ID: 947327615

View in Genome Browser
Species Human (GRCh38)
Location 2:228994780-228994802
Sequence TAGTTGTATTTTTAAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 390}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947327615 Original CRISPR TAGTTGTATTTTTAAGTGCC TGG (reversed) Intronic
900842739 1:5067977-5067999 CAGTTCTGTTTTTAATTGCCAGG - Intergenic
901753038 1:11423489-11423511 TAGTTTATTTTTTAAGTGCAGGG - Intergenic
901919630 1:12526901-12526923 TATTTTTATTTTTTAGTGACAGG - Intergenic
902352443 1:15867367-15867389 TATTTTTATTTTTAAGAGACAGG + Intronic
902638576 1:17751269-17751291 CAGTTCTATTTCCAAGTGCCTGG - Intergenic
902727680 1:18348038-18348060 AATTTATATATTTAAGTGCCTGG - Intronic
903437685 1:23364034-23364056 TAGTTTTTTTTTTAAGAGACAGG - Intronic
903681026 1:25097141-25097163 TCATTGTATTTTTCAGTTCCAGG - Intergenic
904737360 1:32644858-32644880 TATTTTTAATTTTAAGTGCGTGG - Intronic
905268780 1:36773076-36773098 TAGGTGAATCTTTAAGAGCCAGG + Intergenic
905992255 1:42348299-42348321 TAGTTGTATTTTCAAAGGACTGG - Intergenic
908233457 1:62128263-62128285 TAATAATATTTTTATGTGCCTGG - Intronic
908445473 1:64195819-64195841 TAGTTCTATTTTTAGGTGGAAGG + Intergenic
908610745 1:65857430-65857452 TATTTTTATTTTTTAGAGCCAGG + Intronic
909254680 1:73405145-73405167 TAATTATATTTTTAATTTCCTGG - Intergenic
909274609 1:73667720-73667742 TAGTTTTCTTTTTAACGGCCAGG + Intergenic
909429054 1:75564928-75564950 TATTTTTATTTTTAAGTCCTGGG + Intronic
909662726 1:78101742-78101764 TAGTGGTATTTTTTAGGGCATGG + Intronic
909857508 1:80556768-80556790 AAGTTGTATTCTTAATTGCTTGG - Intergenic
910113236 1:83703873-83703895 GATTTGTATTTTTTAGTGTCAGG + Intergenic
910375538 1:86565742-86565764 TAGTTTGATTTTTAAATGCATGG + Intronic
910601609 1:89038679-89038701 AATTTTTATTTTTAAGTTCCAGG + Intergenic
911272044 1:95813830-95813852 TATTTGTATTTTTAAATGCTGGG + Intergenic
911752512 1:101513101-101513123 TACTTGTTTTTTAAAGTGTCTGG - Intergenic
913444311 1:118933560-118933582 TAGTTCTACTTTTCAGTGCTTGG - Intronic
915360498 1:155283843-155283865 TAGTTGTATTTTTTAATTCATGG + Intronic
915417872 1:155756213-155756235 TAGTTGTATTACAAAGTGTCAGG - Intronic
919375767 1:196792520-196792542 TAATTTTTTTTTTAAGTTCCAGG - Intronic
920624796 1:207586441-207586463 TTGTTCTATCTTTAAATGCCTGG + Intronic
920673962 1:208026091-208026113 TTGTTTTCTTTTTAATTGCCAGG + Exonic
921016866 1:211200044-211200066 TTTTTGTATTTTTAAGAGACAGG + Intergenic
921465271 1:215479377-215479399 TAATTCTATTTTTAAGTTTCTGG - Intergenic
921617035 1:217281040-217281062 TAATTTTAATTTTAAGTTCCAGG - Intergenic
921641595 1:217561218-217561240 GAGTTGTAATTTTAAATGTCTGG - Intronic
922288682 1:224191934-224191956 TATTAGTATTTGTAAGTTCCTGG + Intronic
923634221 1:235679526-235679548 TAGCTGTATTTTTTTGTGCCTGG + Intronic
923652286 1:235884961-235884983 TATTTTTATTTTTTAGTGGCAGG + Intergenic
923839195 1:237649723-237649745 TAGTTACATCTTTAAGTGTCGGG - Intronic
924392532 1:243578676-243578698 TTATTTTATTTTTAAGTTCCAGG - Intronic
1063732606 10:8716047-8716069 TAGTTCTTTTTTTAAATGCTTGG + Intergenic
1065658358 10:27977967-27977989 TAGTTGTATGTTTAAGCAACTGG - Intronic
1066951161 10:42118497-42118519 AATTTGTATTTTTGAGTTCCTGG + Intergenic
1067422727 10:46170805-46170827 TTGTTGTTTTTTTTAGTTCCTGG - Intergenic
1068713540 10:60160468-60160490 TAGTTCTTTTTTAAAGTGCTTGG - Intronic
1069075167 10:64031507-64031529 AAGTTGTAATTTTAAAAGCCAGG - Intergenic
1070275830 10:75005511-75005533 TAGTTGTGTTGTTTAGGGCCAGG - Intronic
1070885214 10:79889291-79889313 TAGTTGTATTTTGAAGTTCATGG + Intergenic
1071449675 10:85782445-85782467 TACTTGTTTTTTTAATTGCTGGG - Intronic
1074524011 10:114249008-114249030 TTTTTTTATTTTTAAGTTCCAGG + Intronic
1074646419 10:115458192-115458214 AAGTTACATGTTTAAGTGCCAGG + Intronic
1075107465 10:119550617-119550639 TTTTTGTATTTTTAAGAGACAGG + Intergenic
1076768235 10:132649106-132649128 TTGCTGTATTTTTAAGTGGCTGG + Intronic
1078145963 11:8721986-8722008 TGGGTGCATTTTTAAGTGTCAGG + Intronic
1079971741 11:27043375-27043397 AAGTTATACTTTTAAGTGCTGGG + Intronic
1080251065 11:30234251-30234273 TTGTTGTGTTTCTAAGTTCCAGG - Exonic
1080253295 11:30259937-30259959 TAATTTTAATTTTAAGTTCCAGG - Intergenic
1080786608 11:35480613-35480635 TTATTGTATTTTTCAGTGCTAGG + Intronic
1081045073 11:38263948-38263970 TTATTGTATTTTTCAGTTCCAGG + Intergenic
1081188414 11:40073705-40073727 AAGTTGTAATTTTAAGTGAGTGG - Intergenic
1081445455 11:43127324-43127346 TAATTTTAATTTTAAGTTCCAGG - Intergenic
1082678746 11:56143495-56143517 TTTTTGTATTTTTAAGTAACAGG - Intergenic
1083039223 11:59669642-59669664 GGGTGGTATTTTTAAGCGCCAGG + Intergenic
1083353145 11:62045456-62045478 GCTTTGTATTTTTTAGTGCCTGG + Intergenic
1086421223 11:86639467-86639489 TAGATGTATGTTTTTGTGCCAGG - Intronic
1086636255 11:89089708-89089730 TCTTTGTCTTTTTAAGTGTCTGG - Intergenic
1086769731 11:90746943-90746965 AAGTTGTACTTTTTAGTTCCAGG + Intergenic
1086822146 11:91446963-91446985 TAGTTTTTTTTTTAATTGCCTGG - Intergenic
1087386277 11:97472356-97472378 TTATTGTATTTTTCAGTTCCAGG - Intergenic
1088772788 11:113052693-113052715 TATTTTTATTTTTAAGTTCCAGG + Intronic
1089166361 11:116480193-116480215 AATATGTATTTTTTAGTGCCTGG - Intergenic
1091622511 12:2100090-2100112 TAGTGTTATTTTTAAGTGTCAGG - Intronic
1092178653 12:6429150-6429172 TTTTTGTATTTTTAAGAGACGGG + Intergenic
1093301344 12:17460988-17461010 AAGTAGTATATTCAAGTGCCTGG + Intergenic
1093523485 12:20077225-20077247 TTGTTTTATTTTTAAGTTCTGGG - Intergenic
1093645022 12:21575878-21575900 TATTTGGATCTTTAACTGCCTGG - Exonic
1095120052 12:38406121-38406143 TATTTTTAGTTTTAAGTTCCAGG + Intergenic
1096618909 12:52850190-52850212 TTTTTGTATTTTTAAGAGACGGG - Intergenic
1098390683 12:69966797-69966819 TACTTCTATTTTTAAGTCTCAGG + Intergenic
1098422597 12:70317265-70317287 TAATTTTACTTTTAAGTTCCAGG + Intronic
1098459261 12:70714426-70714448 TATTTGTCTTTGTAAGTGCGTGG - Intronic
1099412483 12:82348376-82348398 TAGCTTTATTTTTAAGAGCCAGG + Intronic
1099894693 12:88630176-88630198 TAGTTGTATGCTACAGTGCCAGG + Intergenic
1099895952 12:88646755-88646777 AAATTGTATTTTTTGGTGCCTGG + Intergenic
1100319781 12:93479817-93479839 AAGTTGTATTTTAGAGTGCTGGG + Intronic
1100515767 12:95326260-95326282 TTTTTGTATTTTTAAGAGACGGG + Intergenic
1101172990 12:102119398-102119420 TATTTTAATTTTTAAGTTCCGGG - Intronic
1102626160 12:114236957-114236979 TAATTTTAATTTTAAGTTCCAGG - Intergenic
1103143101 12:118568514-118568536 TATTTGTATTTTTAGGTTCTAGG + Intergenic
1103511313 12:121476500-121476522 TAATTTTATTTTTAAGAGACAGG - Intronic
1107125216 13:36839208-36839230 TTTTTGTATTTTTAAGAGACTGG + Intergenic
1107889053 13:44898180-44898202 TACTTTTATTTTTAAGTTCAGGG + Intergenic
1108037153 13:46302989-46303011 TTGTAGTATTTTTTAGTGTCTGG - Intergenic
1108043484 13:46360867-46360889 TATTTTTATTTTTAAGTGGTGGG - Intronic
1108895189 13:55318152-55318174 AATTTTTATTTTTAAGTTCCAGG + Intergenic
1109134445 13:58628844-58628866 CAGTTGTACTTTTCAGTGACAGG - Intergenic
1109697841 13:65983917-65983939 TATTTACATTTTTAAGTGGCTGG + Intergenic
1110195010 13:72779287-72779309 TTTTTGTATTTTTAAGAGACAGG + Intronic
1111231332 13:85347665-85347687 TGGATGTAGTTTTAATTGCCTGG - Intergenic
1111484372 13:88876922-88876944 TAGTTTGTTCTTTAAGTGCCAGG + Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1111891880 13:94092673-94092695 TAGTTCTATTTTTAAGTTTTGGG + Intronic
1112086401 13:96036545-96036567 TACTTGAACTTTTAAGTTCCAGG - Intronic
1112907272 13:104439447-104439469 TAGTTGCATTTTTCAGAGCATGG - Intergenic
1114470836 14:22960327-22960349 TTGCTGCATTTTTAACTGCCAGG - Intronic
1115375512 14:32671132-32671154 GAGTTGTAGTTTTAAGTAGCAGG + Intronic
1116481965 14:45401942-45401964 CCGTTTTTTTTTTAAGTGCCTGG - Intergenic
1116500773 14:45618365-45618387 TACTTTTATTTTTAAGTTCTGGG - Intergenic
1116516426 14:45812276-45812298 TAATTATTTTTGTAAGTGCCTGG + Intergenic
1116584547 14:46686294-46686316 CAGTTGTATTTTTCAGCTCCAGG + Intergenic
1116692950 14:48134548-48134570 TCTTTGTATTTTTAAGAGACCGG - Intergenic
1116745531 14:48814029-48814051 TGACTGTATTTTTAAGTGACTGG + Intergenic
1117170896 14:53094528-53094550 TAGTTTTCTTTTTAAGAGACGGG - Intronic
1117170918 14:53094667-53094689 TAGTTTTCTTTTTAAGAGACGGG - Intronic
1117874709 14:60240139-60240161 AACTTTTATTTTTAAGTTCCGGG + Intergenic
1118434704 14:65759606-65759628 TTATTTTATTTTTAAGTTCCAGG + Intergenic
1119070904 14:71583160-71583182 TTGTTGTTTGTTTAAGAGCCTGG + Intronic
1119314817 14:73684341-73684363 TAGTTCTATTTTTAATTTCCTGG + Intronic
1120496849 14:85248641-85248663 TAGATTTATTTTTAAGTTCCGGG + Intergenic
1120540722 14:85747450-85747472 TAGTTCTATTTTTAATTGTTGGG + Intergenic
1120745071 14:88145213-88145235 GACTTGTATCTTTAATTGCCTGG - Intergenic
1121186986 14:91981969-91981991 TATTTTTATTTTTAAGAGGCAGG - Intronic
1122096118 14:99374243-99374265 TAATTTTAATTTTAAGTTCCGGG - Intergenic
1122964226 14:105113895-105113917 TTTTTGTATTTTTAAGAGACAGG - Intergenic
1123483083 15:20654004-20654026 TTTTTGTATTTTTAAGAGACGGG + Intergenic
1124584568 15:30992568-30992590 TAATTGTATTTTTTAGAGTCAGG + Intergenic
1124923037 15:34044875-34044897 TTTTTGTATTTTTAAGAGACGGG - Intronic
1125916217 15:43490257-43490279 TTTTTGTATTTTTAAGAGACCGG + Intronic
1127548876 15:60017179-60017201 TACTTATATTTTTAAGAGACAGG - Intronic
1128918112 15:71585902-71585924 TCGTTGTATTACTTAGTGCCAGG + Intronic
1129645512 15:77427309-77427331 TAGTTTTATTTAATAGTGCCTGG - Intronic
1130676300 15:85955097-85955119 AATTTGTATTTTTGAGCGCCTGG + Intergenic
1131931023 15:97441551-97441573 AAGTTGTCTTTTAAAGTGTCTGG - Intergenic
1133183380 16:4076356-4076378 TTGTTGAATTTTTAAGTGGAAGG - Intronic
1134538494 16:15045707-15045729 TAGTTGGATTTTTCAGTCGCAGG - Intronic
1134601558 16:15537662-15537684 TATATGTATTTTTAAGAGACGGG + Intronic
1137751622 16:50865549-50865571 TAATTTTTTTTTTAAGAGCCGGG + Intergenic
1137797163 16:51231438-51231460 TGCTTGATTTTTTAAGTGCCTGG + Intergenic
1137926108 16:52544429-52544451 TAGTTATATTTTTACTTGCAAGG + Intronic
1138087302 16:54144533-54144555 TAGTTGGCTTTTTCAGTCCCAGG - Intergenic
1139190248 16:64855049-64855071 TTGTTGTTATTTTAAGTTCCGGG + Intergenic
1139398939 16:66664643-66664665 TAGTTTTTTTTTTAAGTGTTTGG - Intronic
1139689016 16:68627570-68627592 TAGTTATATTTTTTTGTGACTGG + Intergenic
1140390107 16:74579173-74579195 TGTTTGTATTTTTAAGAGACAGG - Intronic
1140984801 16:80147902-80147924 TAGTTATATGATAAAGTGCCTGG - Intergenic
1143073089 17:4314675-4314697 TGGTTGTCTTTTAAAATGCCTGG - Intronic
1143740118 17:8946366-8946388 TAGTAGTTTTCTTAGGTGCCTGG - Intronic
1143740131 17:8946446-8946468 TAGTAGTTTTCTTAGGTGCCTGG - Intronic
1146198091 17:30830292-30830314 TAATTGTATTTTTAAGAGACAGG - Intergenic
1146933687 17:36796374-36796396 TAGATGTATTTGTACATGCCTGG - Intergenic
1147391640 17:40112850-40112872 TAGTTGTCTCTTTAAGAGCTCGG - Intergenic
1147601854 17:41751582-41751604 TTGTTTTATTTTTAAGAGACAGG - Intergenic
1149210506 17:54295171-54295193 TAGTTGTACTTTCAAGTTCTTGG - Intergenic
1149376071 17:56045437-56045459 TAGTTGTATTATAAAATACCAGG - Intergenic
1149887726 17:60357445-60357467 TATTTTTATTTTTAAGAGACAGG - Intronic
1150855527 17:68748814-68748836 TATTTTTATTTTTAAGTTCCCGG + Intergenic
1151110599 17:71672971-71672993 TTGTTATTTTTTTAAGTGTCTGG - Intergenic
1151848671 17:76676410-76676432 TAGTACTATTGTTTAGTGCCAGG + Exonic
1154389994 18:13928211-13928233 TTATTTTATTTTTAAGTTCCGGG - Intergenic
1155124243 18:22855519-22855541 GATTTTTATTTTTATGTGCCTGG + Intronic
1155581197 18:27308524-27308546 AATTTTTATTTTTAAGTTCCGGG - Intergenic
1155661110 18:28249239-28249261 TAGTTGATTCTTTAAGTGCAGGG + Intergenic
1156437452 18:37147982-37148004 TATTTTTATTTTTAAGTTCTAGG + Intronic
1156561693 18:38132830-38132852 TGGTTATATTTTCAAGTACCTGG + Intergenic
1156719258 18:40049731-40049753 TTGTTGTATTCTTAATTACCTGG - Intergenic
1156808550 18:41218477-41218499 TCATTGTATTTGTAAGTTCCAGG - Intergenic
1156999068 18:43502688-43502710 ATGTTTTGTTTTTAAGTGCCTGG - Intergenic
1157788439 18:50507626-50507648 AAGTTGTAAGTTTAAGTTCCAGG - Intergenic
1158016800 18:52792670-52792692 TAATGGTATTTTTAAATGGCTGG + Intronic
1159571820 18:70123027-70123049 TAATTTTTTTTTTAAATGCCAGG - Intronic
1160339554 18:78077127-78077149 TATTTGAATTTTTAAGAGCATGG - Intergenic
1162151425 19:8648307-8648329 TATTTATTTTTTTAAGTTCCAGG - Intergenic
1162306805 19:9879730-9879752 TATTTAAATTTTTAAGAGCCTGG + Intronic
1162865833 19:13546232-13546254 TAATTTTAATTTTAAGTGCCTGG - Intronic
1163060733 19:14759664-14759686 TTTTTGTATTTTTAATAGCCAGG + Intronic
1163617218 19:18336520-18336542 TTTTTGTATTTTTAAGAGACAGG + Intergenic
1164956383 19:32390367-32390389 CAGTTGTTTTTTAAAGTTCCAGG + Intergenic
1164996833 19:32726729-32726751 TATTTGTTTTTTTAAGAGACAGG - Intronic
1165205771 19:34184222-34184244 TTTTTGTATTTTTAAGAGACGGG + Intronic
1165799447 19:38538643-38538665 TAGATTTATTTTTAAATGCCAGG - Intronic
1166993664 19:46708486-46708508 TTGTTGTATTTTTTAGAGACGGG + Intronic
925702785 2:6655542-6655564 TCGCTGTATTATTATGTGCCTGG - Intergenic
926551134 2:14302074-14302096 TATTTGTATTTTTAAATGGTAGG - Intergenic
928287451 2:30005415-30005437 TCGTGGTATTTTTAAGCACCTGG - Intergenic
928310240 2:30203744-30203766 TCTTTGTATTGTAAAGTGCCTGG - Intergenic
928438373 2:31271052-31271074 AAGTTGAAATGTTAAGTGCCTGG + Intergenic
929498832 2:42472392-42472414 TAAATGTATTTTTAAGTACATGG + Intronic
930459873 2:51659737-51659759 TTGTTGTAAGTTTATGTGCCAGG - Intergenic
930884246 2:56306297-56306319 TTTTTGTATTTTTAAGAGACTGG + Intronic
931593450 2:63912442-63912464 TAATTGTATTTTTAAGTCCCTGG + Intronic
932259138 2:70312223-70312245 TTTTTGTATTTTTAAGAGACAGG - Intergenic
932899026 2:75676754-75676776 TAGTTGAATTTTTAAACGCATGG + Intronic
935491640 2:103728361-103728383 TATTTTTATTTTTAAGTTCTGGG + Intergenic
936405916 2:112202438-112202460 TATATATATTTTTAAGTGCAGGG + Intergenic
937130275 2:119506119-119506141 TAGTTGCATGTTTAGTTGCCTGG - Intronic
937584172 2:123525886-123525908 TAGTTTTATTTTTTAGTGGTGGG + Intergenic
937916089 2:127099411-127099433 TAGTTGTTTTTTAATGTTCCTGG - Intronic
939382775 2:141457581-141457603 AATTTTTATTTTTAAGTTCCAGG - Intronic
939531273 2:143364834-143364856 TTGTTGTATTTTTAAGAGACAGG - Intronic
939761305 2:146183822-146183844 TATTTGTCTTTTTTAGTGCTTGG + Intergenic
940829196 2:158449164-158449186 CAGTTGTATTTTTATATGCTAGG - Intronic
941131595 2:161657324-161657346 TTGATCTATTTTTATGTGCCAGG - Intronic
941757996 2:169208957-169208979 TAGTAATTTTTTTAAATGCCTGG - Intronic
942871646 2:180741825-180741847 TTATTTTATTTTTAAGAGCCAGG + Intergenic
943005497 2:182384500-182384522 TTGTTGTATTTTTCAGCTCCTGG - Intronic
943448254 2:188016841-188016863 TAAATGAATTTTAAAGTGCCAGG - Intergenic
944834595 2:203566247-203566269 TAGCTGGTTTTTTAAGGGCCAGG - Intergenic
944923777 2:204441986-204442008 TATTTATAATTTTTAGTGCCAGG - Intergenic
946244074 2:218375751-218375773 TTATTGTATTTTTTAGTGACAGG - Intergenic
946475022 2:219998734-219998756 TAACTGTGTTTCTAAGTGCCAGG + Intergenic
946883350 2:224198070-224198092 GACTTATATTTTTAATTGCCAGG - Intergenic
947327615 2:228994780-228994802 TAGTTGTATTTTTAAGTGCCTGG - Intronic
948047871 2:234957613-234957635 TTGTTGTTTTTTTAAGCTCCCGG - Intronic
948260345 2:236599841-236599863 AATTTTTATTTTTAAGTGCCGGG + Intergenic
948447714 2:238045977-238045999 TTGTTGTATTTTTCAGTGTTGGG + Intronic
1170284883 20:14695878-14695900 TATATGTTTTTTTAAGTGCAGGG + Intronic
1171051735 20:21865787-21865809 TAGTTATATTTTGAGGTACCGGG + Intergenic
1171566492 20:26195993-26196015 TAGTTATATTTTTATGTGATTGG - Intergenic
1172368211 20:34365708-34365730 AAGATGTATTTTTTAGGGCCAGG - Intronic
1173610074 20:44360691-44360713 TATATCTGTTTTTAAGTGCCAGG + Intronic
1175792586 20:61750810-61750832 TAGTTGTACTTCTATGTACCAGG + Intronic
1176230592 20:64030772-64030794 TTGTGGTATTCTTAATTGCCCGG - Intronic
1177401229 21:20607429-20607451 GAGTTTGATTATTAAGTGCCTGG - Intergenic
1177569483 21:22869811-22869833 TTTTTGTATTTTTAAGAGACGGG + Intergenic
1178330517 21:31686563-31686585 TTGTTGGGTATTTAAGTGCCAGG - Intronic
1179058381 21:37956618-37956640 AAGTTTTATTTTTAAGTTCAGGG - Intronic
1179918165 21:44491501-44491523 TATATATATTTTTAAGTTCCAGG + Intergenic
1180647723 22:17353357-17353379 TAATTATACTTTTAAGTTCCAGG + Intergenic
1182457932 22:30463779-30463801 TAGTTGTGTTTACAAGTGACAGG - Intronic
1183022929 22:35041910-35041932 TAGCTGTATATTTCAGTGACAGG + Intergenic
1184905270 22:47479713-47479735 TAATTGAATTTTTAAGTCCTTGG + Intronic
951779827 3:26349934-26349956 TTGTTGTATTTTTAATTTCTAGG + Intergenic
952573360 3:34744414-34744436 TAGGTGTATTTCTTATTGCCTGG - Intergenic
952801812 3:37300043-37300065 TTGTTGTTTTTTTAAGAGACAGG - Intronic
954025461 3:47780038-47780060 TAATTATATTTTTAGGTGTCTGG - Intronic
954206533 3:49063299-49063321 AATTTGTATTTCTGAGTGCCTGG - Intronic
955076263 3:55616633-55616655 TTTTTTTTTTTTTAAGTGCCAGG + Intronic
957111663 3:75968567-75968589 TAGTTATATTTTTATGTGATTGG + Intronic
957504929 3:81107507-81107529 TACTTTTACTTTTAAGTTCCAGG - Intergenic
959038180 3:101388826-101388848 TAATTGGATTCTTAAGTTCCAGG - Intronic
959445773 3:106437327-106437349 AAGTTTTATTTTTAAATGACAGG + Intergenic
959770231 3:110086407-110086429 CAGTTTTATTTATAAGAGCCAGG + Intergenic
959920907 3:111867159-111867181 TACATGTATTTTTAAGTAACTGG - Intronic
960353412 3:116621339-116621361 GAGTTTTTTTTTTAACTGCCAGG - Intronic
961084408 3:124054349-124054371 TATTTTTATTTTTAAGTGATGGG - Intergenic
961182878 3:124889840-124889862 TTTTTGTATTTTTAAGAGACAGG - Intronic
962453780 3:135546662-135546684 TTGTTGTAGTTTTAGGTACCAGG + Intergenic
962886393 3:139631955-139631977 TATTTGTTTTTTTAAGAGACAGG + Intronic
962905230 3:139795284-139795306 TAGCTATTTTATTAAGTGCCTGG + Intergenic
962996973 3:140639558-140639580 TATATGTTTTTTTAAGTTCCTGG + Intergenic
963048000 3:141117511-141117533 TATTTTTATTTTTAAGTTCTAGG + Intronic
963854127 3:150236862-150236884 CAGTGGTATTATTAAATGCCCGG + Intergenic
964065820 3:152577547-152577569 TTGTTATATTGTTAAGTGTCTGG - Intergenic
964575654 3:158164279-158164301 TAGCTTTATTATTAACTGCCAGG + Intronic
964994219 3:162854883-162854905 TAGTTTTATTATTATGTGCTTGG - Intergenic
965823560 3:172708817-172708839 TAGTAATGTATTTAAGTGCCTGG - Intronic
966951338 3:184821174-184821196 TAGTTGCATTTATAAGAGCCAGG + Intronic
967508793 3:190286257-190286279 TCATTGTATTTTTCAGTTCCAGG + Intergenic
968116212 3:196092049-196092071 TAGTGGAATTTTTTAGGGCCAGG - Intergenic
968145687 3:196296918-196296940 TTGTTTTTTTTTTAAGAGCCAGG - Intronic
968328068 3:197838635-197838657 TAATTTTATTTTTCAGTGCGTGG + Intronic
969080520 4:4614331-4614353 TAGTTATATTTTCTAGTGTCAGG - Intergenic
971785489 4:31097158-31097180 TACTTCTATCTTTAAGTGTCTGG + Intronic
971902503 4:32680316-32680338 TAGTTGTATTTTTAAAGACATGG - Intergenic
972505248 4:39714852-39714874 AAGTTCTATTTTTAAGAGACAGG + Intronic
973087516 4:46084606-46084628 TAAGTGTATTTTTAATTGCAAGG - Intronic
974374574 4:61060178-61060200 TAGATGTTTTTTTCAGGGCCTGG + Intergenic
974387893 4:61226687-61226709 TACTTCTATTTCAAAGTGCCTGG + Intronic
974436127 4:61859124-61859146 TCTTTGTATTTTTCAGTGCTTGG + Intronic
974446106 4:61984297-61984319 TACTTGTATTTTTTAGTCCTGGG - Intronic
974516546 4:62921203-62921225 TAATTTTATTTTTAACTTCCTGG - Intergenic
974910512 4:68112571-68112593 TAGTAGTATTTTTTAGAGGCAGG - Intronic
975280877 4:72560831-72560853 TAATTTTAATTTTAAGTTCCAGG - Intronic
975792662 4:77971314-77971336 TAATTTTATTTTTAAGTTCCGGG - Intergenic
976020904 4:80624326-80624348 TCCTTGTATTTTTAAGCTCCAGG - Intronic
976412121 4:84726779-84726801 TGGTTTTTTTTTTAAGTGCATGG - Intronic
976525798 4:86086163-86086185 TAATTTTAATTTTAAGTTCCAGG - Intronic
977283507 4:95071797-95071819 TATTTGTTTTTTAAAATGCCTGG + Intronic
977283509 4:95071827-95071849 TATTTGTTTTTTAAAATGCCTGG + Intronic
978252161 4:106644478-106644500 TTGTTGTATTTTTTAATGTCAGG + Intergenic
980011579 4:127600873-127600895 TATTTGTGTTTTTAAATTCCAGG + Intergenic
980288116 4:130807206-130807228 TATTTGGATTTTTAACTGCTAGG + Intergenic
980288125 4:130807348-130807370 TATTTGGATTTTTAACTGCTAGG + Intergenic
980561278 4:134479836-134479858 TTTTTTTTTTTTTAAGTGCCAGG + Intergenic
980951214 4:139379580-139379602 TGTTTGGATTTTTAAGTGACTGG + Intronic
981928059 4:150160981-150161003 TATTTGTTTTTTTAAGTTACAGG - Intronic
982195107 4:152904056-152904078 TATTTTTATTTTTAAGTTCATGG + Intronic
982402198 4:154980938-154980960 TAGTTTTCTTTATCAGTGCCTGG + Intergenic
982473274 4:155819831-155819853 TATTTGTATTTTTTGGTGTCTGG + Intergenic
982698070 4:158626798-158626820 TCGTTTTATTTTTATGTTCCAGG + Exonic
983217709 4:165017574-165017596 TATTTTTATTTTTAAGTTCCAGG + Intergenic
983589081 4:169388075-169388097 TTGTTGCATTCTTAAGTTCCGGG + Intergenic
983667618 4:170199421-170199443 TAATTGTGTTTTTTAGTGACTGG - Intergenic
984050746 4:174861978-174862000 TTGATGTTTTTATAAGTGCCTGG - Intronic
985680051 5:1251286-1251308 TAGTGGTTTTTAAAAGTGCCAGG + Intergenic
986037752 5:3957261-3957283 TTGTTTTGTTTTTAAGTGACTGG - Intergenic
987148310 5:15013931-15013953 TAGTTGTATTTTCCAGTGGCAGG - Intergenic
987962219 5:24824641-24824663 TAGTTGATTTTGTATGTGCCTGG + Intergenic
988987385 5:36633977-36633999 TTGTAGTATTTTTAAATGGCTGG + Intronic
989295546 5:39821527-39821549 TTGTTGTTTTTGTAAATGCCAGG + Intergenic
990472067 5:56124799-56124821 TAGTTGAATTTTTCAGGGCCAGG - Intronic
991928857 5:71731934-71731956 TGGTTTTATTTTTTAGTGACGGG + Intergenic
993185176 5:84608469-84608491 TACTTATATTTTTAAGTACATGG - Intergenic
993920266 5:93793076-93793098 TATTTTTATTTTTAAGAGACAGG + Intronic
994332442 5:98523039-98523061 TATTTTTATTTTTAAATGGCTGG - Intergenic
995939765 5:117567593-117567615 TAATTTTAATTTTAAGTGCCAGG - Intergenic
996227725 5:121021886-121021908 CAGTAGAATTTTTAAGTGCAAGG + Intergenic
996445592 5:123545990-123546012 TAGTTGTATTTTCATGTGTAAGG + Intronic
997436996 5:133882712-133882734 TATTTTTATTTTTAAGAGACAGG - Intergenic
998702637 5:144721214-144721236 AAATTGTATTATTAAGTGCCAGG + Intergenic
999911926 5:156210640-156210662 TAATTATATTTTTCAGTCCCAGG - Intronic
1000006263 5:157187628-157187650 TGGTTGGAATTTTAAGTGCTGGG + Intronic
1000382934 5:160645194-160645216 TATTTGTTTTTTAAAGTGACAGG - Intronic
1003027553 6:2569647-2569669 TAGTTGTATAAGTAAGTGTCTGG - Intergenic
1004968981 6:20887787-20887809 TAGTTGTTGTTTTAAGAGACAGG + Intronic
1005089002 6:22036579-22036601 TATATCCATTTTTAAGTGCCTGG - Intergenic
1005237888 6:23787045-23787067 TAGATGTATTTTTCTGTGTCTGG - Intergenic
1005320992 6:24653548-24653570 TTGCTGTATTATTAAGGGCCTGG + Intronic
1005347019 6:24900859-24900881 TAGTTGTTGTTTTAAGAGACGGG + Intronic
1006125419 6:31834833-31834855 TAGTTGTTTTCTTATCTGCCTGG - Exonic
1007437582 6:41826924-41826946 TAGTTGTATTTTTTAGTTGGGGG - Intronic
1008618622 6:53249965-53249987 AGGTTGTATTTATAAGTTCCAGG - Intergenic
1009513258 6:64580019-64580041 TATTTATTTTTTTAAGTCCCAGG + Intronic
1010267202 6:73880232-73880254 TATTTTTATTTTTAATTGCCTGG - Intergenic
1011218722 6:85032404-85032426 CAGTTTTATTTGTGAGTGCCTGG + Intergenic
1011232422 6:85178009-85178031 GAGTTTTATTCTTAAATGCCTGG + Intergenic
1011464082 6:87637308-87637330 TATTTGTATTATTAAGTCTCTGG - Intronic
1011726026 6:90211637-90211659 TAGTTGCATTTTCAAGGGTCAGG - Intronic
1011810741 6:91129431-91129453 AAGTTTTATTTTGAAGAGCCAGG - Intergenic
1011961386 6:93094917-93094939 TAGCTGTATTTATAAGTGTGGGG - Intergenic
1012902106 6:105018497-105018519 GAGGTGTATTTTTGAGTGCATGG - Intronic
1013682412 6:112539852-112539874 TAGTTTTATTTTTAAGGGATGGG + Intergenic
1014049526 6:116935896-116935918 TAATTTTTTTTTTAAGTTCCAGG - Intergenic
1014411268 6:121124842-121124864 TCATTGTATTTTTCAGTTCCAGG + Intronic
1014422876 6:121267057-121267079 TAATTTTACTTTTAAGTTCCAGG - Intronic
1015963314 6:138672408-138672430 TAGTTTTATTGTTGAGTGCTGGG - Intronic
1016427107 6:143946600-143946622 CAGTGGTATTCTTAAGGGCCAGG + Intronic
1016710801 6:147169458-147169480 TTTTTATATTTTTAAGTGACTGG + Intergenic
1017438431 6:154439883-154439905 TTGTTTTATTTTTAAGAGACAGG - Intronic
1018332491 6:162745531-162745553 TATTTTTATTTTAAAGTTCCAGG - Intronic
1018768767 6:166954820-166954842 TTTTTGTATTTTTAATAGCCAGG - Intronic
1020053104 7:5095967-5095989 TAGTTGTCTTTTTTAGAGACAGG - Intergenic
1020200764 7:6077969-6077991 TTTTTGTATTTTTAAGGGCCAGG - Intergenic
1020379340 7:7526011-7526033 TATTTGTATCTTTAAGAGCTAGG + Intronic
1020703119 7:11508543-11508565 TAGTTGTATTTTTAATTTTCTGG - Intronic
1022389877 7:29934487-29934509 GAGTTCTATTTTCAAGTGTCTGG - Intronic
1022811877 7:33877030-33877052 ATGTTGTATTTTTATGTGACAGG + Intergenic
1023043210 7:36190706-36190728 TAGTATTATTTTTGTGTGCCAGG - Intronic
1023390035 7:39700990-39701012 TATTTGTGTTTATAAGAGCCAGG + Intronic
1023774011 7:43585555-43585577 TAATTTTATTTTTCAGTTCCAGG - Intronic
1023921247 7:44631865-44631887 TATTTTTCTTTTTAAGGGCCGGG - Intronic
1026106932 7:67428817-67428839 TTTTTTTATTTTTAAGTTCCAGG - Intergenic
1026173193 7:67972618-67972640 AATTTTTATTTTTAAGTTCCAGG - Intergenic
1029000434 7:97148529-97148551 TATTTTTATTTTTAAGAGACAGG - Intronic
1031386382 7:121157085-121157107 TACTTGGATTTTTGACTGCCTGG + Intronic
1031556923 7:123188730-123188752 TTATTGTATTTTTAATTGACAGG + Intronic
1031891218 7:127295220-127295242 GAGTTTTCTTTTTAAGTGACTGG - Intergenic
1032108824 7:129057204-129057226 TTGTTTGTTTTTTAAGTGCCAGG - Intergenic
1034077709 7:148248585-148248607 TGGTTGTTTTTTTAATTGCTGGG + Intronic
1034138376 7:148793148-148793170 TAGTTTTATTTTTAAGAGACAGG - Intronic
1034407898 7:150917449-150917471 TCCTTGTCTTTTTCAGTGCCTGG - Intergenic
1038762114 8:30393897-30393919 TTGTTTTCTTTTTAAGTTCCTGG - Intronic
1038917609 8:32041854-32041876 AAGTGGTATTTATTAGTGCCTGG + Intronic
1039378820 8:37065466-37065488 TAGTTCTATTTTTAAGTTTTTGG - Intergenic
1040030657 8:42820839-42820861 TACTTGTATTTTTAAATGGAAGG + Intergenic
1040783240 8:51136290-51136312 TTATTCTATTTTTAGGTGCCTGG + Intergenic
1041115844 8:54535781-54535803 TAATTTTAATTTTAAGTTCCGGG + Intergenic
1041572672 8:59354964-59354986 TAAATGTATTTTTAAATGCCAGG - Intergenic
1041809268 8:61889295-61889317 TGGGCATATTTTTAAGTGCCAGG - Intergenic
1042123182 8:65509935-65509957 TAGGTGTATTTTTTATTGACTGG - Intergenic
1043311940 8:78871601-78871623 TTGTTTTGTTTTTAAGTTCCAGG + Intergenic
1043580414 8:81705747-81705769 TTTTTGTATTTTTAAGAGACGGG - Intronic
1043668867 8:82855274-82855296 TAATTTTATTTTTAAGTTCCAGG - Intergenic
1043753368 8:83969703-83969725 TGTTTGTATTTTTAAGAACCTGG + Intergenic
1044190182 8:89306770-89306792 CAGTTTTATTTTTAATTGGCAGG - Intergenic
1044222580 8:89686618-89686640 AATTTTTATTTTTAAGTTCCAGG + Intergenic
1044244334 8:89924355-89924377 TAGTTTTTTTTTTAAGTGTTAGG + Intronic
1044684758 8:94816107-94816129 TAGTTGTATTTTTAGTAGACAGG + Intronic
1045262848 8:100591821-100591843 TATTTTTATTTTTAAGAGGCAGG - Intronic
1045792857 8:106005884-106005906 GAGTTTTATTATTAAGTGCCTGG - Intergenic
1048784817 8:138039340-138039362 AATTTTTATTTTTAAGTTCCAGG - Intergenic
1049088687 8:140497133-140497155 TTTTTGTATTTTTAAGAGACAGG + Intergenic
1050143610 9:2542202-2542224 GGGTTGTTTTTTTAAGTTCCAGG + Intergenic
1050391735 9:5150667-5150689 TAGTTGTATTTTTAGTTTTCTGG - Intronic
1050455892 9:5833458-5833480 TATTTCTAATTTTAAGAGCCAGG - Intergenic
1050668249 9:7966358-7966380 TACTTCTTTTTTTATGTGCCAGG - Intergenic
1051625857 9:19099631-19099653 TAATTGCATTTTTAAGAGACAGG + Intronic
1051783490 9:20716250-20716272 CAGTTTTATTTTTCTGTGCCTGG + Intronic
1051878827 9:21819151-21819173 TAATTGTACTTTTAAGTTCTAGG + Intronic
1052305196 9:27000820-27000842 AACTTTTATTTTTAAGTTCCGGG - Intronic
1052336969 9:27330154-27330176 TGATTGGTTTTTTAAGTGCCGGG - Exonic
1052630718 9:31035244-31035266 TTATTGTATTTTTAAGTTTCAGG - Intergenic
1054996809 9:71400748-71400770 TGGTTCTATTTTTAAGTGTATGG + Intronic
1055394696 9:75861687-75861709 AGTTTGTACTTTTAAGTGCCTGG - Intergenic
1058159691 9:101555434-101555456 TGTATGTATTTTTAAATGCCAGG + Intronic
1058495615 9:105555783-105555805 CACTTGTATCTTTAAGTTCCTGG + Intergenic
1058626066 9:106933972-106933994 TATTTGGAGTTTTAAATGCCAGG + Intronic
1058637921 9:107054855-107054877 TTGTTGTATTTTTAAATTTCAGG - Intergenic
1059416751 9:114167281-114167303 TACATTTATTTTTAAGTGCCTGG - Intronic
1059789608 9:117626183-117626205 TAGTAGTATTTTTACCTCCCAGG - Intergenic
1059992419 9:119877796-119877818 TTAATGTCTTTTTAAGTGCCAGG - Intergenic
1060315921 9:122510497-122510519 TATATGTATTTTTAAGTTCTGGG + Intergenic
1185634081 X:1538580-1538602 TTTTTGTATTTTTAAGGGACAGG - Intergenic
1185832260 X:3313563-3313585 TATTTGTATTTTTAAATAGCAGG + Intronic
1186364246 X:8874685-8874707 TCATTTTATTTTTAAGTGGCAGG + Intergenic
1186867060 X:13731047-13731069 TAGTTATACTTTTAAGTTCTAGG - Intronic
1186913935 X:14199613-14199635 TATTTTTTTTTTTAAGTTCCAGG - Intergenic
1187078321 X:15958901-15958923 TAATTTTAATTTTAAGTTCCGGG + Intergenic
1187690260 X:21859038-21859060 TTTTTGTATTTTTAAGTAGCCGG - Intronic
1187690379 X:21860240-21860262 TTTTTGTATTTTTAAGTAGCCGG - Intronic
1188816833 X:34725974-34725996 TATTTTTATTTTTAAGTTCCGGG + Intergenic
1188863088 X:35281661-35281683 TATTTGTACTTTTCAGTTCCGGG + Intergenic
1189014696 X:37085144-37085166 TTGTTTTCTTTTTAAGTTCCTGG - Intergenic
1189405437 X:40718513-40718535 TAATTGTATTTCTAAGTTCAAGG - Intronic
1190854860 X:54283932-54283954 TAGTTTTATGTTTAAGTCCATGG - Intronic
1191113841 X:56831813-56831835 TAGTTGTATTTCTAACAGTCAGG + Intergenic
1191138946 X:57095144-57095166 TGGTTTTATCTTTAAGTCCCTGG - Intergenic
1195432090 X:104800356-104800378 TAGTTTTTTTTTTAAATACCTGG - Intronic
1197676577 X:129337030-129337052 GAGTTTGATTCTTAAGTGCCTGG - Intergenic
1197848072 X:130825450-130825472 TATCTGTATTCTTAAGTGGCTGG + Intronic
1199080085 X:143567328-143567350 TTATTTTATTTTTAAGTTCCAGG - Intergenic
1199655946 X:149995653-149995675 TATTTTAATTTTTAAGTTCCAGG - Intergenic
1200428396 Y:3047345-3047367 TAATTTTAATTTTAAGTTCCAGG + Intergenic
1202347037 Y:23942279-23942301 AAGTTGTATTTTTTTGTGCTGGG - Intergenic
1202523734 Y:25727811-25727833 AAGTTGTATTTTTTTGTGCTGGG + Intergenic