1032999896 7:137492603-137492625 GGGATAGTTGCTTAGAGAGGTGG + Intronic
1034149745 7:148905578-148905600 GAGCTAGAGGCTGAGCCAGAAGG - Intergenic
1038368446 8:26962111-26962133 GAGCCAGTGGCTTAGAGAGCAGG + Intergenic
1038907536 8:31922852-31922874 GAGCTTGTAGCTTAGTGGGAAGG + Intronic
1041339320 8:56825539-56825561 TTGCTAGAGGCTAAGAGAGAAGG + Intergenic
1041427511 8:57738999-57739021 GAGCGAGTTGCTTGGAGAGGTGG - Intergenic
1044367250 8:91363237-91363259 CATCTAGTAGCTTGGAGAGATGG + Intronic
1044506585 8:93027248-93027270 GAGCCACTGGCCAAGAGAGAGGG + Intergenic
1045638249 8:104218179-104218201 AGGCTAGTTGCTGAGAGAGACGG - Intronic
1048072622 8:131038914-131038936 GGGTTTGTGGCTTAGAGATACGG + Intronic
1051504136 9:17809246-17809268 GAGGAAGTGGGTCAGAGAGAGGG - Intergenic
1051979265 9:22994359-22994381 AAACTAGTGGCTTAGGCAGAGGG - Intergenic
1056319568 9:85423634-85423656 GAGCTAGAGGTTTAGAGGGCTGG - Intergenic
1057307535 9:93920934-93920956 GAGCTAGGGGATCAGAAAGAGGG - Intergenic
1058583708 9:106484978-106485000 GTGCCATGGGCTTAGAGAGAAGG - Intergenic
1058782300 9:108350534-108350556 GAGCAGGTGGGTTAAAGAGAGGG + Intergenic
1059868515 9:118545098-118545120 GAGAGAGCTGCTTAGAGAGACGG + Intergenic
1062539959 9:137037205-137037227 TGGCTAATGGCTTAGAGTGAAGG + Exonic
1185505961 X:632306-632328 GAGTAAGAGGCTCAGAGAGAGGG + Intronic
1186584463 X:10857634-10857656 GACCAAGAGGCTTTGAGAGAAGG - Intergenic
1186730394 X:12403441-12403463 GAGTTAGTGGAGTAGAAAGAGGG - Intronic
1186957866 X:14702861-14702883 GATCCAGAGGCTTAGAGACAGGG + Intronic
1187333281 X:18360236-18360258 GAGAAAGTGTCTTAGAGTGAAGG + Intergenic
1189040084 X:37533187-37533209 GAGGTATTGGATTAGGGAGAGGG - Intronic
1189701829 X:43720371-43720393 GAGACAGGGGTTTAGAGAGATGG + Intronic
1190903968 X:54707873-54707895 GAACTTGTGGCCCAGAGAGAGGG + Intergenic
1195431943 X:104798751-104798773 AAGCAAGTGGCTTAAAGAGGTGG - Intronic
1195579373 X:106483960-106483982 GAGCTATAGGCATAGGGAGAAGG - Intergenic
1199486724 X:148356600-148356622 GAATTACTGGCTTAGAGAAAGGG + Intergenic
1199573794 X:149293299-149293321 GAGCAAGTGGCCCAGAGAGAAGG + Intergenic
1202031316 Y:20577102-20577124 GAGCTGATGGCTTAGAGAACTGG - Intronic