ID: 947319855

View in Genome Browser
Species Human (GRCh38)
Location 2:228904976-228904998
Sequence CTAGTGGCTTAGAGAGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947319851_947319855 26 Left 947319851 2:228904927-228904949 CCAGCTATTAACAGTCTTGAGAC 0: 1
1: 0
2: 2
3: 5
4: 59
Right 947319855 2:228904976-228904998 CTAGTGGCTTAGAGAGATGGTGG 0: 1
1: 0
2: 0
3: 20
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947319855 Original CRISPR CTAGTGGCTTAGAGAGATGG TGG Intronic
905644698 1:39617139-39617161 TGAGTGGCTTTGAGTGATGGTGG + Intergenic
905733393 1:40311335-40311357 CACGGGGCTTGGAGAGATGGGGG - Intronic
906069165 1:43005208-43005230 GTAGTGGCACAGAGAGATGGAGG + Intergenic
907280107 1:53341787-53341809 CAAGAGGCTTAGAGAGGTGAAGG - Intergenic
907983177 1:59504998-59505020 CTAGTGGGAAAGAGAGATCGAGG + Intronic
908836250 1:68231997-68232019 CTAGTGGCTAAGAGAAAAGGAGG - Intronic
915023517 1:152804888-152804910 CTAGGGGCTTAGACAGAGCGTGG + Exonic
915124180 1:153651754-153651776 CGAGATGTTTAGAGAGATGGTGG + Intergenic
915469339 1:156116125-156116147 CTAGTGTCTTCGAGGGTTGGGGG + Intronic
916661127 1:166923001-166923023 CTACTTGCTTACAGAGAGGGAGG + Intronic
917500033 1:175577569-175577591 CAAGTGGCTTGGAGGGCTGGGGG + Intronic
918052844 1:180989883-180989905 CTTGTGGCTTAGTGACAAGGAGG - Intronic
918831539 1:189405185-189405207 CTAGTGGAGTAGTGAGAAGGGGG - Intergenic
919803760 1:201368721-201368743 CAAGTGCCTGAGTGAGATGGGGG - Intronic
921701671 1:218275487-218275509 CAAGTGTCCTAGAAAGATGGAGG + Intergenic
921924120 1:220697664-220697686 ATAGGGGCTGAGAGAGATGGGGG + Exonic
923286356 1:232499819-232499841 CTAGTGGCTAACACAGCTGGTGG + Intronic
1063860849 10:10306284-10306306 CTAGTGGCTTATAGAAATACAGG - Intergenic
1067055363 10:43046756-43046778 CTAGAGTCTGACAGAGATGGGGG - Intergenic
1067093679 10:43284771-43284793 CCAGAGGCAGAGAGAGATGGGGG + Intergenic
1068835284 10:61546006-61546028 CTAGGGCCTCGGAGAGATGGAGG + Intergenic
1069059823 10:63883823-63883845 CTAGTAGCTTAGAGTGAATGTGG + Intergenic
1070857603 10:79619758-79619780 GTAGTTGCTTTGACAGATGGTGG - Intergenic
1073547397 10:104362590-104362612 ACAGTGGCTTTAAGAGATGGGGG - Intronic
1075127764 10:119714293-119714315 TTAGTAGATTAGAGAGCTGGAGG + Intergenic
1077637234 11:3851536-3851558 ATAGGGGCTTATAGAGATGAGGG + Intergenic
1079372909 11:19867247-19867269 CTATTGGCTTAGAGGGAATGAGG - Intronic
1080579529 11:33630974-33630996 CTAGTGGAGGAGAGAGGTGGAGG + Intronic
1081521289 11:43883844-43883866 CTAGTGGGTTAGTGAGAAGTTGG + Intronic
1081872677 11:46390726-46390748 CTAGGGGCTTGGAGGGAGGGCGG - Intergenic
1083624264 11:64064099-64064121 CGAGGGGCTTGGAGAGATAGGGG - Intronic
1085378814 11:76093735-76093757 TTATTGGCTTAAAGAGATGTTGG + Intronic
1086731518 11:90256370-90256392 ATAGTGGCTTTGAGAGCTGTTGG + Intergenic
1087043160 11:93821133-93821155 CTTGTGGCTTTGAGAGATGTTGG + Exonic
1087761128 11:102105385-102105407 CCAGTTGCTCAGAGATATGGAGG - Intergenic
1089974871 11:122723712-122723734 CCGGTGGCTTAGAGAGTTAGTGG + Intronic
1089979635 11:122761670-122761692 CTAGTGGGTTAGAGAGAAAAGGG + Intronic
1091700260 12:2654326-2654348 CTAATGGCTGAGAGGGAGGGAGG + Intronic
1091726384 12:2849281-2849303 CTTGTGCCTTGGAGAGATGGTGG + Intronic
1094630670 12:32170812-32170834 CTACTGGCTTCTAGGGATGGAGG + Intronic
1094637485 12:32240454-32240476 CTGCTGGCTTTGAAAGATGGAGG - Intronic
1096258653 12:50077661-50077683 CTTGGGGCAGAGAGAGATGGGGG + Intronic
1097282396 12:57852950-57852972 CTAGGGGATTGGAGAGGTGGGGG - Intergenic
1099849346 12:88072828-88072850 CTAGTTGGTTAGATAGATTGGGG + Intronic
1100354316 12:93814691-93814713 CTGGAGGCTCAGAGAGTTGGTGG - Intronic
1100444221 12:94646244-94646266 CTAATAGGTTAGAGAGATGGGGG + Intronic
1101253981 12:102959292-102959314 CTAGTGGTAGAGGGAGATGGAGG - Intronic
1101319295 12:103659163-103659185 CTATTGGCTAATAGATATGGTGG + Intronic
1101799045 12:108004506-108004528 CAGGTGGCCTATAGAGATGGAGG - Intergenic
1106476013 13:30098742-30098764 GTAGAGGATGAGAGAGATGGAGG - Intergenic
1106945319 13:34821020-34821042 CACGTGGCTTTGAGAGGTGGAGG - Intergenic
1109131939 13:58597934-58597956 CTACTGGGTTAGAGTGATGGAGG - Intergenic
1111438488 13:88244582-88244604 CTAGTTTCTTAGAGAGCTAGTGG + Intergenic
1112010438 13:95289569-95289591 CCAGTGGCTGAGGGAGAAGGGGG - Intronic
1115196944 14:30811873-30811895 CTACAGTCTTATAGAGATGGGGG - Intergenic
1115634222 14:35276000-35276022 CTACTGGCACATAGAGATGGGGG + Intronic
1117029012 14:51651118-51651140 ATAGTGGCTTTGGGGGATGGAGG - Intronic
1117201730 14:53396694-53396716 GTGGTGGCTGAGAGAGATGAAGG + Intergenic
1117330997 14:54711868-54711890 TTAGGGGCTGAGAGAAATGGAGG - Intronic
1123412176 15:20069682-20069704 CTTTTGGCTTAGTGAGTTGGTGG + Intergenic
1123521520 15:21076802-21076824 CTTTTGGCTTAGTGAGTTGGTGG + Intergenic
1124796126 15:32782053-32782075 CTTCTGGCTAAGAGAGATGAAGG - Intronic
1126752271 15:51888753-51888775 CTAGTGGCTAAGAGAGAAAATGG - Intronic
1126752490 15:51891393-51891415 CTAGTGGCTTGATGAGATGCAGG + Intronic
1135847809 16:25934623-25934645 TTAGTGTCTTAGAGAAATGCAGG + Intronic
1137591434 16:49696513-49696535 CCAGTGGCTTTGGGAGAAGGAGG + Intronic
1137712358 16:50575222-50575244 CTAGGGGCTGAGAGATAGGGAGG + Intronic
1140289557 16:73640032-73640054 CTCCTGGCTTTGAGGGATGGAGG - Intergenic
1140844734 16:78875647-78875669 ATAGAAGCTTAGAAAGATGGAGG + Intronic
1140916732 16:79500523-79500545 ACAGTGGCTTAGAGAGAAGAAGG - Intergenic
1141640132 16:85336037-85336059 CTAGTGTCTCCGAGATATGGAGG + Intergenic
1144483875 17:15649089-15649111 CTAATGTATTAGAGAGATGTGGG - Intronic
1146957145 17:36942446-36942468 CCAGTGGCTTACAGAGAGCGAGG - Intronic
1147654400 17:42080587-42080609 CCATTGGCTGAGGGAGATGGTGG + Intergenic
1149011844 17:51865018-51865040 CTAGTGTCTTAGGGAGAGTGGGG + Intronic
1150271942 17:63872518-63872540 CCACTGGCTTAGAGGGCTGGGGG - Intronic
1156497675 18:37536757-37536779 CCTGTGGCTTTGGGAGATGGGGG - Intronic
1157716917 18:49894257-49894279 CTTGTGGCTTGTAGAGATGGTGG + Intronic
1158083878 18:53626596-53626618 CTAGTGACTTAGTGAGTTGAAGG - Intergenic
1160288784 18:77571593-77571615 CTAGTGGCCAAGAGAAGTGGAGG - Intergenic
1164861001 19:31562182-31562204 GCAGTGGCATGGAGAGATGGAGG - Intergenic
1165341543 19:35215756-35215778 AAAGTGGAGTAGAGAGATGGAGG + Intergenic
1165358523 19:35319098-35319120 ACAGTGACTCAGAGAGATGGGGG + Intergenic
1165467060 19:35981050-35981072 CTAGAGGCAAAAAGAGATGGGGG - Intergenic
1168402810 19:56095693-56095715 CTGGTTGCTTAGAGAGCTGCAGG + Intronic
1168472559 19:56651299-56651321 CTAGTGGTTAAGAGACATGCTGG - Intronic
926657302 2:15422130-15422152 CAAGGGGCTAAGGGAGATGGAGG - Intronic
927869260 2:26613393-26613415 CCAGGGGCTTAGAGGGAAGGTGG - Intronic
928387572 2:30883381-30883403 CTAGTGGTTTGGAGAGGTGGTGG - Intergenic
932293860 2:70608200-70608222 CCAATGGCTTAGAGGGTTGGAGG + Intronic
932614513 2:73223419-73223441 CCACTGGCTTAGGGAGCTGGGGG - Exonic
933639658 2:84745966-84745988 GTAGTAGATTAGAGAGATGAAGG + Intronic
934584701 2:95480956-95480978 GTAGTCGGTTTGAGAGATGGGGG - Intergenic
934788023 2:97029871-97029893 GTAGTCGGTTTGAGAGATGGGGG - Intergenic
938036603 2:128039846-128039868 ATAGGGGCTGAGAGAGATGGGGG + Intergenic
939857495 2:147377749-147377771 CCAGTGGTTTGGAGAGATGGAGG + Intergenic
941455055 2:165705243-165705265 CCAGTGGCTTAGAGAAAGGAGGG - Intergenic
946408475 2:219505112-219505134 AGAGGGGCTTAGAGAGGTGGTGG + Intronic
946942488 2:224784236-224784258 GGAGTGTCTTAGAGTGATGGGGG - Intronic
947319855 2:228904976-228904998 CTAGTGGCTTAGAGAGATGGTGG + Intronic
948005088 2:234601750-234601772 CTATTGGCTTAGTGATTTGGGGG + Intergenic
948340044 2:237242517-237242539 CCAAATGCTTAGAGAGATGGGGG + Intergenic
1169332391 20:4726366-4726388 CAAGTGGTTTACAGAGATGATGG - Exonic
1173699925 20:45060617-45060639 CTGGAGGCTTAGAGAGATATAGG - Intronic
1173979864 20:47215410-47215432 TTAATGGCTTAGGGGGATGGTGG + Intronic
1174560563 20:51428033-51428055 CTAGTGGGTGAGAGGGAAGGAGG + Intronic
1175091974 20:56512208-56512230 CAGGTGGCCTAGACAGATGGTGG + Intronic
1175644746 20:60661513-60661535 CCAGTGGCTTGGAGGGAAGGGGG + Intergenic
1177096957 21:16847790-16847812 CTAGTGTCTCAGAAAGAAGGAGG - Intergenic
1179893412 21:44349201-44349223 ATGGTGGGTTAGTGAGATGGTGG + Intergenic
1181426890 22:22849489-22849511 CTAGTCTATTAGAGAGATGGGGG + Intronic
1182096755 22:27630848-27630870 CAGGTGGCTTAGAGGGATGAAGG - Intergenic
1182733380 22:32513103-32513125 CTAGTGGCCGAGTGTGATGGGGG + Exonic
1184994619 22:48196448-48196470 CCAGTGGCTTAGAGATAAAGTGG + Intergenic
1185412081 22:50687996-50688018 CTAGTTGCTTGGAGGGAGGGCGG + Intergenic
950108701 3:10404821-10404843 CTTGGGGCTTAGAGGCATGGAGG + Intronic
954109902 3:48428177-48428199 CAAGTGGCTTGGAGGGATTGTGG - Intronic
954881048 3:53836261-53836283 CCACTGTCTTAGGGAGATGGAGG - Intronic
956254464 3:67269039-67269061 CCAGGGGCTCAGAGAGGTGGGGG + Intergenic
956314902 3:67924039-67924061 CTAGGGGCTAAGAGAGATAGGGG + Intergenic
956620996 3:71221419-71221441 CAAGTGGCTTAGAGAAGTGGAGG + Intronic
956722955 3:72134291-72134313 CTAATGGTTTAAAGAGATGAAGG - Intergenic
960164719 3:114388488-114388510 CAAGTGGCTTAGAGATGTGGTGG + Intronic
960542266 3:118874146-118874168 CCAGTGGCTGAGAGAGAAAGAGG + Intergenic
962263497 3:133929386-133929408 GTGGTGGCTGAGAGAGATGCAGG - Exonic
968748558 4:2373950-2373972 CCAGGGGCTGGGAGAGATGGGGG - Intronic
971697238 4:29922037-29922059 CAAGTGACTTTGAAAGATGGAGG + Intergenic
972390811 4:38611163-38611185 TGAGTGCCTTGGAGAGATGGTGG + Intergenic
972984211 4:44744134-44744156 CTTGTGGGGTGGAGAGATGGGGG - Intergenic
973103901 4:46306740-46306762 CCAGTGTCCTAGAGAGCTGGAGG - Intronic
975048842 4:69833823-69833845 ATAGTGGAGTAGTGAGATGGTGG - Intronic
982447204 4:155506375-155506397 CTTTTGGCTTAGAGATTTGGGGG + Intergenic
984453718 4:179938242-179938264 GTAGTGGGTTAGAGAGTGGGAGG + Intergenic
986449802 5:7852525-7852547 CCTGGGGCTTAGAGACATGGTGG - Intronic
990180197 5:53152410-53152432 CTAGAGAGTAAGAGAGATGGAGG - Intergenic
996755091 5:126926971-126926993 CTATTGGCTTGGGAAGATGGGGG - Intronic
997425713 5:133801362-133801384 CTTGTGGCCTGGGGAGATGGTGG - Intergenic
998172755 5:139882120-139882142 GTAGTGGGCTGGAGAGATGGGGG + Intronic
998341256 5:141419786-141419808 CTAGTCGCTGTAAGAGATGGAGG + Exonic
998347715 5:141478694-141478716 TTAGTGCCTTTGTGAGATGGTGG + Intronic
999404074 5:151291601-151291623 CTAGTGGCTTGAATAAATGGAGG + Intronic
1003287401 6:4746575-4746597 CTGGTGGCTGAGAGAGGAGGCGG + Intronic
1003897555 6:10622051-10622073 CCAGTGGCTTGGAGAGCTGTCGG + Intronic
1006177006 6:32128499-32128521 GTAGTGGCTGGGGGAGATGGTGG - Intergenic
1007791331 6:44310506-44310528 CAAGTGGAGTAGAGAAATGGGGG + Intronic
1010151820 6:72741512-72741534 GTAGTAGGTTAGAGAGTTGGAGG + Intronic
1010247896 6:73678971-73678993 CTAGTGGAATACAGACATGGTGG - Intergenic
1010445644 6:75945810-75945832 GTAGTGTCTTAGAAAGAGGGTGG - Intronic
1014137186 6:117903934-117903956 CTTTTTGCTAAGAGAGATGGAGG - Intergenic
1015733388 6:136371426-136371448 CCTGTGGCTTAGAGGGTTGGAGG + Intronic
1016699096 6:147033802-147033824 CTAGTGGCCGAGTGTGATGGGGG - Intergenic
1018002607 6:159593023-159593045 CCCCTGGCTTAGAGAGATGATGG - Intergenic
1019142918 6:169959613-169959635 CTAGTGGCTTTGAGACACAGAGG - Intergenic
1019506560 7:1394328-1394350 CCACTGGCTCAGAGAGATGGGGG + Intergenic
1022026535 7:26452906-26452928 ATAGTGGCTTAAAGACATGCAGG - Intergenic
1023544772 7:41306828-41306850 CTAGGGGGTTGGAGAGAGGGTGG + Intergenic
1023606495 7:41936191-41936213 CTAGGGGCTCAGAGAGATGAAGG + Intergenic
1025930384 7:65989009-65989031 CTTTTGGCTTAGTGAGTTGGTGG - Intergenic
1027216192 7:76185514-76185536 CTGGTGGCTTAGGGAGGAGGGGG - Intergenic
1029987134 7:104932527-104932549 CTGGTGGGTGAGTGAGATGGTGG - Intergenic
1030845270 7:114401379-114401401 CTATTGACTTGAAGAGATGGAGG + Intronic
1032419098 7:131763551-131763573 CCAGTGGCTTAGAGAAATTAGGG - Intergenic
1033046412 7:137966416-137966438 CCAGTGGCTCAGGGAGAAGGAGG + Intronic
1034898179 7:154890918-154890940 CTAGTGTCATAGAAAGATGTAGG + Intronic
1035277877 7:157758713-157758735 CTACTGGCTCAGAGACGTGGAGG + Intronic
1037066172 8:14580813-14580835 GTAGTGGCCTGGAGAGATGGAGG + Intronic
1037767542 8:21781359-21781381 CAAGTGGCTTAGAGTGGTGGTGG - Intronic
1037791469 8:21946496-21946518 CAAGTGGTTAAGAGACATGGAGG + Intronic
1038015196 8:23508937-23508959 CTGGTTGATTAGAGAGAGGGCGG - Intergenic
1039786507 8:40838859-40838881 TGAGTGGCTTAGAGAGAATGAGG + Intronic
1039840083 8:41286770-41286792 CTGGTGACCTAAAGAGATGGGGG + Intronic
1040044562 8:42949399-42949421 CAAGTGACTTAGTGAGAAGGGGG + Intronic
1042760343 8:72265698-72265720 CTGGTCGTTTAAAGAGATGGAGG - Intergenic
1044703187 8:94983013-94983035 ATAGAGGCTTAGGGAGATGGTGG - Intronic
1045690609 8:104756414-104756436 CTAGTGGCTTATACAAATAGGGG - Intronic
1046398354 8:113671260-113671282 CTAATGGCTTTGAAAGATGAAGG - Intergenic
1050734205 9:8744857-8744879 ATAGTATCTTAGAGAGATGTGGG - Intronic
1062206995 9:135342810-135342832 CTGGTGGCCTGGGGAGATGGGGG + Intergenic
1203654235 Un_KI270752v1:7911-7933 CGACTGGATTTGAGAGATGGGGG - Intergenic
1186272214 X:7901253-7901275 TTATTTGCTTAGAAAGATGGAGG - Intronic
1193352873 X:80482532-80482554 GTAGTGGCTTACAGATATGTGGG + Intergenic
1195097862 X:101523337-101523359 CTAGTGGCTGAATGAGGTGGTGG + Intronic
1195545856 X:106111836-106111858 CCACTGGCTTAGAGTGATGCAGG + Intergenic
1198614051 X:138434618-138434640 CTAGAAGCTTTGAGAGATGTAGG + Intergenic
1201450054 Y:14102158-14102180 TTATTTGCTTAGAAAGATGGAGG - Intergenic