ID: 947331268

View in Genome Browser
Species Human (GRCh38)
Location 2:229032095-229032117
Sequence AACCATGCCCCCTGTGTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947331267_947331268 4 Left 947331267 2:229032068-229032090 CCAATGATTCAGTTATGCTCTGC 0: 1
1: 0
2: 2
3: 31
4: 392
Right 947331268 2:229032095-229032117 AACCATGCCCCCTGTGTATTTGG 0: 1
1: 0
2: 0
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947331268 Original CRISPR AACCATGCCCCCTGTGTATT TGG Intronic
905533416 1:38700094-38700116 AACCATGCTGTCTGTGTCTTCGG + Intergenic
909551400 1:76901315-76901337 AACCATGCTCCCTTTGCAATTGG - Intronic
910762515 1:90748026-90748048 CACTATGTCCCCGGTGTATTTGG - Intergenic
917283002 1:173397014-173397036 AACCATGCCCACCTTGTCTTTGG - Intergenic
919157117 1:193779775-193779797 CACCTTGCCCCTTGTATATTTGG + Intergenic
921137146 1:212271885-212271907 AAACATGCCCAATGTGTATAAGG + Intergenic
924182676 1:241454988-241455010 AACCATGCCCACTTTGCCTTTGG + Intergenic
1064303671 10:14145805-14145827 GAACATGCCCCCAGTGTTTTTGG - Intronic
1067791480 10:49291642-49291664 AATCATGCCACCTATGCATTAGG + Intergenic
1069922864 10:71827773-71827795 TGCCAGGCACCCTGTGTATTAGG - Intronic
1069936104 10:71918118-71918140 AACCATGCCCCCTGTGATGCTGG - Intergenic
1075637167 10:124037109-124037131 AGGCATGCTCCCTGTGTCTTAGG + Intronic
1079290057 11:19179946-19179968 GATCATGCCCCCTGTGACTTAGG + Intergenic
1079785601 11:24667546-24667568 AACTATGCACTCTGTGTAATGGG + Intronic
1092486259 12:8904808-8904830 AAACATGCCCTCTGTGTACAAGG + Intergenic
1095409285 12:41904606-41904628 AACTATGCCCTCTGTGTCATAGG + Intergenic
1104482774 12:129122625-129122647 AATCATGCTCCCTGTGAAATTGG + Intronic
1105650193 13:22369147-22369169 GACCATTTCCCCTGTGTCTTTGG - Intergenic
1106755161 13:32815056-32815078 AACCATGGCCCCTGGGTTTGAGG - Intergenic
1106836520 13:33640979-33641001 AACAATTCCCCCTGTGTCTTTGG - Intergenic
1109340799 13:61055807-61055829 AAAGATGACCTCTGTGTATTGGG - Intergenic
1110869806 13:80437642-80437664 AACCAAGCCCCCTGACTAATAGG - Intergenic
1112965307 13:105184025-105184047 AACCATGCCCTGTGTTTTTTAGG - Intergenic
1113666816 13:112147331-112147353 AACCCTGACCCCTGTGTGATGGG + Intergenic
1113666862 13:112147525-112147547 AACCCTGACCCCTGTGTGATGGG + Intergenic
1115729271 14:36250486-36250508 AAACATGGCCTTTGTGTATTGGG + Intergenic
1121937542 14:98034053-98034075 AACCATGCCTCCTGAGTAGCTGG - Intergenic
1129253414 15:74320730-74320752 AACCCTGCCCTCTGTGTCTCAGG + Intronic
1129792163 15:78348688-78348710 AACCATGGCCCCAGTGTTTATGG + Intergenic
1132337556 15:101058158-101058180 TGCCCTGCCCCCTTTGTATTTGG + Intronic
1136018082 16:27418924-27418946 CACCATGCCCCGCGTGTCTTAGG - Intronic
1137595571 16:49721352-49721374 TACCATACCTGCTGTGTATTCGG - Intronic
1138887714 16:61100081-61100103 AACAATGCCTACTGTGAATTAGG + Intergenic
1147399090 17:40168406-40168428 AGCCATCTCACCTGTGTATTAGG - Exonic
1152886570 17:82854726-82854748 AACCATTCCTCCTGTTTCTTAGG - Intronic
1156926552 18:42587385-42587407 AACCTTTCCACCTGTGCATTTGG + Intergenic
1160856101 19:1218692-1218714 AGCCCTGGCCCCTGTGTCTTGGG + Intronic
1161058532 19:2202476-2202498 AATCCTGCCCCCTCTGTTTTTGG + Intronic
1164088215 19:21923412-21923434 AACCAATCCACCTGTGGATTGGG - Intergenic
1164526083 19:29014641-29014663 TCCCATGCCCTCTGTGGATTGGG - Intergenic
928211011 2:29323697-29323719 AACAAAGACCCCTGTGGATTAGG + Intronic
931869287 2:66441507-66441529 AACCCTCCCCCCTGTGTGTTTGG - Intronic
932188895 2:69722150-69722172 ACCCATTCCTACTGTGTATTTGG + Intronic
933995626 2:87667320-87667342 AAGTATGCCACCTGTGTATTAGG + Intergenic
936298231 2:111283592-111283614 AAGTATGCCACCTGTGTATTAGG - Intergenic
936396684 2:112137164-112137186 AACCATGTCCCCTGCTTTTTGGG + Intergenic
939090535 2:137775474-137775496 AACCATTTCCCCTGTATTTTGGG - Intergenic
939755059 2:146100001-146100023 AACCATGCCCACCTTGTCTTTGG - Intergenic
943686367 2:190822876-190822898 AACCATTCACTCTATGTATTTGG + Intergenic
945308239 2:208280911-208280933 AACCATGCCCACCTTGTCTTTGG + Intronic
947331268 2:229032095-229032117 AACCATGCCCCCTGTGTATTTGG + Intronic
947422793 2:229955639-229955661 AACAATGCCCTCTGTGTTTGTGG + Intronic
948909900 2:240997890-240997912 AGCCCTGCCCCCTGTCTCTTGGG - Intergenic
1171190581 20:23156409-23156431 AACCCTGGCCAATGTGTATTTGG - Intergenic
1172987153 20:39000847-39000869 ATCCATGCCCCCTCTGCAGTGGG + Intronic
1173303744 20:41828446-41828468 ATTCATGCCACCTGTGTATGAGG - Intergenic
1174979236 20:55374422-55374444 AATCATGTCCCTTGTGTTTTCGG + Intergenic
1175249494 20:57600617-57600639 AACCAGGCCCCCTGTCAATGAGG - Intergenic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1175363279 20:58431957-58431979 ACTCATGCCTCCTGTGTAATAGG - Intronic
1179443990 21:41418918-41418940 CACCATAACTCCTGTGTATTGGG + Intergenic
1183985789 22:41569501-41569523 AATCATGCCCTCTGTGTTTTTGG + Intronic
949626035 3:5867676-5867698 ACCCATGCCCCCTGGACATTTGG + Intergenic
954553775 3:51502941-51502963 AAGCATGCACACTGTGCATTAGG + Intergenic
961457681 3:127032287-127032309 AGCCATGCCCACTTTGGATTCGG + Intronic
963006057 3:140727213-140727235 AACCATGCCCCCAGTAAATGTGG + Intergenic
968028726 3:195464939-195464961 AAACATGTCCCCTCTGCATTTGG + Intergenic
970144399 4:13019516-13019538 AACAATAACCCATGTGTATTAGG + Intergenic
970900904 4:21159060-21159082 AACAATGCCCGCTGTGAGTTTGG - Intronic
976839960 4:89420618-89420640 AACCATGCCCAATGAGTACTTGG + Intergenic
979048051 4:115894806-115894828 AACTCTGCCCACTTTGTATTTGG - Intergenic
985750240 5:1669497-1669519 AACCATGCATCCTGGGTATGTGG + Intergenic
987779176 5:22410570-22410592 GACCATTTCCCCTGTATATTTGG + Intronic
989283738 5:39674961-39674983 AACAAGGCCCCCTTTGAATTAGG - Intergenic
995601161 5:113798373-113798395 AATAATGCCCGCTGTGTTTTGGG + Intergenic
1001733924 5:173982798-173982820 ACCCCTGCCTCCTGTGTAGTGGG - Intronic
1005601152 6:27427589-27427611 AACCATTACCTCTGTGTACTAGG + Intergenic
1006750728 6:36375166-36375188 AAGCAAGCCCACAGTGTATTTGG - Intronic
1009539844 6:64940533-64940555 AACCTTTCCACCTGTATATTAGG - Intronic
1010632657 6:78216973-78216995 AACCATGTCCCCTATCTAGTGGG + Intergenic
1011736501 6:90315746-90315768 AAGCTTGCCCCTTGTGAATTTGG + Intergenic
1012559392 6:100560628-100560650 AACCATTCCAGCTGTGGATTAGG + Intronic
1013274037 6:108567293-108567315 TACCATGGCTCCTGTGGATTGGG + Intronic
1013431616 6:110061276-110061298 CACCATGGCTCCTGTTTATTGGG + Intergenic
1020400542 7:7771722-7771744 AACCATGCCCTCAGTGGCTTTGG - Intronic
1025041547 7:55650404-55650426 AACCATACACCCTTTGTTTTAGG + Intergenic
1035738189 8:1904599-1904621 CTCCGTGCCCCATGTGTATTCGG - Intronic
1039148928 8:34480996-34481018 AACCATTCCTTGTGTGTATTGGG - Intergenic
1039851306 8:41367887-41367909 CACCATTTCCCCTTTGTATTTGG + Intergenic
1044561562 8:93617518-93617540 AATCATGCCAGCTCTGTATTTGG + Intergenic
1045391638 8:101721005-101721027 ACCCATGCCCCCTTTGGGTTGGG - Intronic
1056725148 9:89107706-89107728 AACCCTGATCCCTGTGCATTTGG - Intronic
1057177318 9:93009830-93009852 AACCATCCCCACTGGGTATCGGG - Intronic
1057577254 9:96253030-96253052 AACCATGTCCCATTTTTATTTGG - Intronic
1060309071 9:122443146-122443168 AAACAAGATCCCTGTGTATTAGG - Intergenic
1186458315 X:9728227-9728249 ACCCATTCCCCATGTTTATTGGG - Intronic
1192208789 X:69113670-69113692 CACCATGCCCCCTGTGAAGTAGG - Intergenic
1196114657 X:111985837-111985859 AACCATGCCCACCTTGTCTTTGG + Intronic
1199372042 X:147060897-147060919 AAGCATGCACACTGTGTAATTGG + Intergenic