ID: 947328309

View in Genome Browser
Species Human (GRCh38)
Location 2:229001726-229001748
Sequence TGGGGCTTTCGGCAGGTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 176}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947328298_947328309 30 Left 947328298 2:229001673-229001695 CCCCACAACTCATATATTGAAGC 0: 1
1: 4
2: 53
3: 432
4: 1612
Right 947328309 2:229001726-229001748 TGGGGCTTTCGGCAGGTAATTGG 0: 1
1: 0
2: 7
3: 39
4: 176
947328302_947328309 7 Left 947328302 2:229001696-229001718 CCTAACACCTAATGTAGCAGCAT 0: 1
1: 0
2: 0
3: 10
4: 160
Right 947328309 2:229001726-229001748 TGGGGCTTTCGGCAGGTAATTGG 0: 1
1: 0
2: 7
3: 39
4: 176
947328301_947328309 8 Left 947328301 2:229001695-229001717 CCCTAACACCTAATGTAGCAGCA 0: 1
1: 0
2: 1
3: 10
4: 97
Right 947328309 2:229001726-229001748 TGGGGCTTTCGGCAGGTAATTGG 0: 1
1: 0
2: 7
3: 39
4: 176
947328300_947328309 28 Left 947328300 2:229001675-229001697 CCACAACTCATATATTGAAGCCC 0: 1
1: 6
2: 95
3: 614
4: 1820
Right 947328309 2:229001726-229001748 TGGGGCTTTCGGCAGGTAATTGG 0: 1
1: 0
2: 7
3: 39
4: 176
947328299_947328309 29 Left 947328299 2:229001674-229001696 CCCACAACTCATATATTGAAGCC 0: 1
1: 4
2: 59
3: 499
4: 1590
Right 947328309 2:229001726-229001748 TGGGGCTTTCGGCAGGTAATTGG 0: 1
1: 0
2: 7
3: 39
4: 176
947328303_947328309 0 Left 947328303 2:229001703-229001725 CCTAATGTAGCAGCATTTGAAGA 0: 1
1: 0
2: 4
3: 34
4: 461
Right 947328309 2:229001726-229001748 TGGGGCTTTCGGCAGGTAATTGG 0: 1
1: 0
2: 7
3: 39
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947328309 Original CRISPR TGGGGCTTTCGGCAGGTAAT TGG Intronic
901260739 1:7868811-7868833 TGGGGCTGTTGGGAGGTGATTGG + Intergenic
905696522 1:39978555-39978577 TGGGGCCTTTAGGAGGTAATTGG + Intergenic
906256001 1:44350816-44350838 TGAGGCTTGAGGCAGGAAATTGG - Intronic
906716337 1:47972437-47972459 TGGGGCCTCTGGGAGGTAATAGG + Intronic
908064781 1:60390975-60390997 TGGGGCCTTTGGGAGGTATTTGG + Intergenic
909589397 1:77329021-77329043 TGGGGCCTTTGGGAGGCAATTGG - Intronic
910824312 1:91389440-91389462 TGGGGCCTTTGGCAGGTAATTGG + Intronic
912448074 1:109752343-109752365 TGGGGCTTTCTGCAGGCAGGAGG + Intronic
916598734 1:166271975-166271997 TGGGGCTTTTGGGAGGTGATAGG - Intergenic
916901365 1:169227718-169227740 TGGGGCCTTTGGGAGGTAATAGG - Intronic
917272339 1:173291332-173291354 TGGGGCCTTTGGGAGGTGATTGG - Intergenic
919005725 1:191897089-191897111 TATGGCTTTTGGGAGGTAATTGG - Intergenic
920275423 1:204800867-204800889 TGGGGTCTTCGGCAGGTGATTGG - Intergenic
923344075 1:233034240-233034262 TGGGGCCTTTGGGAGGTGATTGG + Intronic
923424439 1:233854793-233854815 TGGGGCTTGTGGTAGGTAATTGG + Intergenic
1062843726 10:689486-689508 TGGAGCTGTCGGAAGGTAACCGG - Exonic
1063802299 10:9594149-9594171 GGGGACTTTGGGAAGGTAATCGG - Intergenic
1063971462 10:11384117-11384139 TGGGGCATTTGGCAGGTGATTGG - Intergenic
1064657061 10:17566769-17566791 TGGGGCTTTTGGAAGGTGACTGG - Intergenic
1076602752 10:131669628-131669650 TGGGGCCTTTGGGAGGTGATTGG - Intergenic
1077715126 11:4573108-4573130 TGAGGCCTTCAGGAGGTAATTGG + Intronic
1078035817 11:7804055-7804077 TGAGGCTTTGGGGAGGTAATTGG + Intergenic
1078085497 11:8231070-8231092 TGGGGCTCCTGGCAGGTAAGCGG + Intronic
1080199371 11:29650599-29650621 TGGGACTTTTGGGAGGTAATTGG + Intergenic
1082891389 11:58142745-58142767 TGGGGTTCTCGCCAGGTATTGGG - Intronic
1083235549 11:61348561-61348583 TGGGGCCTTTGGGAGGTGATGGG + Exonic
1083852654 11:65377107-65377129 TGGGGCTTTGGGCTGGGAACTGG + Intronic
1084075177 11:66769639-66769661 TGGGGCCTTTGGGAGGTAAGTGG + Intronic
1084735545 11:71103087-71103109 TGGGGCCTTCAGCAGGTGATGGG - Intronic
1084744776 11:71162401-71162423 TGGGGCCTTTGGGAGGTAATTGG - Intronic
1084788112 11:71455527-71455549 TGAGGCCTTTGGCAGGTGATTGG + Intronic
1085334525 11:75681139-75681161 TGGGGCTTTTGGGCGGTAATTGG + Intergenic
1087422477 11:97947850-97947872 TGGGGCTTTTGAAAGGTAATTGG - Intergenic
1088677986 11:112214879-112214901 TGTGGCTTTCGGCATTTAGTGGG + Exonic
1090788099 11:130068281-130068303 TGGGGCCTTTGGGAGGTAATCGG - Intergenic
1091701745 12:2667925-2667947 TGGGGCCTTCAGCATGCAATGGG - Intronic
1091933235 12:4414237-4414259 TGGGGCCTTTGGGAGGTAACTGG + Intergenic
1093010344 12:14100914-14100936 TGGGGCTTTTGAGAGGTAATTGG - Intergenic
1095707006 12:45247817-45247839 TGGGGCCTTTGGAAGGTCATTGG - Intronic
1097704364 12:62852256-62852278 TGGGGCTTTTGGGAGGTAATTGG + Intronic
1097717768 12:62984277-62984299 TGAGGCCTTTGGGAGGTAATAGG - Intergenic
1098012580 12:66070778-66070800 TGGGGCCTTTGGGAGGTAGTTGG + Intergenic
1102852396 12:116261086-116261108 TGGGGCCTTTGGCAGGTCGTGGG - Intronic
1105012296 12:132763762-132763784 TGGGGCTTGTGGGAGGTGATAGG + Intergenic
1105615651 13:22009724-22009746 TGGGGCCCTTGGAAGGTAATTGG - Intergenic
1106522925 13:30513782-30513804 TGGGGCCTTTGGGAGGTGATTGG - Intronic
1106592354 13:31108927-31108949 TGGGGCCTTGGGGAGGTGATTGG - Intergenic
1107495869 13:40925113-40925135 TGGGCCTGACGGGAGGTAATTGG - Intergenic
1109394258 13:61734591-61734613 TGGGGCCTTTAGGAGGTAATAGG + Intergenic
1110677215 13:78263112-78263134 TGGAGCCTTTGGGAGGTAATTGG + Intergenic
1113047364 13:106170293-106170315 TGGGGCTTTCTGGAGGGAACTGG - Intergenic
1115091654 14:29584007-29584029 TGGGACTTTCAGCAGCTATTAGG + Intronic
1115712453 14:36065960-36065982 GGGGCCTTTCGGGAGGTGATTGG + Intergenic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1117944297 14:61001191-61001213 AGGGGCTATTGGCAGGTAGTGGG + Intronic
1119866359 14:77978419-77978441 TGGGGCCTTCAGGAGGTAATAGG - Intergenic
1120150065 14:81022842-81022864 TGGGGCGTTTGGGAGGTGATTGG + Intronic
1121813788 14:96913797-96913819 TGGGGCCTTTGGGAGGTGATTGG + Intronic
1124839557 15:33229096-33229118 TGGGGCCTTTGGGAGGTAATTGG - Intergenic
1125311731 15:38386625-38386647 TGGGAATGTCGGCAGGAAATTGG - Intergenic
1127657436 15:61069591-61069613 TGGGGTTTTGGGAATGTAATTGG - Intronic
1136375108 16:29860770-29860792 TGTGGCTTTCGGCAGGATACTGG - Intronic
1137547437 16:49414171-49414193 TGGGGCTTTTGGGGGGTGATGGG + Intergenic
1140237899 16:73175072-73175094 TGGGGTTTTCAGCAGGGAAATGG - Intergenic
1142004372 16:87682433-87682455 TGGGGCCTTTGGGAGGTGATGGG + Intronic
1143400025 17:6637827-6637849 TGGGGCTGTCTGCAGCTAGTGGG - Intronic
1144125915 17:12202743-12202765 TGTGGCTTTTGGGAGGTATTAGG + Intergenic
1148348017 17:46916982-46917004 TGGGGCCTTTGGGAGGCAATTGG - Intergenic
1149979436 17:61298010-61298032 TGGGGCCTTGGGCAAGTCATAGG + Intronic
1150455428 17:65303488-65303510 TGGGGCCTTTGGGAGGTGATTGG - Intergenic
1150835484 17:68560030-68560052 TGGGGCCTTTGGGAGGTGATTGG + Intronic
1151423872 17:74017050-74017072 TGGTCCTTTGGGCAGGTAACTGG - Intergenic
1152572480 17:81126899-81126921 CTGGGCTTTCGGCAGGTCAGGGG - Intronic
1157103391 18:44750422-44750444 TGGGGCCTTTGGGAGGTAACTGG - Intronic
1158441042 18:57474634-57474656 TGGGGCCTTTGGGAGGTGATTGG - Intronic
1158485068 18:57858958-57858980 TGGGGCTTTCTCGAGGTGATTGG + Intergenic
1159376349 18:67598402-67598424 TGGGGCCTTTGGGAGGTAATTGG - Intergenic
1159442692 18:68501695-68501717 TGGGGCCTTTGGAAGGTAATTGG + Intergenic
1167521192 19:49956398-49956420 TGGAGCTTTCGGCTGATAGTAGG - Intronic
1168461862 19:56566583-56566605 TGGGACTTTGGGGAGGTAACTGG - Intergenic
924988892 2:294518-294540 TGGGGCCTTTGGGAGGTGATGGG - Intergenic
925452214 2:3979346-3979368 TGGGTCTTTTGGGAGGCAATGGG + Intergenic
925824484 2:7834001-7834023 TGGGGCCTTTGGGAGGTAATTGG + Intergenic
936837355 2:116724184-116724206 AGGGGCTTGTGGGAGGTAATTGG - Intergenic
937282197 2:120726261-120726283 TGGAGCTTTTGAGAGGTAATTGG - Intergenic
937442407 2:121927882-121927904 TAGGGCTTTGGGGAGGTAATTGG - Intergenic
937901582 2:127023763-127023785 TGGGGCCTTCAGGAGGTGATTGG - Intergenic
938186435 2:129236277-129236299 TGGGGTTTTGGGGAGCTAATTGG + Intergenic
938400385 2:130986515-130986537 TGGGGCCTTCAGCAGGGAAGAGG + Intronic
938851784 2:135267866-135267888 TGGGGCTTTTGGGAGGTGATTGG + Intronic
940001079 2:148966735-148966757 TGGGGCCTTTGGGAGGTGATTGG + Intronic
940170777 2:150827780-150827802 TGGGGAGTGCGGCAGGTAAATGG + Intergenic
940280912 2:151988773-151988795 TGGGGCCTTTGGGAGGTGATTGG - Intronic
943171845 2:184411703-184411725 TGGGGCTTTCTATAGGTAAAAGG - Intergenic
943400416 2:187402904-187402926 TGGGGCTTTTGGGAGATAATTGG + Intronic
943467169 2:188241989-188242011 TGGGGCCTTTGGGAGGTGATTGG + Intergenic
944308954 2:198210868-198210890 TGGGGCATTTGGGAGGTGATTGG - Intronic
944429001 2:199613310-199613332 TGGGACTTTTGGGAGGTGATTGG - Intergenic
944638407 2:201697007-201697029 TGGGGCCTTTGGGAGGTAACTGG + Intronic
946929674 2:224659390-224659412 TGGGGCCTTTGGAAGATAATAGG + Intergenic
947328309 2:229001726-229001748 TGGGGCTTTCGGCAGGTAATTGG + Intronic
947376910 2:229505284-229505306 TGGGGGTTCCTGCAGGGAATCGG + Intronic
948360640 2:237417657-237417679 TGGGGCCTTTGGGAGGTTATTGG + Intergenic
1169153500 20:3308966-3308988 TGGGGCTTTTGGAAGGAAATAGG - Intronic
1169172742 20:3478524-3478546 TGGGGCTTTCGGTGGGTAGGGGG + Intronic
1170321131 20:15099277-15099299 TGGAGCCTTTGGGAGGTAATAGG + Intronic
1170399443 20:15964485-15964507 TGGGGCCTTAGGAAGGTGATCGG - Intronic
1170676314 20:18484409-18484431 TGGGGCTTTTGGTAAGTGATAGG + Exonic
1172526127 20:35601446-35601468 TGGGGCTTGCGGTTGGGAATGGG + Intergenic
1172894696 20:38292316-38292338 TGGTGCTTTCCACAGGTAATGGG - Intronic
1174696546 20:52565354-52565376 TGGGGCCTTTGGAAGGTATTAGG - Intergenic
1174814051 20:53671399-53671421 TGGGGCTTTTGGAAGGTAATAGG + Intergenic
1178347622 21:31845231-31845253 TGGGGCCTTTAGGAGGTAATGGG + Intergenic
1179145153 21:38761581-38761603 TGGGGCTTTCTGCAGGAAGGTGG - Intergenic
1179392100 21:41003381-41003403 TGCAGCTTTCGGCAGCTACTGGG + Intergenic
1180926855 22:19561188-19561210 TAGGGTTTTCGGGGGGTAATTGG + Intergenic
1183261053 22:36796255-36796277 TGGGGCCTTTGGGAGGTGATGGG - Intergenic
1183591681 22:38782762-38782784 TGGGGCTTTCAGGAGGTGCTGGG + Exonic
1183706041 22:39475453-39475475 AGGGGCATTAGGCAGGTGATTGG - Intronic
1184600342 22:45539569-45539591 TGGGGATGTCGGCAGGTCCTGGG + Intronic
950214920 3:11152645-11152667 TGGGGCTTAAGGGAGGTAAGGGG - Intronic
951116340 3:18867263-18867285 TGGGGCCTTTGGGAGGTAATTGG - Intergenic
952114726 3:30164893-30164915 TGGGGTTTTTTCCAGGTAATAGG - Intergenic
952380216 3:32798678-32798700 TGGGGCCTTTGGGAGGTGATGGG - Intergenic
953808891 3:46095167-46095189 TGGGGACTTTGGGAGGTAATTGG + Intergenic
954784209 3:53081218-53081240 AGGTGCCTTCTGCAGGTAATGGG + Intronic
956192860 3:66623595-66623617 TAGGGCCTTTGGGAGGTAATTGG - Intergenic
956453210 3:69394302-69394324 TGGAGCTTTGGGGAGGTAATTGG - Intronic
956683753 3:71805226-71805248 TGGGACTTGCGGGAGGTGATTGG + Intergenic
958141011 3:89562141-89562163 TGGGGCCTTTGGGAGGAAATTGG - Intergenic
958145130 3:89614094-89614116 TGGGGCCTTTGGGAGATAATAGG + Intergenic
960218955 3:115080080-115080102 TGGGGCTTTTGAGAGGTAACTGG + Intronic
961567278 3:127772764-127772786 TGGGGCCTTTGGGAGGTGATAGG + Intronic
964552818 3:157903916-157903938 TGGGGCTTGTGGGAGGTATTTGG + Intergenic
966223304 3:177571549-177571571 TAGGACTTTGGGGAGGTAATTGG - Intergenic
966640865 3:182188055-182188077 TGGGGCTTTTTGGAGGTGATTGG - Intergenic
967968811 3:194984610-194984632 TCTGGCTTTGGGCAGGTTATTGG - Intergenic
968836311 4:2966990-2967012 TGGGGCATTTGGGAGGTGATTGG + Intronic
968952862 4:3703576-3703598 GGGGGCTTTCTGTAGCTAATGGG + Intergenic
971542353 4:27835005-27835027 TGGAGCTTTTGAGAGGTAATTGG - Intergenic
972304081 4:37814990-37815012 TGGGGCCTTCGGGAGGTGATTGG + Intergenic
974010998 4:56607165-56607187 TGGGGCTTTCAGGAGGTGATTGG + Intergenic
976759763 4:88535754-88535776 TGGGGCCTTTGAGAGGTAATTGG - Intronic
977360432 4:95997533-95997555 TGAGGCCTTGGGAAGGTAATAGG - Intergenic
977360572 4:95999274-95999296 TGGGGCCTTGGGAATGTAATTGG - Intergenic
978106311 4:104905744-104905766 TGGGGAATTTGGCAGGCAATTGG + Intergenic
978494953 4:109348713-109348735 TGGGGCCTTTGGGAGGTGATTGG + Intergenic
980263645 4:130487381-130487403 TGGGGCCTTTGGGAGGTGATTGG + Intergenic
980628359 4:135405247-135405269 TGGGACTTTAGTCAGGTTATAGG - Intergenic
980972163 4:139576881-139576903 TGGGGCCTTTGGGAGGTGATTGG - Intronic
981867515 4:149441845-149441867 TGGGACTTTTGGAAGGTGATTGG + Intergenic
981926919 4:150150710-150150732 TGGGGCATTAGGCAGGACATGGG - Intronic
983675721 4:170290060-170290082 TGGGGCCTTTGGGAGATAATTGG - Intergenic
984109607 4:175595994-175596016 TGGGGCCTTTGGGAGGTAATTGG + Intergenic
984337405 4:178410605-178410627 TGGAGCTTTTGGAAGGTGATTGG - Intergenic
984966973 4:185148263-185148285 AGGGGCATTTGGGAGGTAATTGG - Exonic
985814642 5:2117525-2117547 TGGGGCCTTTGGCAGGTTATAGG - Intergenic
986214518 5:5706978-5707000 TGAGGCTTTGGGGAGGTGATTGG + Intergenic
986880193 5:12160535-12160557 TGGGGTTGTTGGGAGGTAATTGG + Intergenic
988978411 5:36538692-36538714 TGGGGCCTTTGGAAAGTAATTGG + Intergenic
990190382 5:53253200-53253222 TGGGGCCTTTGGGAGGTAATAGG - Intergenic
993019687 5:82576795-82576817 TGGGGCCTTTGGGAGGTAATTGG - Intergenic
995307050 5:110664836-110664858 TGTGGCCTTTGGGAGGTAATTGG - Intronic
995987722 5:118200068-118200090 TGGAGCCTTTGGGAGGTAATTGG + Intergenic
996442537 5:123508429-123508451 TAGGGCCTTTGGCAGGTAATAGG + Intergenic
996907114 5:128613399-128613421 TGGGGCCTTTGGGAGGTAACTGG - Intronic
997825583 5:137104137-137104159 TGGGGCTGGTGGGAGGTAATTGG + Intronic
999671525 5:153962853-153962875 TGGGGTTTTGGGTAGGTAATTGG - Intergenic
1000258917 5:159567297-159567319 TTGGGCTTGTGGCAGGGAATGGG + Intergenic
1002134599 5:177099843-177099865 GGGGGCTTTCGGGAGTTAGTGGG - Intergenic
1002469463 5:179426829-179426851 TGGGGCCTTTGGGAGGTGATTGG + Intergenic
1003413196 6:5884212-5884234 TGTGGCTTTCTGCAGCTATTCGG - Intergenic
1003716472 6:8652172-8652194 TGGGGCCTTTGGGAGGTAACTGG + Intergenic
1005224555 6:23626557-23626579 TGGGGCCTTTGGAAGGTGATTGG + Intergenic
1005471220 6:26164353-26164375 TGGGGCTTGAGGCAGGGAAAGGG + Intronic
1007249544 6:40486438-40486460 TGGGGAATTCGGCAGTTAGTGGG + Intronic
1012248602 6:96955127-96955149 TGGAGCCTTTGGGAGGTAATTGG - Intronic
1014623449 6:123697799-123697821 GAGGGCTTTAGGCAGGTCATAGG + Intergenic
1014751051 6:125256458-125256480 TTGGGCATTAGGTAGGTAATGGG + Intronic
1018846067 6:167557243-167557265 TAGGGCTTTTGGAAGGTGATTGG + Intergenic
1021025246 7:15658651-15658673 TGGGGCTTTTGGGAGGTAATAGG + Intronic
1021250930 7:18324045-18324067 TGGGGCTTTTGGAAGCTGATTGG - Intronic
1023111412 7:36815114-36815136 TGGGGCCTTTAGGAGGTAATTGG + Intergenic
1023122091 7:36919945-36919967 TGGGGCTTTTGGCATCTCATAGG - Intronic
1024218583 7:47269039-47269061 TAGGGCCTTTGGGAGGTAATTGG - Intergenic
1024566563 7:50686160-50686182 TGGGGCCTTTGGGAGGTGATTGG + Intronic
1027331593 7:77101398-77101420 TGGGACCTTTGGGAGGTAATTGG + Intergenic
1027388486 7:77681765-77681787 TGGGGTCTTTGGGAGGTAATAGG - Intergenic
1027594967 7:80162053-80162075 TGGGGCATTTGGGAGGTAATTGG + Intronic
1029380794 7:100213216-100213238 TGGGGCCTTTGGGAGGTGATTGG - Intronic
1029784179 7:102769942-102769964 TGGGACCTTTGGGAGGTAATTGG - Intronic
1032702124 7:134391528-134391550 TGGGGCCTTTGGGAGGTGATTGG - Intergenic
1035690589 8:1557111-1557133 GGGTGCTTCCGGCAGGTAGTAGG - Intronic
1037944925 8:22982994-22983016 TGGGGCTTTGGGCAGGTCATCGG - Intronic
1038282496 8:26178609-26178631 TGGGGCCTTTGGGAGGTGATTGG + Intergenic
1038431390 8:27503029-27503051 TGGGGCCTTCAGGAAGTAATTGG + Intronic
1039931662 8:41996546-41996568 GGGGGCTTTCGGAAGGTAATTGG + Intronic
1040821501 8:51563434-51563456 TGGAGCCTTCAGCAGGTAATTGG - Intronic
1042033678 8:64506722-64506744 GGGGCCTTCCGGGAGGTAATTGG + Intergenic
1048870100 8:138790328-138790350 TGGGGCTCTTGGGAGGTGATTGG - Intronic
1048895393 8:138988001-138988023 TGGGGCCTTTGGCAGATGATTGG - Intergenic
1051705403 9:19873823-19873845 TGGGGCATTCGGCAAGTACATGG - Intergenic
1055578224 9:77681041-77681063 TGTGGCTTTTGGGAGGTGATTGG + Intergenic
1055856030 9:80689977-80689999 TGGGGCTTGTGGGAGGTGATTGG + Intergenic
1056137956 9:83647679-83647701 TGGTGCTTTGGGCTGGTGATAGG + Intergenic
1056683205 9:88737962-88737984 TAGGGCTTTCGGAGGGTAAATGG - Intergenic
1056847157 9:90049655-90049677 TGAGGCTTTGGGGAGGTGATAGG + Intergenic
1056941849 9:90962675-90962697 TGGGGCCTTTGGAAGGTGATTGG - Intergenic
1058862421 9:109128973-109128995 TGGAGCCTTTGGTAGGTAATTGG - Intergenic
1062273346 9:135719684-135719706 TGGGGCTTCCGGCAGGCAAGAGG + Intronic
1185876347 X:3705335-3705357 TGGGGCTTTTAGGAGGTGATGGG - Intronic
1185886535 X:3788617-3788639 TGGGGCTTTAGGGAGGCAACCGG + Intergenic
1185936388 X:4261849-4261871 TGGGGCCTTTGGGAGGTGATTGG + Intergenic
1186432375 X:9515847-9515869 TGGGGCTTTAGGCGGGTAAGAGG + Intronic
1186987552 X:15033181-15033203 TGGGGACTTTGGAAGGTAATTGG + Intergenic
1188467416 X:30497759-30497781 TGGGGCCTTTGAAAGGTAATTGG - Intergenic
1189449163 X:41111151-41111173 TGGGGCCTTTGGGAGGTGATTGG + Intronic
1189538768 X:41964597-41964619 TGAGGCCTTTGGGAGGTAATTGG + Intergenic
1190074475 X:47306378-47306400 TGGGACTTTGGGGAAGTAATTGG + Intergenic
1190502391 X:51092543-51092565 TGGGGCTTTTGGGAGGTAATTGG - Intergenic
1196666059 X:118317969-118317991 TGGGGCCTTTGGCAGGTAACTGG + Intergenic
1198300782 X:135332376-135332398 TGGGGCCTTTGGGAGGTGATTGG + Intronic
1199858481 X:151779264-151779286 TGGGGCCTTTGGGAGGTAATTGG - Intergenic