ID: 947329345

View in Genome Browser
Species Human (GRCh38)
Location 2:229012418-229012440
Sequence CATTAGGCTCCCGCATGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947329345 Original CRISPR CATTAGGCTCCCGCATGGGT AGG (reversed) Intronic
901457988 1:9374572-9374594 CCTTAGCCTCCCGAATGGCTGGG - Intergenic
902241918 1:15095187-15095209 CGTGAGGTTCCCGCATTGGTTGG - Intronic
908741362 1:67331721-67331743 CCTTAGCCTCCCGAATGGCTGGG - Intronic
912359262 1:109081426-109081448 CCTCAGGCTCCCGAATGGCTGGG + Intergenic
912487279 1:110039224-110039246 CATGAGGCTCCTGGATGGCTTGG + Exonic
918000462 1:180489770-180489792 CCTCAGGCTCCCGCATAGCTGGG + Intronic
923665463 1:235994810-235994832 CCCTAGGCTCCCGCATAGCTGGG + Intronic
1062818741 10:518633-518655 CATGAGGGTGCAGCATGGGTGGG - Intronic
1065596021 10:27312074-27312096 CCTTAGCCTCCCGCATAGCTGGG + Intergenic
1066118045 10:32257483-32257505 CCCTAGCCTCCCGCATAGGTGGG - Intergenic
1068875095 10:61987194-61987216 CATTGGGCTCCCTCATGGGCTGG - Intronic
1074188791 10:111117944-111117966 CATTTGGCTCCCACAGGGCTTGG + Intergenic
1075714504 10:124548287-124548309 CTTCAGGCTCCCGCATGAGCTGG + Intronic
1080550870 11:33373253-33373275 CCTTAGGCTCCCGAGTGGCTGGG + Intergenic
1084987464 11:72888734-72888756 CCTTAGCCTCCCGAATAGGTGGG + Intronic
1087517145 11:99178403-99178425 CATTAGGCTCCTGAATAGCTAGG - Intronic
1092775540 12:11942199-11942221 CAGTAGGCCCCAGCTTGGGTGGG + Intergenic
1097115886 12:56696996-56697018 CCTTAGCCTCCCGCATAGCTGGG + Intergenic
1108042567 13:46352763-46352785 CATTGCGCTCCAGCCTGGGTGGG + Intronic
1111442376 13:88296697-88296719 CATAGGTCTCCTGCATGGGTAGG + Intergenic
1113792799 13:113038971-113038993 CCTTAGCCTCCCGCATAGCTGGG + Intronic
1118245774 14:64108989-64109011 CCTTAGCCTCCCGGATGGCTAGG + Intronic
1118721755 14:68599424-68599446 GAGTAGGCTCCCAAATGGGTAGG + Intronic
1127072730 15:55302059-55302081 CCTTAGCCTCCCGAATAGGTGGG - Intronic
1127356505 15:58205930-58205952 CGTTAGGCGCCCACATGAGTGGG + Intronic
1134414001 16:14028354-14028376 CCTTAGGCTCCTGGATGGGCAGG + Intergenic
1135629872 16:24027806-24027828 CACTGGACTCCAGCATGGGTGGG - Intronic
1139743400 16:69054823-69054845 CCTCAGGCTCCCGAATGGCTGGG - Intronic
1148213350 17:45821146-45821168 CATTGGCCTCCAGCAGGGGTTGG - Intronic
1149757774 17:59201853-59201875 CCTTAGCCTCCCGCATAGCTGGG - Exonic
1152004590 17:77672158-77672180 CATCAAGCTCCCGCTTGGGCTGG + Intergenic
1155463147 18:26106328-26106350 CATCAGGCTCCCACATTGGGAGG + Intergenic
1160568107 18:79799046-79799068 CATGAGGCTCCCGCAGGGAAAGG - Intergenic
1162961377 19:14129136-14129158 CCTTAGCCTCCCGCATAGCTGGG - Intronic
1164882058 19:31741057-31741079 CATTAGGCACCCACATGTGCGGG + Intergenic
1168164245 19:54535795-54535817 CTGTAGGCTCCTGCATGGGCAGG - Exonic
927664017 2:25017185-25017207 CATCATGCTCTCTCATGGGTTGG - Intergenic
928574769 2:32643630-32643652 CATTAGGCAGCCTCATGGCTTGG - Intronic
929708405 2:44240406-44240428 CCTTAGGCTCCCACATGACTTGG - Intronic
931044859 2:58340541-58340563 CATGAGGCTCTCCCATGGCTTGG - Intergenic
940677673 2:156744962-156744984 CATTATTCTACCCCATGGGTGGG + Intergenic
947329345 2:229012418-229012440 CATTAGGCTCCCGCATGGGTAGG - Intronic
947419947 2:229933026-229933048 CATTGCGCTCCAGCCTGGGTGGG + Intronic
1169590011 20:7130424-7130446 AAAAAGGCTCCCACATGGGTGGG - Intergenic
1173281177 20:41629497-41629519 CATTAGCCTCCCGAGTAGGTAGG + Intergenic
1173482303 20:43412160-43412182 CCTTAGCCTCCCAAATGGGTGGG - Intergenic
1173626102 20:44474147-44474169 CCTCAGGCTCCCGCATAGTTGGG + Intergenic
1179881958 21:44296669-44296691 CACTGGGCTCCCGCAGGGGGAGG - Intronic
1182336150 22:29584911-29584933 CTTTAGCCTCCCGCATAGCTGGG + Intergenic
949296469 3:2530422-2530444 CCTTAGGCTCCCGGATAGCTGGG + Intronic
950108586 3:10404067-10404089 CATTGGGCTCCTGGAAGGGTGGG + Intronic
950202522 3:11055251-11055273 CATTAGGCTCCTGCAGGGCCAGG + Intergenic
950549209 3:13655992-13656014 CATGAGGCACCCGGATGGCTTGG + Intergenic
953456787 3:43048717-43048739 CATTTGCCTGCTGCATGGGTGGG + Intronic
954612455 3:51953015-51953037 CCTCAGCCTCCCGCATAGGTGGG - Intergenic
958801969 3:98766534-98766556 CCTTAGCCTCCTGAATGGGTGGG + Intronic
963858323 3:150279823-150279845 CTTTAGCCTCCTGCATAGGTGGG + Intergenic
965597567 3:170423352-170423374 CATCAGGCTCCCTCATAGGTAGG - Intronic
980599926 4:135009273-135009295 CATTAGGCTCCCACGTAGCTGGG + Intergenic
983653045 4:170052661-170052683 CCTCAGGCTCCCGAATGGCTGGG - Intergenic
987237541 5:15958069-15958091 CATCAGGAGCCCTCATGGGTGGG - Intergenic
988242460 5:28631959-28631981 CCTTAGCCTCCCGAATAGGTGGG + Intergenic
991395474 5:66199821-66199843 CATCAGCCTCCTGCATAGGTGGG + Intergenic
1006047067 6:31307589-31307611 CCTGAGGCTCTCCCATGGGTGGG - Intronic
1006638116 6:35474684-35474706 CATCATGCTCCCCCAAGGGTGGG + Exonic
1007455259 6:41972110-41972132 CCTCAGCCTCCCGCATGGCTGGG - Intronic
1012300799 6:97585561-97585583 CATTAGGATCACCCATGGGAGGG + Intergenic
1018236474 6:161728819-161728841 TATTAGGCTCCTGCCTGGTTTGG - Intronic
1023840406 7:44094000-44094022 CATTGCGCTCCAGCCTGGGTGGG - Intergenic
1027873529 7:83740881-83740903 TATTAGGCTGCTGCATGTGTAGG + Intergenic
1033643526 7:143284755-143284777 CATTAGGGTACAGCATGGGTGGG + Intronic
1035174557 7:157040824-157040846 CATTGCGCTCCAGCCTGGGTGGG + Intergenic
1038209615 8:25503934-25503956 CCTTAGGCTCCCAAATGGTTGGG - Intronic
1040922918 8:52643571-52643593 CCTTAGCCTCCCGAATGGCTGGG - Intronic
1042339117 8:67660587-67660609 CCTTAGGCTCCCACAAGGCTAGG + Intronic
1046955330 8:120057384-120057406 CATCAGCCTCCCGCATAGCTGGG - Intergenic
1056329475 9:85509921-85509943 CAGTAGCCACCCACATGGGTAGG + Intergenic
1061395909 9:130343220-130343242 CGTTGGGCTCCTGCATGGCTGGG + Intronic
1061955004 9:133956795-133956817 CACTGGGCTCCCGCCTGGGTGGG - Intronic
1201957289 Y:19639309-19639331 CATTAGGCTCCCTGATAGTTAGG + Intergenic