ID: 947328849

View in Genome Browser
Species Human (GRCh38)
Location 2:229007002-229007024
Sequence GAAAATTCACAAATGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 1, 3: 56, 4: 527}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947328849 Original CRISPR GAAAATTCACAAATGAAGCT TGG Intronic
900251582 1:1673208-1673230 GAAAACACAAAAATGAGGCTGGG + Intronic
900261943 1:1735744-1735766 GAAAACACAAAAATGAGGCTGGG + Intronic
900510747 1:3059643-3059665 AAAAATCCACACATGATGCTGGG + Intergenic
902119765 1:14153428-14153450 AAAAAGACATAAATGAAGCTGGG - Intergenic
903203332 1:21761592-21761614 TAAAATATAAAAATGAAGCTGGG + Intronic
903389599 1:22954534-22954556 GAAAATTCACAAATTCTCCTAGG + Intronic
903533320 1:24048938-24048960 AAAAATACAAAAATTAAGCTGGG + Intergenic
905079017 1:35300340-35300362 GAGAATTCTTAAATGCAGCTGGG - Intronic
905520124 1:38591443-38591465 GAAAATTCAGAAAGGTAGCAGGG - Intergenic
906159364 1:43636389-43636411 AAGAATGGACAAATGAAGCTAGG - Intergenic
907826690 1:58024280-58024302 GAAAGATCACAAAAGAAGCTCGG + Intronic
908528692 1:65012629-65012651 GAAAATTCACCAAATTAGCTAGG + Intergenic
908636361 1:66170222-66170244 GACAGTTCAGGAATGAAGCTGGG + Intronic
908695072 1:66830618-66830640 AAAAATTCAAAAAAGTAGCTGGG + Intronic
909095946 1:71289645-71289667 AAATATTCTCAAATGAAGATTGG + Intergenic
910263200 1:85311741-85311763 TAAAATTAATAAATGAGGCTGGG - Intergenic
910781056 1:90933692-90933714 GAAAATTCTAAAATGAAGGTGGG - Intronic
911232213 1:95373375-95373397 GAAATTACAAAAATGAAGGTGGG + Intergenic
911622259 1:100078772-100078794 GAAAATTTACTGATGAGGCTGGG + Intronic
911952542 1:104193696-104193718 TAAAATTCAGAAAAGAAGTTTGG - Intergenic
912054820 1:105581607-105581629 GAAAATACAAAAACGTAGCTGGG - Intergenic
912166494 1:107047742-107047764 CAAAATGCACAAATAAAGCAAGG + Intergenic
912987260 1:114446149-114446171 GAAAATCCTCAATTTAAGCTGGG - Intronic
913420532 1:118663147-118663169 GAAAATAAACAGATGAATCTAGG + Intergenic
914894541 1:151657324-151657346 AAAAATACAAAAATGAAGCTGGG - Intronic
915492940 1:156261532-156261554 TAAAATTAACAAAAGAAGCCTGG + Intronic
916792038 1:168133754-168133776 AAAAATACATAAATGAAGCTGGG - Intronic
916793592 1:168145860-168145882 GAAAATTCTCAAATAAACCAGGG - Intergenic
918619668 1:186588636-186588658 CAAAATTCACATAAGAGGCTGGG + Intergenic
919092430 1:192991629-192991651 AAAAATACAAAAATGTAGCTGGG + Intergenic
919658155 1:200217488-200217510 AGAAATTCACATTTGAAGCTGGG - Intergenic
920341455 1:205277662-205277684 AAAAATACAAAAATGAGGCTGGG - Intergenic
920767760 1:208849919-208849941 ATAAAGTCACAAATGGAGCTAGG - Intergenic
922904265 1:229162063-229162085 GAAAATTAAAAAACGTAGCTGGG - Intergenic
923623929 1:235598884-235598906 AAAAATACAAAAATTAAGCTAGG - Intronic
923958509 1:239050483-239050505 GAATATTCACATACTAAGCTAGG + Intergenic
924068442 1:240251610-240251632 GAAAATTAACAAAGAAATCTAGG - Intronic
924158354 1:241205060-241205082 AAAAAATCACAAATGAATTTAGG - Intronic
924222483 1:241892636-241892658 AAAAATACAAAAATGAAGCTGGG - Intronic
924533468 1:244913595-244913617 GAAAAACCACTAATGAGGCTGGG - Intergenic
924611760 1:245579506-245579528 GAAAATTTAAAAAGGAGGCTTGG + Intronic
924861599 1:247929269-247929291 GAAAATTGACTCATTAAGCTAGG - Intergenic
1063333171 10:5182747-5182769 GAAAATACAAAAAATAAGCTGGG + Intergenic
1063732315 10:8711581-8711603 AAAAATTCCCAAAAGAAGCCGGG - Intergenic
1064163133 10:12962930-12962952 GAAAACACACACATAAAGCTTGG - Intronic
1064190410 10:13200983-13201005 GAAAATCCAAAAATTTAGCTGGG + Intronic
1064762878 10:18639331-18639353 AAAAATACAAAAATGAAGCCAGG + Intronic
1065768163 10:29051569-29051591 AAAAATTCACAAGTGAAGTAGGG + Intergenic
1065788241 10:29236369-29236391 GAAAATTGAAAAAAGAACCTTGG + Intergenic
1065932603 10:30492883-30492905 GAAAATACAAAAAATAAGCTGGG + Intergenic
1065933741 10:30501918-30501940 GAAAAATCACAGAAGAAGCTGGG - Intergenic
1068261073 10:54582751-54582773 GAAAATTAAAAAATATAGCTGGG + Intronic
1068468028 10:57420561-57420583 GAGAATTCACAAAACAGGCTGGG - Intergenic
1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG + Intergenic
1069022717 10:63506537-63506559 GAAAGTTTACAAAAGCAGCTAGG - Intergenic
1069049691 10:63779567-63779589 TAAAATTCTCACATGAGGCTGGG + Intergenic
1070041970 10:72790233-72790255 CAAAATTCACCAAAGAAGATGGG + Intronic
1070046466 10:72842306-72842328 AAAACCTCACAAATGAAACTTGG + Intronic
1071708077 10:88021054-88021076 GGTAATTTACAAATGATGCTGGG + Intergenic
1072581794 10:96746231-96746253 GAAAATTCCCAAAGGCAGTTTGG - Intergenic
1072886955 10:99285629-99285651 GAAAATATATAAATGAGGCTGGG + Intergenic
1073721338 10:106175841-106175863 GTGAATTCACAAATGCAGTTTGG - Intergenic
1073726742 10:106240773-106240795 GAAAATTAACAAATGCACATAGG - Intergenic
1073764117 10:106663316-106663338 GAAAATACACAAATTAATTTGGG - Intronic
1074310281 10:112316495-112316517 TAAAATTAACAAATGAGGCTGGG - Intergenic
1074589646 10:114800615-114800637 GAAAATCCACATATAAGGCTGGG + Intergenic
1074666991 10:115738531-115738553 GAAAATTCCAAAATGCAGCTGGG - Intronic
1075000236 10:118791532-118791554 AAAAATTTACAAATGCAGCCGGG + Intergenic
1075358625 10:121808291-121808313 GAAAGTACACATATCAAGCTGGG + Intronic
1075387458 10:122066560-122066582 GAAAATACAAAAATTAAGCTGGG - Intronic
1076133036 10:128026884-128026906 GTATATTCACACTTGAAGCTTGG + Intronic
1077999236 11:7480049-7480071 GAAAAATCACAAAATTAGCTGGG - Intergenic
1078229040 11:9421781-9421803 AAAAATTCAAAAATGTAGCCGGG + Intronic
1079438118 11:20478338-20478360 GAAAGTTCAGAAATAAAGTTAGG + Intronic
1081914502 11:46722138-46722160 GTAATTTAACAAATGAGGCTGGG - Intronic
1082125625 11:48428414-48428436 GAGAAGTCACAGATGAAACTTGG - Intergenic
1082169453 11:48985357-48985379 GAGAATTCCAAAATGAAGCCCGG + Intergenic
1082250798 11:49977796-49977818 GAGAAGTCACAGATGAAACTTGG + Intergenic
1082559240 11:54599444-54599466 GAGAAGTCACAGATGAAACTTGG - Intergenic
1082863349 11:57875708-57875730 GAAAATTCCTAAGTGAGGCTGGG + Intergenic
1082882888 11:58055637-58055659 GAAAATACAAAAATGTAGCCAGG + Intronic
1084442784 11:69184972-69184994 AAAAATACACAAATTAGGCTGGG - Intergenic
1084680845 11:70665433-70665455 GAAAATTCTCAGATGGAGCAGGG - Intronic
1086082982 11:82924517-82924539 AAAAATAAACAAATGAGGCTGGG + Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1086572490 11:88301511-88301533 CAAAACTCACAAATGAGGCAAGG - Intronic
1086838417 11:91654162-91654184 TAAAATATACAAATGAGGCTGGG - Intergenic
1087128624 11:94650433-94650455 CAAAATGCACAAATGAGGCAAGG - Intergenic
1087442286 11:98201844-98201866 AAAAATTAACAAAATAAGCTGGG + Intergenic
1087590804 11:100185545-100185567 AAAAATTCACAAGTGAAGTTAGG - Intronic
1087636315 11:100705434-100705456 AAAAACTCACAAAAGAAGCCAGG - Intronic
1089935219 11:122357627-122357649 AAAAATTCAAAAATGTAGCTGGG + Intergenic
1090024009 11:123152360-123152382 AAAAATACAAAAATGTAGCTGGG + Intronic
1090349279 11:126097199-126097221 GAAAATACAAAAATTAGGCTGGG - Intergenic
1090912605 11:131134612-131134634 GAAAAATCAGCAAGGAAGCTAGG - Intergenic
1090999992 11:131902431-131902453 GAACATTTACAAATCAAACTTGG + Intronic
1091487624 12:905110-905132 GGAAATTTAAAAATGAATCTTGG + Intronic
1092213699 12:6665585-6665607 GAAAATACAAAAAATAAGCTAGG - Intergenic
1092215670 12:6680350-6680372 GAAAATTAAAAAATGAAGACTGG + Intronic
1093246464 12:16743880-16743902 GAAAATACAAAAAATAAGCTGGG + Intergenic
1093337480 12:17923845-17923867 GAAAATTAACAAAGTAAGATTGG + Intergenic
1093382518 12:18510264-18510286 GAAAATTAAAAAATGAAGATAGG - Intronic
1093707086 12:22286454-22286476 AAAAATTCAGAAATGAATCATGG - Intronic
1094058655 12:26290883-26290905 GAAAATTCACAAGCGGAGATGGG + Intronic
1096381798 12:51164677-51164699 ATAAAATCAGAAATGAAGCTGGG + Intronic
1097524490 12:60713585-60713607 GAAAATTAACAAAGAAATCTTGG + Intergenic
1097634024 12:62100379-62100401 GAAATTTCAGAAATGAAGGCTGG + Intronic
1097754117 12:63390128-63390150 CAAAATGCACAAATAAAGCAAGG - Intergenic
1098092472 12:66918785-66918807 GAAAGTTGCCAAATGAAGATTGG - Intergenic
1098497777 12:71156218-71156240 GAATATTCACTAAAGAAGATAGG - Intronic
1099050429 12:77775845-77775867 GTAAATTTACATCTGAAGCTGGG + Intergenic
1099794876 12:87387356-87387378 AAAAATTGACAAATAGAGCTAGG + Intergenic
1099956463 12:89355456-89355478 GAGAAATCAGAAATGTAGCTGGG - Intergenic
1100424138 12:94466578-94466600 GAAAATCCACAAATCAATTTAGG - Intergenic
1101270562 12:103139640-103139662 GAAAACTCAGAAATGAATATAGG + Intergenic
1101482567 12:105113872-105113894 GAAAATTCAAAAATGATGAAAGG + Intronic
1101697750 12:107142389-107142411 GAAAATTTAGAAATGATGCCTGG - Intergenic
1102053854 12:109881610-109881632 GAAAACACACAAACGAAGCAAGG - Intergenic
1102161693 12:110774330-110774352 AAAAATACAAAAATTAAGCTGGG + Intergenic
1102193907 12:111010546-111010568 GAAAATACAAAAATTTAGCTGGG + Intergenic
1102240391 12:111321171-111321193 AAAAATACAAAAATTAAGCTGGG + Intronic
1102318797 12:111912898-111912920 CAAAATTCAAGAATGAAGTTTGG - Intergenic
1102506991 12:113389999-113390021 GAAAATGGACAAATGAGGCCAGG - Exonic
1102656910 12:114489814-114489836 GAAAATTCGCAAATGAATATTGG - Intergenic
1103229626 12:119318393-119318415 GAAAATTCAGAAAACAGGCTGGG + Intergenic
1103770544 12:123319566-123319588 GAAAATACAAAAATTTAGCTGGG - Intronic
1104021730 12:124996619-124996641 TAAAATTCACAAAACAGGCTGGG - Intronic
1104075759 12:125388266-125388288 AAAAATACACAAAAGTAGCTGGG + Intronic
1104210208 12:126681722-126681744 TTAAATTCACAAATGAAGAGGGG - Intergenic
1107138591 13:36972829-36972851 AAAAATTCACAAAATTAGCTGGG + Intronic
1107177182 13:37412254-37412276 AAGAATCCACAAATGAGGCTGGG + Intergenic
1110416168 13:75255178-75255200 AAAAATTCACAAATGTATGTGGG + Intergenic
1110632742 13:77728276-77728298 GTAAATTCACGCATGAGGCTGGG + Intronic
1111343111 13:86913993-86914015 GAAAGTTAACAATTGAAGTTTGG + Intergenic
1111676596 13:91396223-91396245 TAAACATTACAAATGAAGCTAGG - Intergenic
1112114539 13:96337809-96337831 GAAAATTCAGGAATCAATCTAGG - Intronic
1114161177 14:20169453-20169475 AAAAATACAAAAATGTAGCTGGG + Intergenic
1114291667 14:21293581-21293603 AAAAATACAAAAATTAAGCTGGG + Intronic
1114326612 14:21595392-21595414 CAAAATACACAAATTAGGCTGGG + Intergenic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1115773109 14:36687110-36687132 GAAAATACAAAAATTTAGCTGGG - Intronic
1116508176 14:45711437-45711459 AAAAATTCACAAATTAAGAATGG - Intergenic
1116610206 14:47059477-47059499 GAAATTTCACAAATCAATGTTGG + Intronic
1117222124 14:53616867-53616889 GGAAATTCCCAAAGGAAACTGGG + Intergenic
1117292896 14:54350886-54350908 GAAAATACAAAAATTTAGCTGGG - Intergenic
1117825675 14:59700768-59700790 GAAAACAAACAAATGAATCTTGG + Intronic
1118456447 14:65949165-65949187 GAAATAAAACAAATGAAGCTTGG - Intergenic
1118822245 14:69353114-69353136 CAAAAATGACAAATGAGGCTGGG - Intronic
1120465563 14:84852958-84852980 GAAACTTCCCAAATGAAGAAAGG - Intergenic
1120613283 14:86669609-86669631 TAAAATTCAAAAATGTATCTAGG + Intergenic
1121766608 14:96492902-96492924 AAAAAATCACTAATGAGGCTGGG + Intergenic
1123436286 15:20256992-20257014 AAAAATTCACAAAATTAGCTGGG - Intergenic
1123712925 15:23003416-23003438 TTAAATTCACCAATGAAACTAGG + Intronic
1124009024 15:25820700-25820722 GAAAATTCAAAAATGCTGCTTGG + Intronic
1124056755 15:26247449-26247471 AAAAATTAACAAAGGAGGCTGGG - Intergenic
1124720351 15:32106138-32106160 GGACATGCACAAGTGAAGCTGGG + Intronic
1125012973 15:34900051-34900073 AAAAATTCAAAAAAGTAGCTGGG - Intronic
1125411755 15:39413560-39413582 GTAAATACACAAATAAGGCTTGG + Intergenic
1126175817 15:45734347-45734369 GCAAGGTCACAAATGAAGATTGG + Intergenic
1126416090 15:48418869-48418891 GAAACTTCACAAATGCAGGATGG + Intronic
1126581241 15:50244461-50244483 AAAAATTAAAAAATGTAGCTGGG - Intronic
1126887788 15:53170523-53170545 GAAAATTCAGAAATGAAAAAAGG - Intergenic
1127236285 15:57056299-57056321 GAAAATACAGAAAAGTAGCTGGG - Intronic
1127614917 15:60674763-60674785 GAAAATTAACAACTCAAGTTGGG + Intronic
1127661559 15:61104258-61104280 GAAAATTAACAAACGCACCTAGG + Intronic
1127829166 15:62735183-62735205 GAAATTTCACAGATGAAGCCTGG - Intronic
1128644483 15:69365401-69365423 TAAAATTCATAAAGGAGGCTGGG - Intronic
1129990164 15:79955108-79955130 GAAAATTGACTAATGCAGCATGG - Intergenic
1130848208 15:87767335-87767357 GTGAATTAAGAAATGAAGCTTGG - Intergenic
1130889710 15:88123336-88123358 GAAAATTCAAAACTGAGACTGGG + Intronic
1131085052 15:89568895-89568917 AAAAAATTAAAAATGAAGCTGGG - Intergenic
1131496348 15:92914535-92914557 TAAAATTCACAGCTGAAGCCAGG - Intronic
1131545159 15:93309718-93309740 AAAAATACAAAAATTAAGCTTGG + Intergenic
1131576160 15:93593468-93593490 CAAAATTCACTGCTGAAGCTGGG - Intergenic
1131719080 15:95147702-95147724 GAAAATCCAAAATTCAAGCTGGG + Intergenic
1131942278 15:97580284-97580306 GAAAATATACAAATGGGGCTGGG - Intergenic
1132151970 15:99468282-99468304 CATAATTCAAAAATGAGGCTGGG + Intergenic
1132207568 15:99997117-99997139 GAAAATTCTCACATCAAGATAGG - Intronic
1133122599 16:3619520-3619542 AAAAATACAAAAATGGAGCTAGG - Intronic
1134582693 16:15384497-15384519 AAAAATGCAAAAATTAAGCTGGG - Intergenic
1135527783 16:23227285-23227307 GAAAAAGCACAAATAAGGCTCGG - Intergenic
1135540415 16:23325560-23325582 AAAAATTCAAAAAAGAGGCTGGG - Intronic
1136130260 16:28215892-28215914 AAAAATACAAAAATGAGGCTGGG + Intergenic
1137944452 16:52720358-52720380 CAAAATACACACATGAGGCTGGG - Intergenic
1138019940 16:53469745-53469767 GAAAGTTCACTAATGAATATAGG + Intronic
1139706740 16:68746262-68746284 AAAAATTCAAAAATTCAGCTGGG + Intronic
1139713187 16:68792079-68792101 AAAAATTCAAAATTTAAGCTGGG - Intronic
1139858365 16:69999646-69999668 GAAAATGCAAAAATTAAGCCGGG - Intergenic
1140034041 16:71359412-71359434 GAAAATGGACAAAGGAAGCAGGG - Intronic
1140043904 16:71426932-71426954 TAAAATCCACAAATGAGGCCGGG + Intergenic
1140769731 16:78192333-78192355 AAAAATTCAAAAATTAGGCTTGG + Intronic
1140852390 16:78947348-78947370 GAAAAATAACAAATGCAGCTAGG - Intronic
1141670565 16:85489593-85489615 GCAACTTCACGAATGAAGCACGG - Intergenic
1143343321 17:6231424-6231446 AAAAATTGACAAAGGAGGCTGGG + Intergenic
1143561860 17:7701262-7701284 AAAAATACAAAAATGAGGCTGGG - Intronic
1144327051 17:14192520-14192542 TGAAAATCACAAACGAAGCTAGG + Intronic
1144475937 17:15589383-15589405 TGAAAATCACAAACGAAGCTAGG + Intronic
1144762192 17:17713478-17713500 GAAAATACAAAAATTTAGCTGGG + Intronic
1145000039 17:19298167-19298189 AAAAATACATAAATGAGGCTGGG - Intronic
1145354466 17:22128804-22128826 CAAAATGCACAAACAAAGCTAGG + Intergenic
1145715853 17:27020346-27020368 AAAAATACAAAAATGTAGCTGGG + Intergenic
1145951579 17:28822462-28822484 AAAAATACAAAAATTAAGCTGGG + Intronic
1146215491 17:30975905-30975927 GAAGAGTCAGAATTGAAGCTTGG - Intronic
1146645361 17:34573659-34573681 GGAAAAACACAAAGGAAGCTGGG + Intergenic
1146789715 17:35744485-35744507 GAAATTTGAAAAAAGAAGCTGGG + Intronic
1146876867 17:36420815-36420837 GAAAATACACAAAATACGCTGGG - Intronic
1147062516 17:37892042-37892064 GAAAATACACAAAATACGCTGGG + Intergenic
1147275756 17:39315090-39315112 GCAAATACAAAAATTAAGCTGGG - Intronic
1148761071 17:50000888-50000910 GAAAAATCAGTAAAGAAGCTGGG + Intergenic
1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG + Intergenic
1150293816 17:63997535-63997557 GAAAATCCAGACAGGAAGCTGGG - Intergenic
1150973630 17:70058948-70058970 GTTAATGAACAAATGAAGCTGGG + Intronic
1151472960 17:74329285-74329307 GAAAATACAAAAATTTAGCTGGG + Intronic
1151951685 17:77357773-77357795 GAAATTTTGAAAATGAAGCTGGG - Intronic
1152105664 17:78327281-78327303 AAAAATACAAAAATTAAGCTGGG + Intergenic
1152367778 17:79866646-79866668 AAAAATACACAAATTAAGCCAGG - Intergenic
1152796956 17:82312865-82312887 AAAAATTAACAACTGAAGCCGGG - Intergenic
1153848737 18:9072991-9073013 GAAAATACAAAAATTAGGCTGGG + Intergenic
1155505889 18:26532422-26532444 AAAAATTTAAAAATGTAGCTGGG - Intronic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1155951240 18:31915599-31915621 AAAAATACAAAAATGAAGCCGGG + Intronic
1156563839 18:38160831-38160853 AATAATTCACATATGAAGATTGG + Intergenic
1157373074 18:47136009-47136031 AAAAAATCACAAATGAATCCTGG - Intronic
1157720080 18:49916788-49916810 GAGAATTCACATTTGATGCTGGG - Intronic
1158694015 18:59687104-59687126 GAAAATTCCAAAATGAAGCAAGG + Intronic
1159010428 18:63054130-63054152 GAAAATCCAAGAATGTAGCTTGG + Intergenic
1159709844 18:71743576-71743598 AAAAATTCACAAGTGAGGCCCGG + Intronic
1162144709 19:8606560-8606582 AAAAATACAAAAATGTAGCTGGG - Intronic
1162534749 19:11256252-11256274 GATAATTTACAAAAGATGCTGGG + Intronic
1162688793 19:12411911-12411933 GCAAATTCAAAATGGAAGCTGGG - Intronic
1162838107 19:13334871-13334893 GAAAAATAAAAAATGTAGCTGGG + Intronic
1163239090 19:16048192-16048214 AAAAATTCACAAAATTAGCTGGG + Intergenic
1163292726 19:16391136-16391158 TAAAATTAATGAATGAAGCTTGG + Intronic
1167549679 19:50151675-50151697 AAAAATTCAAAAATTAAGCCGGG + Intergenic
1168090319 19:54078660-54078682 AAAAATACAAAAATGAGGCTGGG - Intronic
1168341695 19:55627607-55627629 TAAAATTTAAAAATGAATCTGGG + Intergenic
926489303 2:13504208-13504230 AAAAATACACAAATTAGGCTAGG - Intergenic
927976334 2:27341329-27341351 AAAAATACACAATTGAGGCTGGG - Intronic
928151059 2:28829646-28829668 GAAAATACAAAAATTAGGCTGGG + Intronic
928964179 2:36961055-36961077 AAAAATTCACAAAGTTAGCTGGG - Intronic
929162199 2:38843499-38843521 GAAAAATCAAAAATGAAGAGGGG - Intronic
929898394 2:45981123-45981145 GAAAATGCAACAATGAAGCTAGG + Intronic
930441996 2:51420593-51420615 GAAAAATCACCCATGAAGCCAGG + Intergenic
930603876 2:53472546-53472568 TAAAATTCGCAATTGGAGCTGGG + Intergenic
931138137 2:59427454-59427476 GCAAATTTACAAATGAACCTGGG + Intergenic
932661319 2:73655513-73655535 GATTTTTCACAAATGATGCTTGG - Intergenic
933079804 2:77971902-77971924 AAAAATACAAAAATGTAGCTGGG + Intergenic
933223532 2:79718244-79718266 GAAAATTCTTTTATGAAGCTAGG - Intronic
933511579 2:83246783-83246805 AAAAATACAAAAATTAAGCTGGG + Intergenic
934473046 2:94573232-94573254 AAAAATACAAAAATTAAGCTGGG - Intergenic
935531651 2:104240227-104240249 GAAAATTCAGAAAGGAGACTAGG + Intergenic
937595333 2:123665399-123665421 AAAAATTCAAAAATTTAGCTGGG + Intergenic
938470210 2:131553136-131553158 AAAAATGCACCAAAGAAGCTGGG - Intergenic
940220956 2:151350834-151350856 GAAAATACAAAAATGAACCTGGG + Intergenic
940247603 2:151636482-151636504 GAAGACTCAAAAATGAGGCTAGG + Intronic
940868976 2:158844112-158844134 TAAAATTCACAAAAGTAACTGGG + Intronic
941152423 2:161931287-161931309 GAAAGTCCCCAAAAGAAGCTAGG - Intronic
941173842 2:162172661-162172683 GAACATTAGCAAATGAATCTTGG - Intronic
941363026 2:164576502-164576524 GAAAAATCACTAATCAATCTGGG + Intronic
941390216 2:164903898-164903920 GAAATTTCTCAAATGATGCAAGG + Intronic
941539767 2:166767609-166767631 TAAAGTTCACAAATGTAGCTAGG - Intergenic
941698300 2:168576865-168576887 GAGAATTCAAGAATGACGCTTGG + Intronic
942029616 2:171945963-171945985 AAAAATTCAAAAATTAGGCTGGG - Intronic
942059906 2:172219008-172219030 GAAAATACGAAAATTAAGCTGGG - Intergenic
942259014 2:174139004-174139026 GAAATTTGAAAAATGAAGTTAGG - Intronic
942354546 2:175095256-175095278 AAAAATACAAAAATTAAGCTGGG - Intronic
943510746 2:188824006-188824028 AAAAAATAACAAATGAAGCCAGG - Intergenic
943899787 2:193418888-193418910 AAAAATACAAAAATGTAGCTAGG - Intergenic
944561914 2:200948206-200948228 GAAAATTTAAAAATTAGGCTGGG - Intronic
944791954 2:203140003-203140025 GAAAATACACAAAAGCGGCTGGG + Intronic
946288730 2:218726760-218726782 GAAATTTCACAAAAGAGGCCAGG - Intronic
946796366 2:223358517-223358539 TAAAATTCAAAACTGAAGCTTGG - Intergenic
946909237 2:224443526-224443548 AAAAATTAAAAAATGAAGCCTGG - Intergenic
947030428 2:225786425-225786447 TTAAATTTAAAAATGAAGCTGGG - Intergenic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
947474758 2:230433738-230433760 GCAAATTCAAAAATAAAGGTAGG - Intronic
948527958 2:238584745-238584767 TAAAATTCACAAAAGAGGCCAGG + Intergenic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1170168715 20:13387352-13387374 AAAAATACAAAAATTAAGCTGGG - Intergenic
1171165027 20:22962241-22962263 GAAAAATCAGAAATGAGGCTGGG - Intergenic
1172582202 20:36057287-36057309 AAAAATACAAAAATGAAGCTGGG + Intergenic
1173364476 20:42372442-42372464 GAAAATATACAAATTTAGCTAGG - Intronic
1173551469 20:43935764-43935786 GAAAATACAAAAATTTAGCTGGG + Intronic
1174361685 20:50032804-50032826 AAAAATACAAAAATTAAGCTAGG + Intergenic
1174801944 20:53571563-53571585 AAAAATACACAAATTTAGCTGGG - Intronic
1175042476 20:56067864-56067886 GAAAATTAACATATGAAACAAGG + Intergenic
1175672133 20:60912647-60912669 GAAAATACAAAAATTTAGCTAGG + Intergenic
1175837341 20:62004620-62004642 GAAAATTCAGAAAGGGAGCTGGG - Intronic
1175989984 20:62783850-62783872 CAAAAATCACAAAAGACGCTGGG + Intergenic
1176936825 21:14876942-14876964 CAAAAATCCCAAAGGAAGCTGGG - Intergenic
1176972709 21:15285418-15285440 GTAAATCCAGAAATGAAGCTGGG - Intergenic
1177242950 21:18484790-18484812 GACAATTTACCAATGATGCTAGG - Intronic
1177679491 21:24347399-24347421 GAAAATACACAAAATTAGCTGGG - Intergenic
1177691377 21:24512436-24512458 GAAAATTGTCAAATGAAGTTCGG + Intergenic
1177879329 21:26673456-26673478 GAAAATTTAAAAATGTAGCTGGG - Intergenic
1177966296 21:27731165-27731187 GAAATCTCACGAATCAAGCTTGG - Intergenic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1178999277 21:37440430-37440452 GAAAAAGAGCAAATGAAGCTGGG - Intronic
1180272649 22:10613323-10613345 AAAAAATCAACAATGAAGCTGGG + Intergenic
1180644340 22:17326171-17326193 CAAAATACAAAAATGTAGCTGGG + Intergenic
1181927451 22:26371470-26371492 GAATATACACAAATGTAGCTGGG + Intronic
1182201628 22:28577507-28577529 GAAAATCCACAAATAAACATTGG - Intronic
1182628567 22:31666669-31666691 TAAAATTAAAAAATGAGGCTGGG - Intergenic
1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG + Intronic
1182833129 22:33319899-33319921 GAACATTTCCAAATGCAGCTTGG + Intronic
1182838993 22:33369432-33369454 GAAAATAGAAAAAAGAAGCTTGG - Intronic
1183903669 22:41023911-41023933 AAAAATACAAAAATTAAGCTGGG - Intergenic
1183982920 22:41552969-41552991 AAAAATACAAAAATGAGGCTGGG - Intergenic
1184283764 22:43454463-43454485 AAAAATTCAAAAAATAAGCTGGG - Intronic
1184294260 22:43514005-43514027 AAAAATTCAAAAAATAAGCTGGG + Intergenic
1184297757 22:43536359-43536381 TAAAATGCACAAATGAAACCAGG - Intronic
1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG + Intronic
1184819309 22:46897136-46897158 CAAAATGCACAAACAAAGCTAGG + Intronic
1185407984 22:50666549-50666571 GAAAATACAAAAACGTAGCTGGG - Intergenic
949126821 3:455095-455117 AAGAATTCACAAAGTAAGCTCGG - Intergenic
949577918 3:5356832-5356854 AAAAACTCACCCATGAAGCTGGG - Intergenic
951625647 3:24660324-24660346 GAAAATTAACAAATAAACATTGG - Intergenic
951626438 3:24669361-24669383 CAGAATTCACAAGTGAACCTGGG + Intergenic
952527330 3:34224280-34224302 GAGAATGCACAAAAGAGGCTGGG - Intergenic
953005394 3:38972982-38973004 GAAAATTAATTAATGAGGCTTGG + Intergenic
953085844 3:39666152-39666174 GAAAATTCATAAATGGGGATTGG + Intergenic
953334744 3:42084870-42084892 GAAAGTTAACAAGAGAAGCTTGG - Intronic
953401013 3:42617050-42617072 TAAAATTCACATTTTAAGCTGGG - Intronic
953423731 3:42774925-42774947 GAAAATTCTCAAAAGAATTTTGG - Intronic
954530572 3:51315280-51315302 GAAAATCCACAAATCAATTTTGG - Intronic
954739889 3:52740636-52740658 AAAAATACAAAAATGTAGCTGGG + Intronic
955931537 3:64062366-64062388 GATAATACAGAAATGAAGCTGGG + Intergenic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
957276449 3:78096459-78096481 GAAAATTCATAAATTGAGTTTGG - Intergenic
957460204 3:80508058-80508080 GAAATTTTATGAATGAAGCTTGG + Intergenic
958153138 3:89717990-89718012 CTAAAATCAGAAATGAAGCTGGG - Intergenic
958790595 3:98646444-98646466 TAAAAATCAGAAATGAACCTGGG - Intergenic
959358753 3:105365430-105365452 GAAAAATCACAGCTGAAGATAGG + Intergenic
959827958 3:110822789-110822811 GAAACTTCACAAAAGAAGTATGG + Intergenic
960459956 3:117921466-117921488 GGACATTCACAAAATAAGCTGGG + Intergenic
960576686 3:119237043-119237065 GGAAATCCACACATGAAGCCAGG + Exonic
960778933 3:121295579-121295601 GAAAATTCACACATACTGCTAGG - Intronic
960839767 3:121945267-121945289 TAAAATATACAAAGGAAGCTAGG + Intergenic
962490824 3:135892646-135892668 GAAAATACAAAAAAAAAGCTGGG + Intergenic
962744209 3:138385440-138385462 AAAAATTTACAAATAAAGCTGGG - Intronic
962941574 3:140129397-140129419 GCTAATTAACAAAAGAAGCTAGG - Intronic
963653616 3:148016697-148016719 GAAAATTCACAAAGAAACATTGG + Intergenic
964346258 3:155757450-155757472 AAAAATACAAAAATGTAGCTGGG + Intergenic
966345994 3:178980597-178980619 GAAAATTCACAAAGAAATATTGG - Intergenic
966350066 3:179024055-179024077 GAATATTCAAATATGAGGCTTGG + Exonic
966367540 3:179206216-179206238 GAAAATACAAAAAATAAGCTGGG - Intronic
966571539 3:181449502-181449524 GAAAATACAAAAAATAAGCTGGG + Intergenic
966988234 3:185202040-185202062 AAAAAATCACAAGTGAGGCTGGG + Intronic
967370946 3:188745417-188745439 GAAAATTCACAAATGAATACAGG - Intronic
967569244 3:191009095-191009117 GAAAAGAGACATATGAAGCTAGG + Intergenic
967707563 3:192669424-192669446 GAAAATACAAAAATTTAGCTGGG + Intronic
967907026 3:194509911-194509933 GAAAAGTCACTAGTGAGGCTGGG - Intergenic
968134812 3:196213628-196213650 GAAAAATCAAAAAAGAGGCTGGG - Intronic
968136144 3:196220851-196220873 CAAAGTTTACAAATGAAGCGAGG - Intronic
968837876 4:2978932-2978954 GAAAATACACAAATTAGGCTGGG + Intronic
969708028 4:8823290-8823312 AAAAATACAAAAATTAAGCTGGG + Intergenic
970051035 4:11915508-11915530 GAAAATTGAGAGATGAAGATTGG + Intergenic
970398878 4:15699040-15699062 GAAATTTCAGAGATGAAGTTGGG - Intronic
970757725 4:19446355-19446377 GAAAATTAACAAATAAACATTGG + Intergenic
970937221 4:21587321-21587343 GAAAAATCACAAATGAGGTAAGG + Intronic
971106620 4:23532211-23532233 AAAGATTCACAAAAGAAACTAGG + Intergenic
971176862 4:24290382-24290404 GGATATTCACTGATGAAGCTGGG - Intergenic
971248711 4:24953375-24953397 GAAAAGACAAAAATGAAGCAGGG - Intronic
971620067 4:28844719-28844741 CAATATTCACAAATGAGGCCAGG + Intergenic
971689701 4:29816934-29816956 CAAAATTCAGAAAGGAAGGTGGG + Intergenic
972116528 4:35642551-35642573 CAAAATGCACAAATAAAGCAAGG + Intergenic
972463164 4:39325676-39325698 GAAGATTCACAGATGAGGCTGGG - Intronic
972863154 4:43196792-43196814 GAAAACTCAGAAATGCAGATAGG + Intergenic
972871562 4:43306262-43306284 GAAATTTCCCATATGAAACTTGG - Intergenic
973080855 4:45991620-45991642 GAAAATTCACCAGTGAAGGAGGG - Intergenic
974556432 4:63455631-63455653 GAAAATTCTCATATGAATCTTGG + Intergenic
975223453 4:71841001-71841023 GAAATTACACAAATGATACTGGG - Intergenic
975269264 4:72410398-72410420 GAAAATCCTGAAAGGAAGCTAGG + Intronic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
976670239 4:87644272-87644294 GAAAATTCAAAAAAGTGGCTGGG - Intergenic
976694862 4:87908557-87908579 GAAAATTCATAAAGGAGCCTTGG + Intergenic
977118485 4:93065619-93065641 TAAAATTCAGAACTAAAGCTTGG + Intronic
977481210 4:97578263-97578285 AAAAATACACAAATTTAGCTGGG - Intronic
977573320 4:98652357-98652379 GAAAATTCATAAATGAAAATTGG - Intronic
977829142 4:101569812-101569834 GAAAATTCTTAAAAGAAGATAGG + Intronic
978597648 4:110395674-110395696 GAAAGTTCAGAAATGCAGCTTGG - Intronic
979303855 4:119119766-119119788 GACAATTCAATAATTAAGCTAGG + Intergenic
979975380 4:127189829-127189851 GACACTTCAGAAATGAAGATTGG + Intergenic
980267838 4:130543004-130543026 GAAAATGCACAAACAAAGCAAGG + Intergenic
980340773 4:131543054-131543076 GAAAATGCATAAATCAATCTAGG - Intergenic
980546179 4:134266181-134266203 GAAAATACAGAAACCAAGCTGGG + Intergenic
981304339 4:143230316-143230338 GAAAATACACAAAATTAGCTGGG - Intergenic
981405376 4:144361419-144361441 GAAAATACCCAAATGAGTCTGGG - Intergenic
981696633 4:147565300-147565322 CAAAACGCACAAATGAAGCATGG + Intergenic
981961769 4:150549624-150549646 TAAAAGTGACAAATGAGGCTGGG - Intronic
982008271 4:151083420-151083442 AAAAATACAAAAATGTAGCTGGG + Intergenic
982201647 4:152967264-152967286 AAAAATACAAAAATTAAGCTGGG + Intronic
982304370 4:153914677-153914699 GAAAATTCACAGAGGAACCCTGG - Intergenic
983816258 4:172130349-172130371 GAAAATTAAGAAATGATTCTTGG - Intronic
984172119 4:176372002-176372024 GAAAATTAACAAAGGAACATTGG - Intergenic
984298057 4:177879555-177879577 GAAAAATCACAAATGAGTGTTGG + Intronic
984776929 4:183490023-183490045 TAAATTTCAAAAATGAGGCTGGG - Intergenic
985254942 4:188060674-188060696 GAAAACCAACAACTGAAGCTTGG + Intergenic
986565130 5:9105297-9105319 GAAATTTCACAAGTGAAGCTGGG + Intronic
987285143 5:16448718-16448740 GAAAATACACAAAATTAGCTGGG - Intergenic
987978906 5:25054234-25054256 GAAAATAAACAAATAAGGCTGGG + Intergenic
988361980 5:30248087-30248109 GAAAATTCTCAAATAAAGTGTGG - Intergenic
988792485 5:34621351-34621373 GAAAATACAGAAATGAGGCTGGG - Intergenic
990722963 5:58718772-58718794 GAATATGCATAAATGAAGCCAGG + Intronic
991671606 5:69053862-69053884 AAAAATTGACAAATCAGGCTGGG - Intergenic
991936751 5:71809853-71809875 AGAAATTCACAAATGACTCTTGG - Intergenic
992068536 5:73129094-73129116 CAAAATGCACAAACGAAGCAAGG + Intronic
992700959 5:79341747-79341769 AAAAACACACAAATTAAGCTGGG - Intergenic
992779963 5:80118856-80118878 GAACCTTCATGAATGAAGCTGGG - Intronic
992792265 5:80224163-80224185 GAAAAGTCAGAAATGAATCTGGG + Intronic
993634660 5:90329195-90329217 GAAAATTAACAAAGGAACATTGG - Intergenic
994593083 5:101796462-101796484 TAAACTTCACAAATGTAGTTTGG - Intergenic
995026828 5:107433466-107433488 CAAAAGTAACAACTGAAGCTGGG + Intronic
995230226 5:109752858-109752880 GATTATTAACAAATGGAGCTGGG + Intronic
995401185 5:111743614-111743636 TAAAATTCACAAGTGCAGTTTGG - Intronic
998494912 5:142580021-142580043 GAAAATTCAAAAAATTAGCTGGG - Intergenic
998547783 5:143045836-143045858 GAAAATACAAAAATTAGGCTGGG + Intronic
998650085 5:144109055-144109077 GAAATTTCTCAAAGGAATCTTGG + Intergenic
998718777 5:144917964-144917986 GACAATTCATAAATGAAGAAAGG + Intergenic
999685778 5:154101788-154101810 GAAAATACAAAAAAAAAGCTGGG + Intronic
999960082 5:156745130-156745152 GAGATTTCACAGATGAAACTGGG + Intronic
1000172844 5:158720415-158720437 GAATAAACACAAAGGAAGCTGGG - Intronic
1000720581 5:164701373-164701395 AGAAAATCACAAAAGAAGCTGGG + Intergenic
1000911511 5:167028547-167028569 AAAAATTCACAAAAGAAATTTGG - Intergenic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001937812 5:175718162-175718184 GATAATCCCCAAATGAAACTAGG + Intergenic
1002552923 5:180010518-180010540 AAAAATACAAAAATGTAGCTGGG - Intronic
1003075581 6:2981177-2981199 GAAAATTCTGGAAGGAAGCTAGG - Intergenic
1003653471 6:7984239-7984261 GAAAATACATAAAAGAGGCTGGG - Intronic
1004862120 6:19815158-19815180 GAAAATACACAAATAGAGATTGG + Intergenic
1004974555 6:20950417-20950439 GAGAATTCAGAAATTACGCTGGG - Intronic
1005007525 6:21303730-21303752 AAAAATCCAAAAATGAAACTGGG + Intergenic
1005106569 6:22230166-22230188 GAAAATACTCAAATGAAGGCAGG - Intergenic
1005903857 6:30243339-30243361 AAAAATACAAAAATGAAGCCGGG + Intergenic
1006728018 6:36214047-36214069 GAAAAATCACCACTGCAGCTAGG + Exonic
1007997422 6:46322937-46322959 GAAAATGAACAAATTAAGGTGGG - Intronic
1008646020 6:53515888-53515910 GAGAATTGACAAATCAAGCCTGG + Intronic
1008916472 6:56792906-56792928 AAAAATACAAAAATGTAGCTAGG + Intronic
1009298438 6:61984342-61984364 GAAATTTCACAAAAAAAGCTAGG - Intronic
1010480892 6:76352376-76352398 GAAAATTCATAAATATAACTTGG + Intergenic
1010554528 6:77262738-77262760 GAAAATGCACTAGGGAAGCTGGG - Intergenic
1010691488 6:78915963-78915985 CAAAATTCACAAACAAAGCAAGG + Intronic
1012235810 6:96813673-96813695 GAAAATTAACAAAGAAACCTTGG - Intronic
1012455157 6:99395304-99395326 GAAAATACAAAAATTAAGCCGGG - Intergenic
1013154092 6:107476528-107476550 GCAAATTCACAACAGAAGTTTGG + Intergenic
1013215482 6:108023650-108023672 GAAAATCCATAAATAAGGCTGGG - Intergenic
1013392397 6:109699661-109699683 GAAAATTCAAAAAATTAGCTGGG - Intronic
1013502522 6:110766837-110766859 GAAAATAAACAAATAAGGCTGGG + Intronic
1013970410 6:116011495-116011517 GAAAATGCAGAAAGGAAACTGGG + Intronic
1014226375 6:118852569-118852591 GCAAGTTCACAGCTGAAGCTTGG - Intronic
1014430651 6:121366285-121366307 GAAAATCAACAAAGGAACCTTGG + Intergenic
1014493709 6:122093361-122093383 GAAATTTCACAAAGTAGGCTAGG - Intergenic
1015821062 6:137260709-137260731 CAAAACTCACAAATAAAGCAAGG - Intergenic
1015826066 6:137313086-137313108 GAAGATTAACAAAAGAGGCTGGG - Intergenic
1016871446 6:148821128-148821150 GAAAATACACAAAATTAGCTGGG - Intronic
1016949808 6:149568111-149568133 GGAAATTCACATATTACGCTGGG + Intronic
1017041599 6:150312838-150312860 CAAAATGCACAAATAAAGCAAGG - Intergenic
1017053666 6:150418861-150418883 GACAAATGACAAATAAAGCTGGG - Intergenic
1017495021 6:154976090-154976112 GAAAATACAAAAAATAAGCTGGG + Intronic
1018023346 6:159783992-159784014 CAAAAAACAAAAATGAAGCTTGG - Exonic
1018675906 6:166222334-166222356 AAAAATACAAAAATTAAGCTGGG - Intergenic
1019466204 7:1190763-1190785 TAAAATTCAGAAGTGAGGCTAGG + Intergenic
1019813467 7:3182326-3182348 AAAAATTCAAAAATGTAGCCAGG - Intergenic
1019987432 7:4667976-4667998 TAAAAAACAAAAATGAAGCTCGG + Intergenic
1020038020 7:4977187-4977209 GAAAATTAACAAATGTGGCCAGG - Intergenic
1020205615 7:6113062-6113084 AAAAATACAAAAATGTAGCTGGG - Intronic
1020847550 7:13306423-13306445 GAAAATACAAAAATATAGCTGGG + Intergenic
1021364223 7:19756478-19756500 GAAAAATAACTAATGAATCTAGG - Intronic
1023691676 7:42795628-42795650 CAAAAAACAAAAATGAAGCTTGG + Intergenic
1025076438 7:55947759-55947781 AAAAATACACAAAAGTAGCTGGG - Intergenic
1025744803 7:64233329-64233351 AAAAATTTAAAAATTAAGCTGGG + Intronic
1025934643 7:66025520-66025542 GAAAATACAAAAAAAAAGCTGGG + Intergenic
1026421840 7:70246515-70246537 GAAAACTCAGAAATAAACCTAGG - Intronic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1026993824 7:74603138-74603160 GAAAATGCAAAAATGAGGCCGGG + Intergenic
1026998506 7:74635249-74635271 GAAAATTAACTAATGAAGAGGGG + Intergenic
1027388708 7:77683564-77683586 AAAAATACACAAATTAGGCTGGG - Intergenic
1027919157 7:84369899-84369921 GATGATTCAGAAATGCAGCTAGG + Intronic
1028016289 7:85718065-85718087 GAAAACTGATACATGAAGCTGGG - Intergenic
1028344732 7:89765163-89765185 TAAAACTCACAAATGAAAATAGG + Intergenic
1028473393 7:91228475-91228497 AAAAATAAACAAATAAAGCTGGG - Intergenic
1028594298 7:92530919-92530941 AAAAATACAAAAATCAAGCTGGG + Intronic
1028598391 7:92572556-92572578 GAAAATACAAAAAAGTAGCTGGG + Intronic
1029110025 7:98209032-98209054 GAAAATTCAGAAGTGAACCAAGG + Exonic
1029378428 7:100196630-100196652 AAAAATACAAAAAGGAAGCTGGG + Intronic
1029728053 7:102421246-102421268 AAAAATTGAAAAATGAGGCTGGG + Intronic
1030328730 7:108250263-108250285 AAAAATACACAAAATAAGCTGGG + Intronic
1031036027 7:116788838-116788860 GAAAATGCCCAAATGGAGTTTGG + Intronic
1031444397 7:121832754-121832776 AAAAATTCACAAATGCATCATGG - Intergenic
1032371829 7:131363190-131363212 AAAAATTCACAAATGCGGCCTGG - Intronic
1032754455 7:134875474-134875496 AAAAATTCAAAAAATAAGCTGGG + Intronic
1032837800 7:135690018-135690040 AAAAATACAAAAATTAAGCTGGG + Intronic
1033402799 7:141043002-141043024 GAAATTTCATAAATTAGGCTGGG + Intergenic
1033505232 7:141993191-141993213 GAAAATTCAGAAAAAAATCTGGG - Intronic
1035433913 7:158843553-158843575 AAAAATACAAAAATGAGGCTGGG - Intergenic
1035814359 8:2523019-2523041 AAGAATTCCCAAATCAAGCTTGG + Intergenic
1036076259 8:5504502-5504524 AAAAATACACAAAAGTAGCTCGG - Intergenic
1036595934 8:10211982-10212004 GAATCTTCACAAATTAAGCTTGG - Intronic
1036947662 8:13109722-13109744 GAAAATACACAAAATTAGCTGGG + Intronic
1037360525 8:18068978-18069000 AAAAATTCAGAAAAGTAGCTGGG + Intronic
1037450255 8:19009728-19009750 AAAAATACAAAAATTAAGCTGGG + Intronic
1037536067 8:19826061-19826083 AAAAATTTAAAAATGCAGCTAGG - Intronic
1037593625 8:20335108-20335130 GATATTTCAGAAATGAAGATTGG + Intergenic
1038339719 8:26675086-26675108 GAAAATTAAAACATGAACCTGGG + Intergenic
1038698441 8:29827252-29827274 GAAAAATCAAAATTCAAGCTGGG + Intergenic
1039266332 8:35828193-35828215 GAAAATTAAGGAATCAAGCTTGG + Intergenic
1040615927 8:49038417-49038439 GAAAAATCACTTATGAAGGTGGG - Intergenic
1040640454 8:49328437-49328459 AAAAATACAAAAATTAAGCTGGG - Intergenic
1040767761 8:50935660-50935682 GAAAACTAACAAATAAATCTTGG + Intergenic
1040931993 8:52745268-52745290 GATAATTCTCAAATAATGCTAGG - Intronic
1040943637 8:52858172-52858194 AAAAATACAAAAATGTAGCTGGG - Intergenic
1043254666 8:78119262-78119284 GAAAATCTTCAAGTGAAGCTTGG + Intergenic
1043420345 8:80091173-80091195 TAAAATACACAAAAGAGGCTGGG + Intronic
1043647590 8:82540250-82540272 GAAAATTCACAAAATGGGCTCGG - Intergenic
1043991766 8:86764368-86764390 GAAAATTCACATATAGAGTTAGG - Intergenic
1044288149 8:90435184-90435206 GAAAATTTACAAATTTAGGTAGG + Intergenic
1044431409 8:92111990-92112012 GAAAATACAGACATGAAGCCAGG - Intergenic
1044869222 8:96601917-96601939 AAAAATTCAAAAATTTAGCTGGG - Intronic
1045325583 8:101115383-101115405 GAAAAATCCCAAGTGAAGCCTGG - Intergenic
1046305580 8:112361287-112361309 GAAAAATCAGAAATGAATCCAGG + Intronic
1047603559 8:126451510-126451532 GAAGAATAACAAATGAAACTTGG - Intergenic
1048607111 8:135980763-135980785 GAAATTTCACAAATGAAAAATGG - Intergenic
1048784210 8:138033416-138033438 GAAAATTCCCAAATGCAACCGGG + Intergenic
1049248144 8:141573774-141573796 CAAAATGCACAAATAAAGCAAGG - Intergenic
1050518197 9:6468050-6468072 AAGAATTCCCAAATAAAGCTGGG - Intronic
1050715682 9:8522428-8522450 GCAAATTCAGAAAGGGAGCTGGG + Intronic
1051062699 9:13063179-13063201 GAAAATCTGCAAATGAAACTGGG - Intergenic
1051095476 9:13460864-13460886 AAAAATTCAAAAATTAAGCCAGG - Intergenic
1051833609 9:21309697-21309719 GAAAATTAACAAATTAACTTAGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053935255 9:43143569-43143591 AAAAATACAAAAATTAAGCTGGG + Intergenic
1054298385 9:63350736-63350758 AAAAATACAAAAATTAAGCTGGG + Intergenic
1055050098 9:71970912-71970934 AAAAATACACAAATTTAGCTGGG - Intronic
1055301824 9:74890490-74890512 GAACAATCAAAAATGAAACTGGG + Intergenic
1056121825 9:83495845-83495867 GTAAATTCACAAATTATGGTTGG + Intronic
1056429773 9:86515588-86515610 AAAAATACACAAAAGAAGCTTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058280364 9:103105471-103105493 GAAAATTCAAAAAATTAGCTGGG - Intergenic
1058427776 9:104890418-104890440 GAAAATACAAAAAAGTAGCTGGG + Intronic
1058443095 9:105028599-105028621 TTAAATTCACAAAGGGAGCTTGG + Intergenic
1058748079 9:108011400-108011422 GCAGATTCACCAATGTAGCTTGG + Intergenic
1059022145 9:110587995-110588017 GATAATTTACAAATGAAATTTGG - Intergenic
1059077679 9:111211344-111211366 TAATATTCCCAAATTAAGCTGGG - Intergenic
1059333679 9:113554464-113554486 AAAAATACAAAAATGTAGCTGGG - Intronic
1060172324 9:121472005-121472027 CAACTTTGACAAATGAAGCTGGG + Intergenic
1060460980 9:123854398-123854420 AAAAAATAAAAAATGAAGCTGGG + Intronic
1060548084 9:124472243-124472265 GAAGATTCAGAGATGAAGATTGG - Intronic
1060647687 9:125295725-125295747 AAAAATTAACACATGAGGCTGGG - Intronic
1061166380 9:128924964-128924986 GTAAATACACAAATACAGCTAGG - Intronic
1061350003 9:130056628-130056650 GAAAGTTCACAAATTTGGCTGGG + Intronic
1061976827 9:134072656-134072678 GAAAAATCAAAAATGTAGCTGGG + Intergenic
1062075054 9:134583384-134583406 GAAAATTCAGAAGTGAACCAAGG - Intergenic
1185626368 X:1485296-1485318 TAAAATTCAAAAATGTAGCTGGG - Intronic
1185834186 X:3329632-3329654 AGAAATTCACAAAGGATGCTTGG - Intronic
1186158344 X:6749577-6749599 GAGACTTCAGAAATGAATCTTGG + Intergenic
1187889455 X:23920594-23920616 GAAAATTATCAAATGAAGCCAGG + Intronic
1188421914 X:30000606-30000628 GGAAATGCACAAATGAATTTCGG + Intergenic
1189850705 X:45173729-45173751 AAAAATTCAAAAATTTAGCTGGG - Intronic
1190022552 X:46892383-46892405 AAAAATTTAAAAATTAAGCTGGG + Intronic
1190080157 X:47350460-47350482 GAAAATGAACAAATAAGGCTGGG + Intergenic
1190154836 X:47981737-47981759 AAAAATACAAAAATGTAGCTGGG + Intronic
1190405623 X:50084540-50084562 AAAAATTCACAAAATCAGCTGGG - Intronic
1190533298 X:51402492-51402514 AAAAATACACAAATTTAGCTGGG + Intergenic
1190715757 X:53101836-53101858 AAAAATACAAAAATTAAGCTGGG + Intergenic
1190947715 X:55111949-55111971 TAGAATTAACAAAAGAAGCTTGG - Intronic
1192805784 X:74507249-74507271 AAAAAATCACAGATGAGGCTGGG - Intronic
1193251943 X:79301320-79301342 GAAAATTAACAAAGGAAGTCTGG + Intergenic
1194245219 X:91502396-91502418 GAAAATTCACAAAGAAACTTGGG + Intergenic
1194799734 X:98257669-98257691 CAAAATACACAAATAAAGCTGGG + Intergenic
1194800487 X:98266805-98266827 GAAAATTAACAAAGGAACATTGG + Intergenic
1194838034 X:98706139-98706161 GAAAATTAACAAATAAATATTGG - Intergenic
1195385758 X:104312311-104312333 GTACATTCAGAAATGAAGCCAGG - Intergenic
1196063666 X:111438889-111438911 GAATATTAACAAATAAGGCTGGG - Intergenic
1196794490 X:119491214-119491236 AAAAATACAAAAATGTAGCTGGG - Intergenic
1197835331 X:130688093-130688115 GAAAAATCATTAATGAGGCTTGG + Intronic
1198030580 X:132750074-132750096 GAAACTTCAAGAAGGAAGCTGGG - Intronic
1198470865 X:136945604-136945626 GAAAATTTACAAATTGTGCTTGG + Intergenic
1198628018 X:138601412-138601434 TGAAATTCAGATATGAAGCTAGG + Intergenic
1200164683 X:154027801-154027823 GAAGAGTCAGAAGTGAAGCTGGG + Intronic
1200564190 Y:4743708-4743730 GAAAATTCACAAAGAAACTTGGG + Intergenic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic
1202044513 Y:20725110-20725132 TAAAATGCACAAACGAAGCAAGG + Intergenic