ID: 947323914

View in Genome Browser
Species Human (GRCh38)
Location 2:228954038-228954060
Sequence CCCGGGTTTAAGGTTTCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947323914 Original CRISPR CCCGGGTTTAAGGTTTCTCT CGG (reversed) Intronic