ID: 947329120

View in Genome Browser
Species Human (GRCh38)
Location 2:229009714-229009736
Sequence GTGTGAGTATATGAGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947329115_947329120 12 Left 947329115 2:229009679-229009701 CCAGGCAGAGGGGACAACATGTG 0: 1
1: 1
2: 78
3: 412
4: 1414
Right 947329120 2:229009714-229009736 GTGTGAGTATATGAGGAACTAGG 0: 1
1: 0
2: 5
3: 18
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947329120 Original CRISPR GTGTGAGTATATGAGGAACT AGG Intronic
903274893 1:22214981-22215003 TAGTGAGTATATGGGGAAGTAGG + Intergenic
904591081 1:31615704-31615726 GAGTGTGCATATGTGGAACTTGG - Intergenic
905309533 1:37039733-37039755 GTGTGAGTAAATGAGTGAGTGGG - Intergenic
906887286 1:49663287-49663309 ATGTCAGTATAGGAGGTACTGGG - Intronic
907392819 1:54169390-54169412 GTTTGAGTTTATGAGGAAGAGGG + Intronic
908742450 1:67342627-67342649 GTGTGAGGATGTGAGGATGTTGG + Intronic
910763609 1:90759033-90759055 GTGTCAGTCTAAGGGGAACTGGG + Intergenic
912360543 1:109091074-109091096 GTGTGAGCATAAGAGGCACTGGG - Intronic
915758561 1:158287447-158287469 GTGTGATTATATTTGGAAATGGG - Intergenic
916551266 1:165851825-165851847 GAGTGAGAATATGAGGCATTTGG + Intronic
917690609 1:177464364-177464386 GTGAGTATGTATGAGGAACTGGG + Intergenic
918676844 1:187297036-187297058 TTATCATTATATGAGGAACTGGG + Intergenic
921778375 1:219129840-219129862 GTGTGTGTATATGTTGAAATTGG - Intergenic
923052021 1:230395877-230395899 GTGGGAGTAAGAGAGGAACTTGG - Intronic
924029764 1:239874500-239874522 GAGTGAGTATTTGAGGATTTTGG + Intronic
1064587545 10:16853638-16853660 CTGTGAATATATCAGGGACTGGG - Intronic
1064927916 10:20590454-20590476 CTTTGAGTAGATGAGGAAGTGGG - Intergenic
1068878270 10:62021164-62021186 GAGTGAGTATTTGTGGGACTTGG - Intronic
1069046766 10:63751280-63751302 GTGTGTGGATATTAGGAACACGG + Intergenic
1069238870 10:66113103-66113125 TGGTGAGTATATGAAGAAATTGG - Intronic
1071351945 10:84755337-84755359 ATGTGAGAATATGAGGAAATGGG + Intergenic
1072293063 10:93983403-93983425 GTGTGTGTATATGATTAATTTGG - Intergenic
1076321452 10:129585108-129585130 TGGTGAGTATATGAAGAAATTGG - Intronic
1076828218 10:132981133-132981155 GTGTGAGTGTGTGAGGATCTGGG + Intergenic
1079105844 11:17571978-17572000 GTGTGTGTATATGAGCAAGTAGG + Intronic
1079236392 11:18693639-18693661 CTGTGAGTATACTTGGAACTAGG + Intronic
1079347438 11:19665279-19665301 GTGGGAGTAAAAGAGGATCTTGG - Intronic
1081268262 11:41054184-41054206 GTGTGAGGAAATGAGTAACTGGG - Intronic
1082760205 11:57119995-57120017 ATGTGAGTATATTTGGAGCTAGG + Intergenic
1083282590 11:61636399-61636421 GTGTGATTGTGTGAGCAACTGGG + Intergenic
1083482897 11:62961092-62961114 GTGTGACTATATTTGGAAATAGG + Intronic
1083685748 11:64373938-64373960 TTGTGAGTATCTGATGAAATGGG - Intergenic
1085140362 11:74135175-74135197 GTATGAGTATATGAGGCAATGGG - Intronic
1086588260 11:88481375-88481397 GTGTGAGTAGATGCCCAACTCGG - Intergenic
1087185567 11:95189703-95189725 ATATGTGTATATTAGGAACTTGG - Intronic
1087586742 11:100131350-100131372 GTGTGAGGATTTGAGTGACTGGG + Intronic
1087800760 11:102501414-102501436 GGGTGAATATATGAAGAAATTGG - Intergenic
1088580383 11:111310118-111310140 CTTTGTGTATATGAGGAAGTTGG - Intergenic
1091324519 11:134676438-134676460 GTGTGAGGGTATGAGGGTCTTGG + Intergenic
1092297909 12:7216267-7216289 GTGTGAGTGTTTAAGGAATTTGG - Intronic
1095370313 12:41458983-41459005 TTGGGAGTAGATGAGGAATTAGG + Intronic
1096794400 12:54066238-54066260 GTGTAAATGTATGAGCAACTGGG + Intergenic
1098558159 12:71842533-71842555 GTATGAGAAAATGAGGAACCAGG + Intronic
1099265989 12:80448607-80448629 GAGTGAGAATATGCGGTACTTGG + Intronic
1100384907 12:94096741-94096763 GTTAGAGTATAGGAGGATCTAGG - Intergenic
1100915696 12:99419085-99419107 GTGTGGGTGTATGTGGAATTGGG + Intronic
1101478363 12:105073317-105073339 GAGTAACTATATGAGGAAGTGGG - Intronic
1103143925 12:118577510-118577532 GGGTGAGGATATGGGGAAATGGG + Intergenic
1103200772 12:119086192-119086214 GTGTGTGTGTATGAGGGACGTGG - Intronic
1103567999 12:121826757-121826779 GTGGAAGAATATGAGGAAGTGGG + Intronic
1104119950 12:125789556-125789578 GTGTGATGGTATGAGGAACTGGG + Intergenic
1108680313 13:52774446-52774468 CTGTGTGTATATGAAGAAGTGGG + Intergenic
1110228669 13:73145997-73146019 GTGTGTGTGTGTGTGGAACTTGG + Intergenic
1111384616 13:87508293-87508315 GTGTGAGCATATCAGGAACAGGG - Intergenic
1111666805 13:91279576-91279598 GTGTGACTATATTTGGAAATTGG - Intergenic
1112432945 13:99368556-99368578 ATTTGAGCAAATGAGGAACTCGG + Intronic
1114305786 14:21421772-21421794 ATGTGAGTGTATTAGGAAATTGG + Intronic
1117675853 14:58153910-58153932 GAGTGAGAATATGAAGACCTAGG + Intronic
1118930945 14:70239923-70239945 TTGTTAGTATAACAGGAACTGGG - Intergenic
1119916600 14:78407802-78407824 GTGTGGGTTTAAGAGGAATTTGG - Intronic
1120715619 14:87837989-87838011 ATGTGACTATATGTGGAGCTAGG + Intronic
1122751890 14:103941331-103941353 GTCAAAATATATGAGGAACTTGG + Intronic
1125191942 15:37003737-37003759 ATGTGAGGATATTAGGAAGTGGG + Intronic
1125408809 15:39383429-39383451 ATGTGAGGATATTAGGAAGTGGG - Intergenic
1125443350 15:39726828-39726850 GTGTGTGTATGTGAAGACCTGGG - Intronic
1125816995 15:42594162-42594184 GTGTGAGGATGTCAGGAACCTGG + Intronic
1128988014 15:72235303-72235325 GTGTGAGTAAAAGTGGAAATTGG + Intergenic
1137783167 16:51114707-51114729 GTGTGTGAATATGAGCAACCAGG + Intergenic
1138052435 16:53794079-53794101 GTTTGAGTATATGAAGAACTGGG + Intronic
1139701734 16:68711843-68711865 GTGGGAGGATAAGAGGAACAAGG + Intronic
1141162089 16:81636083-81636105 GTGTGAGTGTGTGTGTAACTGGG + Intronic
1143782393 17:9236074-9236096 GTGTGAGAATATTAAGAAGTAGG - Intronic
1144492550 17:15726883-15726905 GTGTCAGTCTAAGAGGAACCTGG + Intergenic
1144907703 17:18649778-18649800 GTGTCAGTCTAAGAGGAACCTGG - Intronic
1147219264 17:38919110-38919132 GTGTGGGTATGTGAGGAGCTGGG - Exonic
1148495493 17:48051254-48051276 GTCTGAGTATAGGCAGAACTGGG - Exonic
1149373216 17:56017403-56017425 GTGAGAATATATGAGTAACTGGG - Intergenic
1150653767 17:67026356-67026378 GTGTGTGTATTTGAGGAATGTGG + Intronic
1150653774 17:67026427-67026449 GTGTGTGTATTTGAGGAATGTGG + Intronic
1151359201 17:73578566-73578588 GTGTGATTATTTGGGGAGCTGGG + Intronic
1151498994 17:74476967-74476989 GTGTGTGTATGTGGGGAAATTGG + Intronic
1153826710 18:8881892-8881914 ATGTGAGTAGAGGAGGAATTTGG + Intergenic
1156802350 18:41131842-41131864 GTGACTGAATATGAGGAACTAGG + Intergenic
1157785727 18:50480888-50480910 GTCTGAGTTTAAAAGGAACTGGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1161040419 19:2108205-2108227 GTGTCTGTATATGAGGAGTTGGG - Intronic
1161497291 19:4593754-4593776 CTAAGAGTATTTGAGGAACTAGG + Intergenic
1162275470 19:9650540-9650562 GTGTGAAAACATGAGGAAGTGGG + Intronic
1162552890 19:11367667-11367689 GAGTGAGTCTATGAGGAAGCAGG - Intergenic
1165085434 19:33342909-33342931 ATGTGACTATATGTGGAAATAGG - Intergenic
1165231840 19:34392278-34392300 GTGTCAGTGTCTGAGGAATTAGG + Intronic
926449210 2:12981872-12981894 ATGTGAGGATATTAGGAAGTGGG - Intergenic
926591678 2:14746330-14746352 GTGTGAGTATATGAGCGTGTGGG - Intergenic
930481874 2:51958305-51958327 GGGTGAGTAAATGAGGAAAATGG - Intergenic
930903531 2:56537244-56537266 GAGTGAGTATATGTGGAGATGGG - Intergenic
930967780 2:57352540-57352562 TTGTGAGGATATGAAGAAATTGG - Intergenic
933049756 2:77589298-77589320 GTGTCAATATATGAGGAACTCGG + Intronic
933408097 2:81888636-81888658 GTATGAGTATCAGAGGAACTTGG - Intergenic
933417981 2:82011512-82011534 GTGTGTGTGTGTGAGGCACTAGG + Intergenic
935234713 2:101128850-101128872 TTCTAATTATATGAGGAACTTGG + Intronic
939654141 2:144801841-144801863 GGGTGGGTATATAAGGAAGTAGG + Intergenic
947329120 2:229009714-229009736 GTGTGAGTATATGAGGAACTAGG + Intronic
1172267804 20:33631962-33631984 GTCTGATTACATGAGGAGCTTGG + Intronic
1172494092 20:35365854-35365876 TAGTGAGTATCTGAGGAACATGG - Intronic
1172704895 20:36875967-36875989 GGGTGAGTCTGTGAGCAACTCGG - Intergenic
1172913438 20:38426983-38427005 GTGTGTGTGTATGTGTAACTTGG - Intergenic
1175643390 20:60650288-60650310 GTGTGAGTATATGTGAATGTAGG + Intergenic
1176915292 21:14618352-14618374 GTGTGATTATATGAGGAAGAGGG + Intronic
1178254287 21:31037328-31037350 GTGTGTGTATAAGAGGAAATGGG + Intergenic
1178799668 21:35780831-35780853 ATGTGAGTATATGAGACACATGG + Intronic
1182181116 22:28349146-28349168 GTGTGTGTAACTGATGAACTTGG - Intronic
1182890708 22:33816538-33816560 GTGTGAGGGTATTAGGAGCTGGG - Intronic
1185007258 22:48288243-48288265 GGGTGAGTGAAAGAGGAACTAGG + Intergenic
1185329574 22:50246110-50246132 GTGTCCGTAGATGAGGAGCTGGG - Intronic
949315991 3:2756255-2756277 GTGTGATCATATGAGGAGGTGGG + Intronic
949680267 3:6505629-6505651 GAGTGAGAATATGAGGTATTTGG - Intergenic
950442220 3:13016660-13016682 GAGTGAGTTTGTGAGGACCTTGG - Intronic
950766052 3:15273884-15273906 ATGTGATTATATTAGGAAGTGGG + Intronic
950939188 3:16876343-16876365 TAGTGAGTAGAAGAGGAACTTGG + Intronic
951717522 3:25664807-25664829 GTGTGTGTGTGTGAGGAAATCGG - Intronic
955143313 3:56291095-56291117 GGGTAAGTATAAGAGGATCTTGG + Intronic
959365274 3:105450424-105450446 GTGTGTGTATGTGAGGTAGTGGG - Intronic
959384151 3:105680883-105680905 GTGTGTGTATATGTTGAAGTTGG - Intronic
959987246 3:112588103-112588125 GTGTTAGTATGTGGTGAACTTGG + Intergenic
959987268 3:112588370-112588392 TGGTGAGTATATGAGGAACTTGG - Intergenic
960327152 3:116311687-116311709 GTACAATTATATGAGGAACTAGG - Intronic
961189123 3:124942726-124942748 GGGTGAGTAGAGGAGGAAGTGGG - Intronic
962478653 3:135779770-135779792 GTGTGTGTTTATGTGGAACATGG - Intergenic
962556069 3:136552924-136552946 TTGAGAGTAAATAAGGAACTTGG + Intronic
962700319 3:137992115-137992137 GTGAGAGCACATGAGGACCTGGG + Intergenic
963321253 3:143811949-143811971 GTTTGAGAATATGAGGCACAAGG + Intronic
963743093 3:149098451-149098473 GTGTGAGGAAATGAGGACTTTGG - Intergenic
965565751 3:170115868-170115890 GTGTGTGTGTGTGAGAAACTTGG - Intronic
965608276 3:170518408-170518430 GCGTGAGTAGATGAGGGACAAGG - Intronic
969544605 4:7817078-7817100 GAGTGCGTGGATGAGGAACTTGG + Intronic
971251031 4:24973721-24973743 GTGTGAGTGTATGATTAACCCGG + Intronic
971891454 4:32529139-32529161 GAGTGAGCATATGAGGAAGGGGG - Intergenic
973031340 4:45345062-45345084 ATTTGAGTATTTGAGGCACTCGG - Intergenic
977546614 4:98389527-98389549 ATGTGAGTATATAATGAATTTGG + Intronic
978268236 4:106853898-106853920 GTGTTAGTATATGATAAAATTGG + Intergenic
979554983 4:122035277-122035299 GAGTGAGGATTGGAGGAACTGGG + Intergenic
979842249 4:125457108-125457130 GTGTGTGTATGAGAGAAACTGGG - Intronic
979916337 4:126439138-126439160 ATGTAAGTTTCTGAGGAACTAGG + Intergenic
980452664 4:132995269-132995291 GTGTGAGTATATAAGAAACCTGG + Intergenic
980663074 4:135892834-135892856 ATGTAAGTATAGGAGAAACTTGG + Intergenic
980864713 4:138541751-138541773 ATGGGACTATATGAGGAAATTGG - Intergenic
980927115 4:139148864-139148886 TGGTGAGGATATGAAGAACTGGG - Intronic
981807446 4:148733015-148733037 GTGTGATTATCTGAAGACCTTGG + Intergenic
983446915 4:167863652-167863674 GAGTGAGAATATGAGGTATTTGG - Intergenic
984081329 4:175252952-175252974 GTGTGAGCAAATGTGAAACTTGG + Intergenic
984615551 4:181893020-181893042 GTGTGAGTATCAGAGGAACTAGG + Intergenic
986410850 5:7477307-7477329 GTGAGGGCATATGAGAAACTAGG - Intronic
986805804 5:11307872-11307894 GTGTGAGAAGATGAGGACTTTGG + Intronic
987287553 5:16472781-16472803 GTGTGAGGATGGGAGGAAGTTGG - Intergenic
988511361 5:31867363-31867385 ATGTGGGTATATGAGGTGCTGGG + Intronic
989366534 5:40662390-40662412 GAGTGAGTACATGTGGTACTTGG - Intergenic
989381034 5:40809683-40809705 GTGTGATTATATTAGGAGGTGGG + Intergenic
989614223 5:43323125-43323147 GAGTGAGAATATGCGGTACTTGG + Intergenic
989695737 5:44198753-44198775 GTGAGAATATATGTGAAACTGGG + Intergenic
990182675 5:53179890-53179912 GTGTGAGTGAATGAGGACATTGG + Intergenic
990344673 5:54860025-54860047 GTGTGACTATATGTGAAAATAGG - Intergenic
991096957 5:62749873-62749895 GTGTGAGAATATTAGGAGGTGGG + Intergenic
993325191 5:86525774-86525796 ATGTGATCATATGAGGAAATGGG - Intergenic
994226708 5:97260422-97260444 GGGTCATTATATTAGGAACTGGG + Intergenic
995923193 5:117338486-117338508 GAGTGAGAATATGAGGAGTTTGG + Intergenic
996143885 5:119949369-119949391 CTGTGAGGATATCAGCAACTTGG - Intergenic
998402098 5:141853386-141853408 GTGTCTGTATATAAGGACCTTGG - Exonic
999249926 5:150176489-150176511 GTGTGGGTCTCTGAGGGACTTGG + Intronic
1000187083 5:158869564-158869586 GTGTGTGTTTATTAGGATCTGGG - Intronic
1001997895 5:176176611-176176633 GTGAGAGTTCATGAGCAACTAGG - Intergenic
1003719689 6:8686939-8686961 GTGTGAGTATATGATGGACTTGG + Intergenic
1004557475 6:16713582-16713604 GTGTGTGTATATGAAGAAGGGGG + Intronic
1005277901 6:24239316-24239338 GTGTGTTTCTATGAGGACCTTGG - Intronic
1007080578 6:39099928-39099950 TGGTGAGGATATGAGGAAATTGG + Intergenic
1007192781 6:40033676-40033698 GTGTGTGTGTAAGAGGAAGTTGG + Intergenic
1008275960 6:49544663-49544685 GTGTGAATGTATCAGGAGCTAGG - Intergenic
1009645134 6:66392503-66392525 GGGAGAGTATATTAGGAAGTGGG + Intergenic
1014797513 6:125743513-125743535 TTGTTAGTATATGAAGGACTAGG - Intergenic
1015111637 6:129598595-129598617 GTAAGAGTATATTAAGAACTGGG - Intronic
1016646521 6:146415314-146415336 GTGTGATGATATTAGGAAGTGGG - Intronic
1018021567 6:159765932-159765954 GTTTGAGTATATCTGAAACTGGG + Intronic
1021437071 7:20630707-20630729 GTGTGAGTAAATGGGCAACCTGG + Intronic
1022178761 7:27897971-27897993 GTGAGAGTAAATGAGGTAATTGG + Intronic
1024766362 7:52665695-52665717 GGGTGAGTATGTGAAGAAATTGG - Intergenic
1024802407 7:53095837-53095859 GGGGAATTATATGAGGAACTCGG - Intergenic
1025109716 7:56203862-56203884 GTGTGATGATATTAGGAAGTGGG - Intergenic
1027945355 7:84738390-84738412 GTGTGAGGATATTAGGAGTTGGG + Intergenic
1028064838 7:86370567-86370589 GAGTGAGAATATGAGGTATTTGG - Intergenic
1028204100 7:87996507-87996529 ATGTGATTATATGAGGAGCTGGG - Intronic
1028664654 7:93327428-93327450 GTGTCAGTATATAATGAGCTGGG - Intronic
1028929886 7:96401349-96401371 TGGTGAGAATATGTGGAACTTGG - Intergenic
1029849575 7:103447760-103447782 GTGTTAGTATATTAGGTACCTGG - Intergenic
1030318935 7:108144335-108144357 GAGTGAGTAGGTGAGGAAATGGG - Intergenic
1031098075 7:117444575-117444597 TTGTGAGGATATGAGACACTTGG - Intergenic
1033838462 7:145344127-145344149 ATGTGAGTACATGAGGTAATGGG + Intergenic
1034252963 7:149706841-149706863 GAGTGAGTACAGGAGGAACTGGG - Intergenic
1037569950 8:20149655-20149677 GTGTAAGTATAAGAAGACCTGGG - Exonic
1038053990 8:23840574-23840596 GTGTGAAGATATGAGACACTTGG + Intergenic
1039818986 8:41119567-41119589 GAGTGAGTACATGAGGAAGGGGG - Intergenic
1042924146 8:73949989-73950011 GTGTGTGTATATGAGGAGTGGGG + Intronic
1043810740 8:84736582-84736604 GTGTGAGTATAATAGGTAATAGG + Intronic
1045618573 8:103947679-103947701 GGGTGAGTCAATGAGCAACTTGG + Intronic
1046897672 8:119490008-119490030 GTGTGTGTATATGTGCAAGTGGG - Intergenic
1047860027 8:128955670-128955692 GAGGGAGAATATGAGGAAGTTGG + Intergenic
1048671925 8:136732328-136732350 GTGTGAGTAGAGGAGGAGGTGGG - Intergenic
1051325170 9:15959016-15959038 CTGTGAGTTTATGAGGATCAGGG + Intronic
1052218748 9:25996039-25996061 TTGTGGGTAGAAGAGGAACTAGG - Intergenic
1055961070 9:81821044-81821066 CTGGGAGTCTATGAGAAACTGGG - Intergenic
1056688454 9:88785737-88785759 GTGAGGAGATATGAGGAACTTGG + Intergenic
1057952726 9:99382767-99382789 GTGTGACTATATTTGGAAATAGG + Intergenic
1059054574 9:110966033-110966055 GAGTGAGAATATGTGGTACTTGG - Intronic
1186247217 X:7626941-7626963 GTGTTAGAAGATGAGGAAGTGGG - Intergenic
1187642915 X:21314348-21314370 GTGTGTGTACATCAGGAAGTGGG - Intergenic
1188397972 X:29708002-29708024 ATGTGAGTATATTTGTAACTGGG - Intronic
1189201655 X:39201439-39201461 GTGTGTGTGTAAGAGGAAGTGGG - Intergenic
1189609786 X:42720031-42720053 GTTTGGGTATTTGAGGAACGAGG + Intergenic
1191964007 X:66736297-66736319 TGGTGAGTATATGAGGAAAAGGG - Intergenic
1196596662 X:117553734-117553756 GTCTGAGAAAATGAGGAACTAGG + Intergenic
1196927949 X:120652545-120652567 GAGTGAGAATATGAGGTATTTGG - Intergenic
1197122900 X:122913480-122913502 GTGTGTGCATTTGAGGAAGTAGG + Intergenic
1197155809 X:123269075-123269097 GGGTGAGTACATGAGGAACATGG - Intronic
1197724196 X:129765510-129765532 TAGTGAGTATGTGAGGAAATGGG - Intronic
1198435912 X:136616788-136616810 GTGTGGGTATGTGAGGGAGTGGG - Intergenic
1200390900 X:155945760-155945782 GAATGAGTCTAGGAGGAACTGGG - Intergenic