ID: 947319856

View in Genome Browser
Species Human (GRCh38)
Location 2:228904980-228905002
Sequence TGGCTTAGAGAGATGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947319851_947319856 30 Left 947319851 2:228904927-228904949 CCAGCTATTAACAGTCTTGAGAC 0: 1
1: 0
2: 2
3: 5
4: 59
Right 947319856 2:228904980-228905002 TGGCTTAGAGAGATGGTGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947319856 Original CRISPR TGGCTTAGAGAGATGGTGGC AGG Intronic
901010152 1:6196250-6196272 TGGCTCAGAGGGAGGGAGGCAGG + Intronic
901667225 1:10833103-10833125 TGGCTTGGAGAGAGGCTGGCTGG - Intergenic
901758488 1:11455722-11455744 TGGGCTAGGGAGAGGGTGGCGGG - Intergenic
901921925 1:12542848-12542870 AGTCTTAGAGAGTTGGTGGCGGG + Intergenic
903588791 1:24438507-24438529 GGGCTTAGAGAGCTGAGGGCAGG - Intronic
906284935 1:44581068-44581090 TGGCTGAGAGAGAGAGTGTCCGG + Intronic
906567303 1:46810523-46810545 TGCAGTAGAGAGTTGGTGGCAGG + Intronic
906584052 1:46961109-46961131 TGCAGTAGAGAGTTGGTGGCAGG + Intergenic
907441502 1:54481403-54481425 TGGGTAAGAGTGATGGTGGCTGG - Intergenic
908053431 1:60257524-60257546 TGCCTTAGAGAAATGCTAGCTGG + Intergenic
909289981 1:73870182-73870204 TGGAGTAGAGAGGTGGTAGCTGG + Intergenic
912121821 1:106480451-106480473 TGTCTTACATAGATGGTGGCAGG - Intergenic
912166530 1:107048089-107048111 TGGCATGTAGAGATGGAGGCAGG - Intergenic
913009288 1:114666990-114667012 TGGCTAAAGGAGATGGTGCCTGG - Intronic
915133627 1:153713933-153713955 TTTTTTAGAGAGATGGTGTCTGG + Intergenic
916739372 1:167635183-167635205 TGGCTCAGTGAGAGGGTGGGTGG - Intronic
918480962 1:184975911-184975933 TGGCAGAGAGAGGTGATGGCTGG - Intergenic
918969534 1:191396795-191396817 TGTCTTACACGGATGGTGGCAGG - Intergenic
920580430 1:207101897-207101919 TTGGTGAGAGAGAAGGTGGCTGG + Intergenic
924152555 1:241143452-241143474 TGTCTTACATGGATGGTGGCAGG + Intronic
1063292505 10:4763877-4763899 TGGCTTGGGGAGCTGGAGGCAGG - Intergenic
1063450409 10:6146367-6146389 TGGGGTAGAGAGATGGGGGAGGG + Exonic
1068125744 10:52840216-52840238 TGGCTCAGGGAGATGGAGACTGG + Intergenic
1069517316 10:69088260-69088282 GGGCTTACAGAGAAGATGGCTGG - Intronic
1069776713 10:70931538-70931560 TGGTGTACAGACATGGTGGCTGG + Intergenic
1070344634 10:75529971-75529993 CAGCTCAGAGAGATGGTGGAAGG + Intronic
1071497535 10:86179216-86179238 TGGCTTTGTGAGCTGGTGGCAGG - Intronic
1071523161 10:86343413-86343435 TCCATTAGTGAGATGGTGGCAGG - Intronic
1074112015 10:110429472-110429494 TGGATTAGAGAGATGGTAGCTGG - Intergenic
1075040431 10:119103764-119103786 TGGATTAGAGAAATTGAGGCAGG + Intergenic
1075354102 10:121755670-121755692 TGTCTTACATGGATGGTGGCAGG + Intronic
1075412926 10:122242244-122242266 TGGCTGAGTCAGATGGTGGCTGG - Intronic
1075437317 10:122454654-122454676 TGGCTGAGTGAGATGGCAGCTGG + Exonic
1076841914 10:133050018-133050040 TGGCTTGGGGAGATCGTGGATGG - Intergenic
1076841971 10:133050190-133050212 TGGCTCGGAGAGATCGTGGATGG + Intergenic
1077094335 11:792953-792975 CTGCTTAAAGAGATGCTGGCGGG - Exonic
1077543705 11:3159725-3159747 TGAGTCAGGGAGATGGTGGCTGG + Intronic
1078464487 11:11540078-11540100 AGGCCCAGAGAGATGGTGGTGGG - Intronic
1078736169 11:14023093-14023115 TGGGTGAGACAAATGGTGGCAGG + Intronic
1079602871 11:22331029-22331051 TTGGGTAGAGAGATGGAGGCAGG - Intergenic
1080065257 11:28003182-28003204 TGTCTTACATGGATGGTGGCAGG - Intergenic
1081270129 11:41073182-41073204 TGGTTCAGAGTTATGGTGGCTGG + Intronic
1084727278 11:70949925-70949947 TGGCTCACAGCGCTGGTGGCCGG + Intronic
1084905355 11:72341881-72341903 TGGTTTTGTGAGATGGAGGCTGG + Intronic
1087303587 11:96463252-96463274 TAGCTTAGAGAGATCATGGGAGG + Intronic
1087617546 11:100505781-100505803 TAGCTTAGAGAGGTGGGAGCAGG - Intergenic
1089084449 11:115805290-115805312 GGGCTTAGAGACATGGGGGCTGG - Intergenic
1090253127 11:125264745-125264767 GGGCTTAGAGAAATTGTGTCTGG - Intronic
1090618563 11:128540667-128540689 TGGCTTAGAGAGAGGCTGCCCGG + Intronic
1091632974 12:2176303-2176325 GGGCCTAGAGAGGTGGTTGCAGG + Intronic
1091726386 12:2849285-2849307 TGCCTTGGAGAGATGGTGGAGGG + Intronic
1094352798 12:29545341-29545363 TGTTTTAAAGAGATGGAGGCCGG + Intronic
1094451157 12:30584401-30584423 TGACCTAGACAGATGGTGTCAGG + Intergenic
1095942989 12:47738456-47738478 AGGCTTAGAGAGAAGAGGGCTGG + Intronic
1096239148 12:49950388-49950410 TGAGTCAGAGAGATGGGGGCCGG + Intergenic
1097358288 12:58627432-58627454 TGGCTTAGTGGAATGTTGGCTGG + Intronic
1097654841 12:62345793-62345815 TGTCTTACATGGATGGTGGCAGG + Intronic
1097853471 12:64436951-64436973 TGGCTTTGAGAGAGGCTGGAGGG - Intronic
1098517124 12:71390280-71390302 TGTCTTACATGGATGGTGGCAGG + Intronic
1099097163 12:78389032-78389054 TGGCTTAGTGACTAGGTGGCAGG + Intergenic
1100354315 12:93814687-93814709 AGGCTCAGAGAGTTGGTGGCAGG - Intronic
1100444223 12:94646248-94646270 TAGGTTAGAGAGATGGGGGAGGG + Intronic
1100971803 12:100078981-100079003 TGTCTTACATGGATGGTGGCAGG - Intronic
1101709699 12:107253653-107253675 TGTCTTACATGGATGGTGGCAGG - Intergenic
1104555784 12:129798743-129798765 TGGCTTAGAGAAGGGGTGGAGGG + Intronic
1106284843 13:28309663-28309685 TGGGTTAGAGAGAGGGAGGGGGG - Intronic
1110124108 13:71920645-71920667 TGGCTTAAAGTTATGGTGGTGGG - Intergenic
1111327304 13:86716137-86716159 TAACTAAGAGAGATGGAGGCCGG + Intergenic
1111707052 13:91763376-91763398 TGGGTTAGAGACATGTTGGGTGG + Intronic
1111927877 13:94482473-94482495 TGTGGTAGAGAGAAGGTGGCTGG - Intergenic
1112287957 13:98120395-98120417 ACGCATAGAGAGATGCTGGCTGG + Intergenic
1112367975 13:98772033-98772055 TTGCTTTGAGAGAGGGTGGTGGG + Intergenic
1112454616 13:99547723-99547745 TGGCTTAGAAAGCAGCTGGCAGG + Intronic
1118781813 14:69013672-69013694 TGGCTAAGTGAGATGAAGGCAGG + Intergenic
1120879277 14:89402363-89402385 GGACGGAGAGAGATGGTGGCTGG - Intronic
1120909701 14:89655002-89655024 TGGCCATGAGAGATGGTGGCAGG + Intergenic
1121427228 14:93861002-93861024 TGGCATAGGGTGATGGTGGAGGG + Intergenic
1121465633 14:94113859-94113881 GGCCTTAGAGTGATGGTGGGAGG - Intronic
1121603663 14:95224927-95224949 TGGCTAGGAGAGCAGGTGGCTGG + Intronic
1121725454 14:96145197-96145219 GGGGTTAGAGAGAGGGCGGCAGG + Intergenic
1122245954 14:100403739-100403761 TTGCTTAGAGTGAAGCTGGCTGG + Intronic
1125374346 15:39013099-39013121 GGGCTGAGGGAGATGGAGGCGGG - Intergenic
1126185377 15:45826168-45826190 TGGCTTAGAGTTCTGGAGGCTGG - Intergenic
1127287781 15:57545983-57546005 TTGCCTGGGGAGATGGTGGCTGG + Intronic
1127447596 15:59081108-59081130 TGGCTAAGTGAGTTGGTGGTGGG - Exonic
1129167831 15:73788772-73788794 TGGAGTATAGAGAAGGTGGCAGG + Intergenic
1129245106 15:74274530-74274552 TGGGGTAGAGTGATGGTGGTGGG + Intronic
1130368315 15:83260824-83260846 TGACTGAGAGAAATGGTGTCAGG + Intronic
1130843853 15:87726045-87726067 TTGATTAGGGAGATGGTGGAGGG + Intergenic
1131767606 15:95696886-95696908 TGGCTTAAAGAGGTTGTGGATGG + Intergenic
1132232358 15:100193476-100193498 TGGCGGAAAGAGATGGTGGCAGG + Intronic
1132347828 15:101119073-101119095 TTGCCCAGAGAGAAGGTGGCAGG - Intergenic
1133235336 16:4384944-4384966 TGGCCGAGTGGGATGGTGGCAGG + Intronic
1133518207 16:6530682-6530704 TGTCTTACATAGATGGTGGCAGG + Intronic
1135074681 16:19383161-19383183 TGGCTGAGTGAGAGGCTGGCTGG + Intergenic
1136450871 16:30353658-30353680 TTGCCTAGAGAGACAGTGGCTGG - Exonic
1139339802 16:66261001-66261023 ATGCTCAGAGAGATGGTGTCAGG - Intergenic
1140706120 16:77632032-77632054 TGTCTTACATGGATGGTGGCAGG - Intergenic
1140707962 16:77648667-77648689 TGTCTTACATGGATGGTGGCAGG - Intergenic
1143023037 17:3926426-3926448 TGGCTTGGAAAGGTGGTGCCTGG - Intronic
1143511088 17:7395328-7395350 TGTTTTAGAAAGATCGTGGCGGG + Intronic
1143777992 17:9212131-9212153 AGGCTTAGAGAGATGGGTGGGGG + Intronic
1144969072 17:19095745-19095767 TGTCTGAGAGAGTGGGTGGCTGG + Intronic
1144978844 17:19156321-19156343 TGTCTGAGAGAGTGGGTGGCTGG - Intronic
1144989378 17:19221911-19221933 TGTCTGAGAGAGTGGGTGGCTGG + Intronic
1145285893 17:21505878-21505900 TGCCTTAGAGAGGTGCTGGAGGG + Intergenic
1146696308 17:34911303-34911325 TGGCTAAGAGAAAAGTTGGCTGG + Intergenic
1146911234 17:36649744-36649766 GGGCTTGGAGAGGTGGTGGGGGG + Intergenic
1147553653 17:41462790-41462812 AGGCTTAGAGAGACGTGGGCAGG - Intronic
1147589318 17:41671361-41671383 TGTCTTATATGGATGGTGGCAGG + Intergenic
1147793527 17:43027443-43027465 TGGCTGGGAGGGATGGGGGCTGG - Intronic
1148774672 17:50088651-50088673 TGGTTTACAGAGATGGGGCCTGG - Intronic
1148958195 17:51371154-51371176 TGGCATGGAGAGATGGCTGCAGG + Intergenic
1149368183 17:55966372-55966394 TTGCTTAGAGGGATGGAGCCCGG - Intergenic
1150949449 17:69785806-69785828 AGTCTTACATAGATGGTGGCTGG - Intergenic
1151810337 17:76436625-76436647 TTGAGTAGAGAGGTGGTGGCTGG - Intronic
1152419011 17:80182162-80182184 TGGCTGAGAGAGATGGGCTCTGG + Intronic
1153537901 18:6122531-6122553 TGTCTTACATGGATGGTGGCAGG - Intronic
1154484758 18:14864930-14864952 AGGCTTTGTGAGAAGGTGGCAGG - Intergenic
1155784196 18:29876843-29876865 TGGCATTGTGAGATGGAGGCTGG - Intergenic
1157591566 18:48839218-48839240 GTGCTCAGAGAGAGGGTGGCAGG - Intronic
1157716919 18:49894261-49894283 TGGCTTGTAGAGATGGTGGTGGG + Intronic
1158330722 18:56359128-56359150 TGTCTTACATGGATGGTGGCAGG - Intergenic
1159349892 18:67258890-67258912 TGTCTTAGACAGATGGCAGCAGG - Intergenic
1159897550 18:74011609-74011631 GGGCTGAGAGACAGGGTGGCCGG - Intergenic
1159976759 18:74722676-74722698 TGGGTAAGAGAGCTGGTGGGAGG - Intronic
1160613082 18:80104255-80104277 TGGCATGGAGAGCTGGAGGCAGG - Intergenic
1160825356 19:1077755-1077777 TTGCTGAGAGAGATGGGGGTGGG + Intronic
1162774231 19:12969421-12969443 TTGCTGAGAGACATGGGGGCTGG - Intronic
1163203036 19:15782019-15782041 TGGCCTAGAGAGCTGATGGGAGG - Intergenic
1163266284 19:16224437-16224459 TGGCTTGCAGAGCTGGTGGCTGG + Intronic
1164035359 19:21449363-21449385 TGGTTTAGAGTGAGGCTGGCTGG - Intronic
1165943116 19:39425102-39425124 TGGCTGGGGGAGGTGGTGGCTGG - Exonic
1167106320 19:47431883-47431905 TTTCATAGAGAGAAGGTGGCAGG - Intronic
1167876174 19:52414448-52414470 TGGGTAAAGGAGATGGTGGCAGG + Intronic
1202663869 1_KI270708v1_random:98576-98598 AGGCTTAAAGAGAGGATGGCAGG - Intergenic
925814727 2:7736506-7736528 TGGCTGAGAGAGGTGTTGACTGG - Intergenic
927885876 2:26718184-26718206 TGGCTGTGGGAGATGGGGGCAGG - Intronic
928312687 2:30223576-30223598 TGGCTTAGAGAGCTGCAGGATGG + Intergenic
928387570 2:30883377-30883399 TGGTTTGGAGAGGTGGTGGGTGG - Intergenic
929026792 2:37612457-37612479 TGGCTTTCAGAGAAGGTGGCGGG + Intergenic
929383339 2:41378762-41378784 AGGGGTAGAGACATGGTGGCGGG - Intergenic
929873025 2:45774109-45774131 TCCCTTGGAGAGATGGGGGCTGG + Intronic
931482355 2:62654292-62654314 TGGGTTACAGAGATGGAGTCAGG + Intergenic
932618239 2:73249740-73249762 TGGCTTTGAGACGAGGTGGCAGG + Intronic
934756782 2:96829856-96829878 TGGCTTAGAGGGTGTGTGGCTGG + Intronic
935193323 2:100795523-100795545 TGTCTTGGGGTGATGGTGGCAGG - Intergenic
935712574 2:105912427-105912449 AGGCATAGAGAGATGGTGGGAGG + Intergenic
936713497 2:115160886-115160908 AGGCTCAGAGAGAGGGTCGCAGG - Intronic
937065177 2:119012141-119012163 TGGCATGGGAAGATGGTGGCAGG - Intergenic
937940010 2:127277936-127277958 TTGCTTAGAAAGATGAAGGCTGG + Intronic
938305042 2:130247463-130247485 TGGCTCAGGGAGCTGCTGGCTGG + Intergenic
941346080 2:164371269-164371291 AGTCTTAGATGGATGGTGGCAGG + Intergenic
942649663 2:178153755-178153777 TAGCTTACATGGATGGTGGCAGG + Intergenic
944349022 2:198704944-198704966 TGGATCAGAGAGATGGTTGGCGG + Intergenic
946602692 2:221369543-221369565 TGGCTTAGAGGGAGGATGGATGG + Intergenic
946909125 2:224442881-224442903 TCGCTTAATGAGATGGTGGAGGG - Intergenic
947020763 2:225673103-225673125 TGTCTTATATGGATGGTGGCAGG + Intergenic
947319856 2:228904980-228905002 TGGCTTAGAGAGATGGTGGCAGG + Intronic
947955525 2:234187136-234187158 TGTCTTACATGGATGGTGGCAGG - Intergenic
948789092 2:240368052-240368074 TGGCTCTGGGAGTTGGTGGCCGG - Intergenic
948802415 2:240438894-240438916 TGGCATAAAGGGAGGGTGGCCGG - Intronic
948884728 2:240877006-240877028 TGGCCATGAGAGCTGGTGGCTGG + Intronic
1170002010 20:11625303-11625325 TGTCTTCAAGACATGGTGGCTGG + Intergenic
1171321432 20:24247870-24247892 TGTCTTACATGGATGGTGGCAGG - Intergenic
1172412787 20:34738605-34738627 AGTGTTAGAGAGATGGGGGCAGG - Intronic
1172927333 20:38550476-38550498 TGGCTTACAGAGTTGATGACAGG - Intronic
1173339489 20:42140852-42140874 TGGCTAAGAGTAATGGTGCCAGG + Intronic
1173531656 20:43774269-43774291 TGGGATAGAGAGATGGAGGCAGG + Intergenic
1174289802 20:49500003-49500025 TGGCTGAGTGAGGGGGTGGCAGG - Intergenic
1174589889 20:51636560-51636582 TGGCGTAGAGAGCTGGGAGCTGG + Intronic
1174756821 20:53167131-53167153 TGGAAAAGAAAGATGGTGGCTGG + Intronic
1176030513 20:63009081-63009103 TGGCTCAGAGGGTTGGAGGCAGG + Intergenic
1176972959 21:15288113-15288135 GGGCTTAGAGAGATGGAGTTAGG - Intergenic
1178375059 21:32059871-32059893 TGTCTTACATGGATGGTGGCAGG + Intergenic
1178716732 21:34971545-34971567 TGGATAAGATAGATGGTGGTTGG - Intronic
1180030783 21:45205538-45205560 TGGCTCCGAGAGATGGTGACAGG + Intronic
1180738688 22:18037826-18037848 TGGGTAGGAGAGCTGGTGGCGGG + Intergenic
1181680508 22:24493073-24493095 TGGCTTAGAGAAATTGTTGGAGG - Intergenic
1181964678 22:26648051-26648073 TGGCTGAGAGGGGTGGCGGCAGG + Intergenic
1182786272 22:32910293-32910315 TGGGTTAAAGAGATGGGGGTGGG + Intronic
1182857689 22:33532514-33532536 TGCCTTAGAGTGTTGGTGTCTGG - Intronic
1183226737 22:36555561-36555583 TGGGTTATAGAGGTGGTGTCAGG - Intergenic
1184901586 22:47449726-47449748 TGGCTTCGAGTGCAGGTGGCTGG - Intergenic
1185066206 22:48632866-48632888 TGGCCTGCAGAGTTGGTGGCAGG + Intronic
949171787 3:1008482-1008504 TAGCATAGAAAGATGGTAGCAGG - Intergenic
949204278 3:1419822-1419844 ATGTTTAGAGAGATGGTGGGAGG + Intergenic
950254495 3:11493277-11493299 TTGCCTTCAGAGATGGTGGCTGG - Intronic
951545170 3:23817609-23817631 TGGGTTTGAGGGATTGTGGCTGG + Intronic
953236820 3:41114155-41114177 TGGCATAGGGAGAAGGAGGCTGG + Intergenic
953526317 3:43692483-43692505 TGGCTTGGAGTGATGGTTGGAGG + Intronic
953538992 3:43797940-43797962 TGACTTAAAGAGGTGGTGCCAGG + Intergenic
954790625 3:53130496-53130518 TGGCCTTGAGAGAGGGGGGCGGG + Intergenic
956811419 3:72867413-72867435 TGTCTTAGATGGATGGCGGCAGG + Intergenic
958636785 3:96755352-96755374 AGTCTTAGAGAGATGCAGGCTGG - Intergenic
959237592 3:103744764-103744786 TGGCTTAAAGAGATGTTCACAGG - Intergenic
960164720 3:114388492-114388514 TGGCTTAGAGATGTGGTGGAAGG + Intronic
961440900 3:126952622-126952644 TTGCTTAGAGAGGTGCTGCCTGG - Intronic
964471598 3:157062962-157062984 TGGCTTATAGAAATGTTGTCCGG + Intergenic
965040976 3:163506799-163506821 TGGCTTACAGTTATGGAGGCTGG + Intergenic
966722506 3:183078895-183078917 TGTCTTACATGGATGGTGGCAGG + Intronic
967534655 3:190588406-190588428 TTGCTTAGAAAGATGTAGGCCGG - Intronic
967910422 3:194538105-194538127 TGGCTTAGAAAGACAGTGACGGG + Intergenic
968894302 4:3389774-3389796 TGGCTTTGGGGGACGGTGGCAGG + Intronic
969927630 4:10600091-10600113 TGGCAGAGAGAGAGGGTAGCAGG - Intronic
970482794 4:16494542-16494564 AGACTAAGAGAGATGGTGGATGG - Intergenic
971010549 4:22430063-22430085 TGCCTTACATGGATGGTGGCAGG - Intronic
971278943 4:25225249-25225271 TGTCTTACATGGATGGTGGCAGG + Intronic
971638729 4:29100636-29100658 TTGGTTAGAAAGATGGAGGCAGG - Intergenic
971906442 4:32732410-32732432 TGGCTTAGACAGAAGGCAGCTGG - Intergenic
972923909 4:43979748-43979770 TTGCTTAGAGAGATGATGATGGG - Intergenic
974455724 4:62127601-62127623 TGTCTTACATGGATGGTGGCAGG - Intergenic
978755840 4:112302170-112302192 TGGCTCAGAGGAATGGTGACTGG - Intronic
979130860 4:117043190-117043212 TGGCTTAGAGACAGGCTGGTTGG + Intergenic
979436978 4:120704729-120704751 TGGCTTGGAGAGAAGAAGGCAGG + Intronic
980041391 4:127944886-127944908 TTGCTTTGAGAGTTGGAGGCGGG - Intronic
980893642 4:138840421-138840443 TGACTTAAAGAGCTGATGGCAGG + Intergenic
981274930 4:142887950-142887972 TGGATTAGATAGATGGTGAGTGG + Intergenic
981846711 4:149177646-149177668 TGGCTTATAGAGTTTCTGGCGGG - Intergenic
981903081 4:149889507-149889529 AGGCTAACAGAGATGTTGGCAGG - Intergenic
984092065 4:175387240-175387262 TAGCTTAGACAGCAGGTGGCTGG - Intergenic
984553435 4:181186469-181186491 TGTCTTACAGGGATGGTAGCAGG + Intergenic
984634212 4:182093310-182093332 GCTCTTAGAAAGATGGTGGCAGG + Intergenic
985618539 5:939304-939326 TGACTGAGACAGATGGTGACCGG - Intergenic
986044611 5:4025138-4025160 TGGCTCAGGGGGATGGTGCCTGG - Intergenic
986681524 5:10237580-10237602 TGTCTTACATTGATGGTGGCAGG - Intronic
987378365 5:17259173-17259195 TGTCTTACATGGATGGTGGCAGG + Intronic
987671993 5:21022392-21022414 TGTCTTAAATGGATGGTGGCAGG - Intergenic
988317161 5:29644901-29644923 TGTCTTACATGGATGGTGGCAGG - Intergenic
988826779 5:34944336-34944358 TGGACTAGAGAAATGGTGGTGGG - Intronic
989606272 5:43246997-43247019 GGCCTTGGAGACATGGTGGCTGG - Intronic
989740725 5:44767971-44767993 TGTCTTACATGGATGGTGGCAGG + Intergenic
990165029 5:52985306-52985328 TGGCTTAGCGACAAGGAGGCAGG + Intergenic
991631610 5:68661821-68661843 TGGCTAATAGACATGGTGGAAGG + Intergenic
993922810 5:93828490-93828512 TGGATTTGAGAGACGGTGGCAGG - Intronic
994615191 5:102095613-102095635 AGGAAGAGAGAGATGGTGGCTGG - Intergenic
995380035 5:111521684-111521706 TGGCTTAGAGAGTTGGCTGGAGG - Intergenic
996101231 5:119447801-119447823 TGGCTTTGGAAGATGGAGGCTGG - Intergenic
996125234 5:119718548-119718570 TGGCTTCAAGGTATGGTGGCTGG - Intergenic
996755090 5:126926967-126926989 TGGCTTGGGAAGATGGGGGCAGG - Intronic
997566272 5:134889195-134889217 TGGATTAAACAGGTGGTGGCAGG + Intronic
998609553 5:143673098-143673120 AGCCTTAGAGAGATTGTGGCAGG + Intergenic
1000204670 5:159047510-159047532 TGGCTGACAGAGATGGGGGAGGG + Intronic
1000518129 5:162265548-162265570 TGGAAAAGAGAGATGGAGGCAGG - Intergenic
1000607323 5:163338799-163338821 TCGCTTAGAGGGCTGGTGTCTGG - Intergenic
1001085570 5:168697917-168697939 TGGCAGTGAGATATGGTGGCTGG + Intronic
1001450478 5:171820745-171820767 TTGCTGAGCGGGATGGTGGCTGG - Intergenic
1002759932 6:193472-193494 AGACTAGGAGAGATGGTGGCAGG + Intergenic
1004337358 6:14776422-14776444 GGGTTTAGAGAGCTGGTGGTGGG + Intergenic
1004462245 6:15848467-15848489 TGGCTTAGTGTATTGGTGGCTGG - Intergenic
1005500227 6:26422876-26422898 TGCCTTAGAGATGTGATGGCTGG + Intergenic
1005504696 6:26459424-26459446 TGCCTTAGAGATGTGATGGCTGG + Intronic
1006379077 6:33687420-33687442 TGGCTGGGGGACATGGTGGCTGG - Intronic
1008242111 6:49126606-49126628 TGTCTTACATGGATGGTGGCAGG - Intergenic
1008346930 6:50439138-50439160 TGGCTGAGATTGATGGTGGCGGG - Intergenic
1009793389 6:68433717-68433739 TATCTTACATAGATGGTGGCAGG + Intergenic
1010247895 6:73678967-73678989 TGGAATACAGACATGGTGGCTGG - Intergenic
1010480356 6:76344661-76344683 TGTCTTACATGGATGGTGGCAGG - Intergenic
1011099614 6:83708070-83708092 TGGCTCCGAGAGGTGGTGCCAGG - Intronic
1012683345 6:102210544-102210566 TGTCTTACATGGATGGTGGCAGG - Intergenic
1013177111 6:107687407-107687429 TGTCTTACATGGATGGTGGCAGG + Intergenic
1014983399 6:127973145-127973167 TTGCTTTCAGAAATGGTGGCGGG - Exonic
1015106360 6:129541322-129541344 AGGCTTTCAGAGATGTTGGCGGG - Intergenic
1018211190 6:161483717-161483739 TGGCATAGTGAGATCCTGGCAGG + Intronic
1018281266 6:162188088-162188110 TGTCTTACATGGATGGTGGCAGG - Intronic
1018286230 6:162240967-162240989 TGCCTAGGAGAGATGGAGGCAGG - Intronic
1019056465 6:169227162-169227184 TGGCTCAGAAAGGGGGTGGCTGG + Intronic
1021273365 7:18619879-18619901 GGGCTTAGTGAGATGTTGACAGG - Intronic
1023003667 7:35839698-35839720 TAGCTGAGCGTGATGGTGGCAGG - Intronic
1023009185 7:35910085-35910107 TGGCCTTGTGACATGGTGGCTGG + Intergenic
1023017278 7:35980942-35980964 TGGCCTTGTGACATGGTGGCTGG + Intergenic
1027546393 7:79532195-79532217 TGGCTTAGAAAGAAGATGACTGG + Intergenic
1028249341 7:88522677-88522699 AGGCTGAGAGAGAAGGTGGCAGG + Intergenic
1029927187 7:104329544-104329566 CCGCTTAGAGAGATGGGGCCGGG + Intronic
1030503511 7:110389294-110389316 TAGCTTTGAGACATGGGGGCAGG + Intergenic
1030510761 7:110480068-110480090 TGTCTTACATGGATGGTGGCAGG + Intergenic
1030673841 7:112364884-112364906 TCGCTAAGAGGGATGGTGGGTGG + Intergenic
1033046714 7:137968766-137968788 TGGGATAGAGAGTTGGTGGCGGG - Intronic
1033130824 7:138744164-138744186 TGGCTGACAGAGTTGGGGGCAGG - Intronic
1036577288 8:10040012-10040034 TGGCTTATAAAGGTGGGGGCAGG - Intergenic
1037047197 8:14321948-14321970 AGGCTAAGAGAAATTGTGGCTGG + Intronic
1037767540 8:21781355-21781377 TGGCTTAGAGTGGTGGTGGGTGG - Intronic
1038541183 8:28391448-28391470 CAGGCTAGAGAGATGGTGGCTGG - Intronic
1039089844 8:33816046-33816068 TGTCTTACATGGATGGTGGCAGG + Intergenic
1039355299 8:36808877-36808899 TGGCTTACAGTGATGGAGACAGG - Intronic
1039438403 8:37577545-37577567 GGGCTGAGAGAGATGGAAGCAGG + Intergenic
1040567729 8:48582354-48582376 TGGCTAAGGCAGATGGAGGCAGG + Intergenic
1041389696 8:57337680-57337702 TGTCTCAGAGAGTTGGTGACGGG - Intergenic
1041925678 8:63233922-63233944 TGTCTTACATGGATGGTGGCAGG + Intergenic
1046010883 8:108545742-108545764 TCGCTTTGAGAGGTGGAGGCAGG - Intergenic
1047296612 8:123576065-123576087 TGGCTTACAGTGCTGGAGGCTGG - Intergenic
1047615593 8:126559897-126559919 AGGCTTATAGAGATTATGGCTGG + Intergenic
1048226659 8:132594383-132594405 TGACTTATAGAGATTGTGACTGG + Intronic
1048265485 8:132981797-132981819 TGCCTTAGAGTGATAGTAGCAGG + Intronic
1049069212 8:140344174-140344196 TGGCTCAGAGACATGCTGGAAGG - Intronic
1050978541 9:11975983-11976005 AGGCAGAGAGAGTTGGTGGCAGG + Intergenic
1051088952 9:13384197-13384219 TGTCTTACATGGATGGTGGCAGG - Intergenic
1051089204 9:13386140-13386162 TGTCTTACATGGATGGTGGCAGG - Intergenic
1052262290 9:26531236-26531258 TGGGATAAAGAGATGGTGGTTGG - Intergenic
1052844593 9:33323993-33324015 GTGCTTTGAGAGATGGAGGCAGG + Intronic
1055169674 9:73240591-73240613 AGGCATAGAGAGATGGTGTAAGG + Intergenic
1056825950 9:89876460-89876482 TGGAGAAGAGAGATGGTGGAGGG - Intergenic
1057541245 9:95973545-95973567 TGTCTTACATGGATGGTGGCAGG + Intronic
1058547395 9:106075401-106075423 GGGCTTGGAGAGTTGGTGACTGG + Intergenic
1058868898 9:109185796-109185818 AGGCTGAGAGAGAGGGTGGGGGG - Intronic
1060774948 9:126366170-126366192 GGGCATACAAAGATGGTGGCTGG - Intronic
1062003179 9:134226915-134226937 CCCCTTAGAGAGTTGGTGGCAGG - Intergenic
1062164220 9:135098601-135098623 TGGCTTCGCGAGGTGATGGCTGG + Intronic
1062274406 9:135723970-135723992 GGGCTCAGAGTGAAGGTGGCAGG - Intronic
1194521063 X:94919322-94919344 TTGCTTATAGAGATGCTGTCTGG + Intergenic
1195416031 X:104620341-104620363 TTTTTTAAAGAGATGGTGGCTGG + Intronic
1195814404 X:108869318-108869340 TGGCAGGGAGAGATGGGGGCCGG + Intergenic
1196981215 X:121215330-121215352 TTTCTTAAAGAGATGGTGGGAGG - Intergenic
1197336882 X:125219848-125219870 TGGCTTTGATAAACGGTGGCAGG - Intergenic
1197988493 X:132292633-132292655 AGCTTTAGAGAGATGGTGGTGGG - Intergenic
1200829638 Y:7678388-7678410 TGGCTTGGAGAGAGTGGGGCAGG + Intergenic
1201354643 Y:13084146-13084168 GGGGTTAAAGTGATGGTGGCTGG - Intergenic
1202174185 Y:22082466-22082488 AGGCCTAGAGAGATGTTGGTGGG + Intronic
1202217175 Y:22503916-22503938 AGGCCTAGAGAGATGTTGGTGGG - Intronic
1202326011 Y:23692143-23692165 AGGCCTAGAGAGATGTTGGTGGG + Intergenic
1202342528 Y:23885017-23885039 AGGCCTAGAGAGATGTTGGTTGG + Intergenic
1202528241 Y:25785068-25785090 AGGCCTAGAGAGATGTTGGTTGG - Intergenic
1202544760 Y:25977911-25977933 AGGCCTAGAGAGATGTTGGTGGG - Intergenic