ID: 947331674

View in Genome Browser
Species Human (GRCh38)
Location 2:229035455-229035477
Sequence GTGTGTGAGTAGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1002
Summary {0: 1, 1: 0, 2: 7, 3: 98, 4: 896}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947331674_947331680 -7 Left 947331674 2:229035455-229035477 CCTCCTTCCCTCTACTCACACAC 0: 1
1: 0
2: 7
3: 98
4: 896
Right 947331680 2:229035471-229035493 CACACACATACATATAAATGGGG 0: 1
1: 0
2: 53
3: 330
4: 1580
947331674_947331679 -8 Left 947331674 2:229035455-229035477 CCTCCTTCCCTCTACTCACACAC 0: 1
1: 0
2: 7
3: 98
4: 896
Right 947331679 2:229035470-229035492 TCACACACATACATATAAATGGG 0: 1
1: 0
2: 13
3: 188
4: 1082
947331674_947331678 -9 Left 947331674 2:229035455-229035477 CCTCCTTCCCTCTACTCACACAC 0: 1
1: 0
2: 7
3: 98
4: 896
Right 947331678 2:229035469-229035491 CTCACACACATACATATAAATGG 0: 1
1: 2
2: 34
3: 286
4: 1630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947331674 Original CRISPR GTGTGTGAGTAGAGGGAAGG AGG (reversed) Intronic
900159489 1:1216704-1216726 GTTTGTGAGTAGGGGTCAGGGGG - Intergenic
900337111 1:2169738-2169760 GGGTGTGCGCAGAGGGGAGGTGG + Intronic
900509540 1:3051982-3052004 GTGGGTGAGTGGATGGAAGATGG - Intergenic
900805834 1:4767842-4767864 GTGTGTGGGTAGAGAGCAAGAGG + Intronic
900836075 1:5005158-5005180 GTGAGTGAGGAGTGGGAAGAAGG - Intergenic
901226189 1:7614067-7614089 GGGTGGGAGGAGAGGGATGGTGG + Intronic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
901678731 1:10901358-10901380 GTGTGTGGGTAGCTGGAAGGAGG + Intergenic
901693000 1:10985987-10986009 GTGTGTGTGTAGGAGGAATGGGG - Intergenic
901831798 1:11897300-11897322 GTGTGTGTGTCGGGGGGAGGGGG - Intergenic
902129091 1:14243119-14243141 GTGTGTGTGTAGTGGCATGGTGG - Intergenic
902200082 1:14826818-14826840 GTGGGTGAGAAGAGCAAAGGCGG - Intronic
902236525 1:15060872-15060894 GTGTGGGAGTAAATTGAAGGTGG + Intronic
902265654 1:15261672-15261694 GTCTGGGAGCAGAGGGAAAGAGG - Intronic
902917502 1:19647542-19647564 GTGTGGGGGGAGAGGAAAGGTGG + Intronic
903012601 1:20342318-20342340 GTGGGGGAGCAGAAGGAAGGAGG + Intronic
903680720 1:25094978-25095000 GTCTGTGTGTTGAGGGCAGGTGG - Intergenic
904306559 1:29593905-29593927 GTGTGTGGGAAGGGGGAAGAGGG + Intergenic
904373279 1:30064399-30064421 GTGTGTGGGTGGGAGGAAGGAGG + Intergenic
904375828 1:30081903-30081925 GTGGGGGAGCAGAGGGAGGGAGG - Intergenic
904995096 1:34625598-34625620 GTGTGAGAGTTGGAGGAAGGAGG - Intergenic
905184742 1:36188199-36188221 GTGTGTGTGTTGAGGGGCGGGGG - Intergenic
905241281 1:36583185-36583207 GTGGGTGAGTGGTGGGTAGGTGG - Intergenic
905961918 1:42050143-42050165 GGATGGGAGTAGAGGGAAGCTGG + Intergenic
907244199 1:53097338-53097360 GTGTGTGAGTACACGGAGGCAGG - Intronic
907303704 1:53502727-53502749 GGGAGAGAGGAGAGGGAAGGGGG + Intergenic
907310200 1:53534693-53534715 GTGCGTGAGTGGAAGGATGGGGG - Intronic
907471942 1:54679804-54679826 AGGTGGGAGGAGAGGGAAGGGGG - Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
908096249 1:60741991-60742013 TTGGGAGAGAAGAGGGAAGGTGG - Intergenic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909073169 1:71020724-71020746 GTGTGTGTGTAGTGGGGTGGGGG + Intronic
909295446 1:73941955-73941977 GTGTATGAGGAGGTGGAAGGTGG - Intergenic
909295454 1:73941997-73942019 GTGTATGAGGAGGGGGAAAGTGG - Intergenic
909474851 1:76071478-76071500 GCCTCTGAGGAGAGGGAAGGTGG + Intergenic
909942533 1:81626919-81626941 GGGTGTGGGTGGAGGGTAGGTGG + Intronic
910121925 1:83799606-83799628 GTGTGTGTGTTGGGGGAGGGAGG + Intergenic
910508403 1:87976818-87976840 GTGTGTGTGGTGGGGGAAGGGGG - Intergenic
910896121 1:92071253-92071275 GTGTGTGTGTATGGGGTAGGGGG - Intergenic
911496047 1:98632628-98632650 GTGTTTGTGCAGAGAGAAGGAGG + Intergenic
911905535 1:103563996-103564018 AAGTGTTAGTAGAGCGAAGGCGG + Intronic
912197252 1:107412700-107412722 GTGTCTGAGGACAGGGATGGAGG + Intronic
912438596 1:109680575-109680597 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912441117 1:109699020-109699042 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
913088346 1:115459212-115459234 GTGTGTGTGTTGGGGGAGGGTGG - Intergenic
913301372 1:117373389-117373411 ATGTCTGAGTAAAGGGAAGTGGG - Intronic
913318898 1:117575245-117575267 CTGTGGGAGTCTAGGGAAGGGGG - Intergenic
913371517 1:118104879-118104901 GTGGGTGAGTGGATGCAAGGGGG + Intronic
914986681 1:152463821-152463843 GTGTGTGTGTGTAGGAAAGGGGG - Intergenic
915292882 1:154898095-154898117 GTGTGGGAGTTGTGGGGAGGAGG - Intergenic
915488091 1:156235993-156236015 GAGTGTGTGTGGAGGAAAGGAGG + Intronic
915518978 1:156430442-156430464 GTATGAGAGAGGAGGGAAGGGGG - Intronic
915769684 1:158407294-158407316 GTGTGTGTGTCGGGGGACGGGGG + Intergenic
915907474 1:159889399-159889421 GTGTGTGTGTTGGGGGAGGGTGG + Intronic
916586488 1:166154225-166154247 GTGTGTGGGTAGGGGCCAGGAGG + Intronic
917122435 1:171656105-171656127 GTGTGTGTGTATAGGGGAGGAGG - Intergenic
917218939 1:172706798-172706820 GTGTGTGACTTGGGGGAAGGAGG - Intergenic
917994125 1:180417281-180417303 GTGTTTGAGCAGAGGGAATGTGG - Intronic
918028810 1:180782486-180782508 GTGTGTGATTGGAGTGAGGGAGG + Intronic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
918295147 1:183149558-183149580 GTGTGTGAGGAGAGGGGTGTGGG - Intergenic
918295196 1:183149805-183149827 GTGTGTGAGGAGAGGGGTGTGGG - Intergenic
918295233 1:183150002-183150024 GTGTGTGAGGAGAGGGGTGTGGG - Intergenic
918355679 1:183705148-183705170 TTTGGTGAGTAGAGTGAAGGAGG + Intronic
918420497 1:184359871-184359893 GCCTGTGGGTAGGGGGAAGGAGG - Intergenic
918480835 1:184974873-184974895 GTGTGTGTGTAGAGGGGTGGTGG - Intergenic
919403984 1:197152793-197152815 GTGTGTGTGTGGAGGGGTGGGGG + Intergenic
919534142 1:198765757-198765779 GAGTGGGAATAGAGGCAAGGAGG - Intergenic
919754929 1:201060857-201060879 GTGGGTGTGGAGAGGGAGGGAGG - Intronic
919977994 1:202625453-202625475 GTGTGCGGGGAGGGGGAAGGGGG + Intronic
920068023 1:203282824-203282846 GTGGCTGAGAATAGGGAAGGTGG + Intergenic
920251484 1:204625028-204625050 GTGTGTGATTAAATGGGAGGTGG - Intronic
920540364 1:206773622-206773644 GTGTGTGTGTAGAAGGTAAGGGG + Intergenic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
920932957 1:210406094-210406116 GGGTGGGAGTAAAGGTAAGGTGG + Intronic
921628171 1:217401798-217401820 TTGGGGGGGTAGAGGGAAGGGGG - Intergenic
922648688 1:227318391-227318413 GCGCGAGAGGAGAGGGAAGGCGG - Exonic
923051653 1:230394628-230394650 GAGCGTGAGTGGAGGGGAGGAGG - Intronic
923051685 1:230394741-230394763 GAGCGTGAGTGGAGGGGAGGAGG - Intronic
923051985 1:230395760-230395782 GAGTGTGAGGAGGGGGGAGGAGG - Intronic
923374499 1:233347050-233347072 GTGTGTGTGTAGAGGAGCGGGGG + Intronic
923647427 1:235838177-235838199 GAGAGTGAGAAGTGGGAAGGAGG + Intronic
924202434 1:241674045-241674067 GTGTGTGTGTAGGGGGTGGGTGG + Intronic
924563734 1:245178824-245178846 GTGTCTGAGTGGAGGGCAAGTGG + Intronic
1062974411 10:1672742-1672764 GTGTGTGCGTGGAGGGAGGGAGG - Intronic
1063417853 10:5888994-5889016 CTCTGCGAGTAGAGGGGAGGCGG + Intronic
1063458535 10:6201707-6201729 GGCTGTGATTGGAGGGAAGGCGG - Intronic
1063594180 10:7418619-7418641 GTGTGTGTGTGAAGCGAAGGAGG + Intergenic
1063655192 10:7981258-7981280 GTGGGTGAATAGATGGAAGAGGG - Intronic
1063943752 10:11157381-11157403 GTGTGTGTGTGGGGGGAGGGCGG - Intronic
1063982708 10:11468633-11468655 GCGTGGGAGTGGAGGGGAGGAGG + Intronic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1065125095 10:22566460-22566482 GAGTGTGCGTAGAGGGAAGGGGG - Intronic
1065135736 10:22667907-22667929 GTGTGTGTGTAGAGAGGGGGAGG + Intronic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1066135639 10:32443089-32443111 GTCTCTGAGTTGAGGGAAGGAGG - Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067514708 10:46928582-46928604 GTGTGTGAGTATAGGACTGGGGG - Intronic
1067647548 10:48123231-48123253 GTGTGTGAGTATAGGGCTGGGGG + Intergenic
1067879182 10:50029047-50029069 GTGTGGGAGTTGTGGGGAGGAGG + Intergenic
1068131904 10:52905671-52905693 GTGTGTGGGTCGAGGGGAGGAGG + Intergenic
1068620667 10:59177346-59177368 GTGTGTGTGTTGGGGGAAGGGGG - Intronic
1068637135 10:59360351-59360373 GGGTGTGAGTAGAAGGATGTAGG + Intronic
1068753605 10:60624957-60624979 GTGTGTGTGCACAGGGAAGAAGG - Intronic
1068997670 10:63225989-63226011 GAGTGTATGTGGAGGGAAGGGGG - Intronic
1069082911 10:64107282-64107304 GTGTGGGAGAAGAGTGTAGGAGG - Intergenic
1069244639 10:66188568-66188590 GTGTGTGTGTGGGGGGAGGGGGG + Intronic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1069777363 10:70934826-70934848 GTGTGTGGGGAGAGGGAAAGTGG + Intergenic
1069846361 10:71374527-71374549 GTGTGTGTGTTGTGGGAAGCAGG + Intergenic
1070043610 10:72807640-72807662 GTGTGAGAGGAGAGGGAGGGTGG - Intronic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070250037 10:74765608-74765630 GTCTGTGAGTAGAGAGAATATGG + Intergenic
1070323089 10:75369452-75369474 GTGTGAGAGCCGAGTGAAGGGGG - Intergenic
1070686452 10:78487214-78487236 TTGTGGGAGTAGAGGGATAGAGG + Intergenic
1070895653 10:79981670-79981692 GGCTGTGGGAAGAGGGAAGGTGG + Intronic
1070937441 10:80312035-80312057 GTGTGTGTGTTGGGGGGAGGGGG - Intergenic
1071143670 10:82542068-82542090 GTCAGTGGGTAGAGGGAAAGGGG - Intronic
1071552965 10:86581501-86581523 CTCTGTGAGTAGAGGGAGGTTGG - Intergenic
1072167875 10:92831207-92831229 GGGTGGGAGTAGAGGGAGGGTGG + Intergenic
1072370353 10:94760151-94760173 GTGTGTGGGTGCAGGGAAAGAGG + Intronic
1072386499 10:94935883-94935905 GTGTGTGGGTGCAGGGAAAGAGG + Intergenic
1072637328 10:97186216-97186238 GGATGGGAGAAGAGGGAAGGGGG + Intronic
1072686803 10:97542430-97542452 GTGGGAGAGCAGAGGGAGGGAGG - Intronic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1072862441 10:99020641-99020663 GTGTATGTGTTGAGGGAGGGTGG + Intronic
1072904459 10:99439538-99439560 GGGTGGGAGTAGGAGGAAGGAGG + Intergenic
1073036532 10:100567662-100567684 GTGTGTGTGTTGCGGGGAGGTGG - Intergenic
1073054013 10:100687459-100687481 CTGGGTGAGGACAGGGAAGGAGG + Intergenic
1073284832 10:102381349-102381371 GTCTGTGAGCCGAGGGAAGAAGG + Intronic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1073577983 10:104641206-104641228 GTGTGTGTGTAGGGGGAGTGGGG - Exonic
1073588547 10:104734084-104734106 GTGTGTGAGTAGATGTATGTTGG + Intronic
1073754500 10:106566451-106566473 GTGTATGGGTAGAGTGAAAGAGG + Intergenic
1073767443 10:106698857-106698879 GGCTGTGAGTAAAGGGATGGTGG - Intronic
1074099018 10:110338970-110338992 GTGTGAGAGAGGTGGGAAGGAGG + Intergenic
1075242696 10:120792941-120792963 GTGTGTGTGTTGTGGGAGGGGGG - Intergenic
1075242758 10:120793181-120793203 GTGTGTGTGTTGTGGGAGGGGGG - Intergenic
1075242776 10:120793264-120793286 GTGTGTGTGTGGGGGGGAGGGGG - Intergenic
1075544249 10:123342593-123342615 GTATGTGTGTTGAGGGAGGGAGG - Intergenic
1075845540 10:125542390-125542412 GTGAGGGAGAAGAGGGAAGCTGG - Intergenic
1076168510 10:128301482-128301504 GTTTGTGACAAGAGGGAAGTAGG - Intergenic
1076783475 10:132737228-132737250 GTGTGTGTCCAGAGGGCAGGTGG + Intronic
1076917224 10:133430335-133430357 GTCTGTGAGCACAGAGAAGGAGG + Intergenic
1076937321 10:133575094-133575116 GTCTGTGAGCACAGGGAAGGAGG + Intergenic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077789762 11:5425521-5425543 GTGTGTGTGGCGAGGGGAGGAGG + Intronic
1077896997 11:6460528-6460550 GTCTCTGAATGGAGGGAAGGAGG + Intronic
1078650092 11:13182469-13182491 GTGTGTGTGTTGTGGGAGGGAGG + Intergenic
1078673112 11:13382510-13382532 GTGTGTGTGTTGTGGGCAGGGGG - Intronic
1078845000 11:15112628-15112650 GTGTGTGTGTATTGGGAAGTGGG + Intronic
1078942238 11:16020368-16020390 GAGTGTGAGTAGAAGGACTGGGG - Intronic
1079023587 11:16927975-16927997 TTGTGTGTGGAGGGGGAAGGGGG + Intronic
1079314848 11:19398808-19398830 GTGTGTCTGTGGGGGGAAGGAGG - Intronic
1079576784 11:22013690-22013712 GTGTGAGAACATAGGGAAGGTGG + Intergenic
1079762489 11:24347447-24347469 GTGTGTGTGTAGAGAGAGAGAGG - Intergenic
1080387612 11:31819085-31819107 GTGTGTGTGTAGAAGCAGGGAGG + Intronic
1081432961 11:42996691-42996713 GTGTGTGTGTGGAGGGCGGGGGG - Intergenic
1081577219 11:44326784-44326806 GCGTGTGTGTGGAGGGAGGGAGG + Intergenic
1081706970 11:45187927-45187949 GTGGGAGAGTACGGGGAAGGTGG + Intronic
1081869957 11:46378924-46378946 GCGTGTGAGCTCAGGGAAGGAGG + Intronic
1082653875 11:55828223-55828245 GTGTTGGAGTAGAGAGAAGAAGG + Intergenic
1082982740 11:59138071-59138093 CAGTGTGTGTACAGGGAAGGGGG + Intergenic
1083305307 11:61758968-61758990 ATGTGTGAGTAGGGGGCAGGTGG + Intronic
1083374040 11:62205316-62205338 GTGTGTGTGTAAGGGGAAGGGGG + Intergenic
1083441409 11:62678956-62678978 GTGTGTGACGAGAAGGAGGGCGG + Exonic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1083692090 11:64415515-64415537 GGGTCTGAGGAGAGGGGAGGAGG + Intergenic
1084144353 11:67256201-67256223 GCGTGTGTGTGGAGGGAGGGAGG + Exonic
1084343538 11:68526565-68526587 GTGTGTGAATAGAGGTAAGATGG - Intronic
1084460082 11:69292326-69292348 GTCTGAGAGCAGATGGAAGGAGG - Intergenic
1085204001 11:74719369-74719391 GTGTGTGTGTACAGGGGAGGGGG - Intronic
1086306425 11:85485564-85485586 GTGAGTAAGGAGAGGGAAGGGGG + Intronic
1086944928 11:92835721-92835743 CTGTGTGTGTAGGGGGAAAGGGG - Intronic
1087119173 11:94554693-94554715 GTGTGTGTGTACTGGGATGGGGG + Intronic
1088140490 11:106609910-106609932 GTGTGGAAGTAGTGGGAAGAAGG - Intergenic
1088190719 11:107225528-107225550 GTGTGTGTGTGTATGGAAGGAGG - Intergenic
1088549369 11:110995658-110995680 GTGTGTGTGTAAAGCAAAGGTGG - Intergenic
1089147324 11:116338853-116338875 GCCTGTGGGTTGAGGGAAGGGGG + Intergenic
1089169021 11:116499749-116499771 GTGTGTGCGCACAGGGAGGGAGG - Intergenic
1089364127 11:117910648-117910670 GTGTGGGAGTAAAGGGCAGAGGG - Intronic
1090019063 11:123110913-123110935 GTGTGTGAGTAGCTGTAAAGGGG + Intronic
1090153202 11:124406782-124406804 GTGTGTGTGTGGTGAGAAGGAGG - Intergenic
1090358895 11:126159449-126159471 GTGTGTGAGTGCAGGGAGTGGGG + Intergenic
1090406482 11:126478829-126478851 CTGCGTGAGTAGTGGGAGGGAGG + Intronic
1091001583 11:131914249-131914271 GTGTGTGTGTAGGGGGACAGAGG + Intronic
1091143864 11:133260214-133260236 GCCAGTGAGTGGAGGGAAGGAGG + Intronic
1091446382 12:546196-546218 GGGTGTGAGAGGAGGGAGGGGGG + Intronic
1091543121 12:1480736-1480758 GGGTGTGGGTAGTGGGCAGGGGG + Intronic
1091641852 12:2243247-2243269 GTGTGTGAGTACCTGGAAGCAGG + Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1093549352 12:20389228-20389250 GTGTGTGTGAGGAGGAAAGGGGG + Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094344250 12:29449266-29449288 GTGTGTGTGTGTAGGGAGGGGGG - Intronic
1094345111 12:29459495-29459517 GTGGGTGAGTATAGGGGAAGTGG + Intronic
1095279075 12:40328135-40328157 GGGTATGTGTAGAGGGAAGACGG + Intronic
1095709892 12:45277124-45277146 GTTTGTGAGAGAAGGGAAGGGGG - Intronic
1095825745 12:46529630-46529652 ATGTGTGTGTATAGGGGAGGAGG + Intergenic
1095946882 12:47758749-47758771 TTGGGTGAGTAGAGGGGTGGGGG + Intronic
1096079088 12:48822110-48822132 GTGTGTGTGTATAGGGGAAGGGG - Intronic
1096155133 12:49337301-49337323 GTGGGGGAGTGGAGGGGAGGCGG - Intergenic
1096216584 12:49801159-49801181 GTGTGTGTGTATGGGGGAGGGGG - Intronic
1096744358 12:53715778-53715800 GTGTGGAGGTAGAGGGATGGGGG - Exonic
1096750639 12:53756742-53756764 GTGTGTGTGTACTGGGGAGGGGG + Intergenic
1097680287 12:62642577-62642599 GTGAGTGAGTAGAGGCCACGTGG - Intergenic
1098104033 12:67050800-67050822 GTGGGTGAGTTGAGGAAAAGGGG - Intergenic
1098190078 12:67938623-67938645 GGGTGAGAGTAGAGAGAAGGGGG + Intergenic
1098504497 12:71233422-71233444 GTGTGAGGGAAAAGGGAAGGTGG + Intronic
1098998490 12:77149331-77149353 GTGTGTGTGTTGAGGGAGGGAGG - Intergenic
1099016577 12:77350427-77350449 GTGTGTGTGTTGAGAGAAAGGGG + Intergenic
1099395977 12:82139357-82139379 GAGTGTGTGTAGTGGGGAGGAGG - Intergenic
1099573546 12:84355909-84355931 GTGGGTGAGTAGTGGGTAGCTGG - Intergenic
1099719673 12:86344766-86344788 GTGTGTGTGTAGCGGCAAGAGGG + Intronic
1099843220 12:87993684-87993706 GTGTGTGAAGAGTAGGAAGGAGG - Intronic
1101056129 12:100916012-100916034 GTGAGTGAGTGGAGGGCAAGTGG + Intronic
1101119182 12:101561638-101561660 GTGTGTGTGTGTAGGGAATGTGG - Intergenic
1101177678 12:102172290-102172312 GTGGGGAAGTAGAGAGAAGGAGG - Intronic
1101652477 12:106690066-106690088 GTGTGTGTGTTGTGGGAAGGGGG + Intronic
1102215633 12:111159643-111159665 GTATGTGAATAGCCGGAAGGGGG - Intronic
1102867924 12:116388952-116388974 GTGTGTGTGTGGCGGGAGGGTGG - Intergenic
1104101985 12:125621381-125621403 CTCTTTGAGTAGAGGGAAGGGGG + Intronic
1104177973 12:126351382-126351404 GTGTGAGGGTAGGGGGATGGTGG - Intergenic
1104953887 12:132454500-132454522 GTGTGGGGGTTGAGGGAACGGGG + Intergenic
1105391914 13:19987589-19987611 GTGTGTGTGTATAGGAAAGATGG + Intronic
1105391918 13:19987649-19987671 GTGTGTGTGTATAGGAAAGATGG + Intronic
1105607315 13:21936898-21936920 GTGTGTGTGTGTAGAGAAGGTGG + Intergenic
1106059048 13:26268244-26268266 GTGTGTGTGTTGGGGGAGGGGGG - Intronic
1106269610 13:28139542-28139564 GTGTGTGTGTAGGGGGCGGGAGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106896393 13:34307333-34307355 GGCTGTGAGGAAAGGGAAGGTGG + Intergenic
1106936945 13:34732983-34733005 GTGTGCGAGCAGATGGAAAGGGG + Intergenic
1107002377 13:35564030-35564052 GCTTGAGGGTAGAGGGAAGGAGG - Intronic
1107178778 13:37431690-37431712 GTAAGTGTGTAGAGGGAATGGGG + Intergenic
1107501436 13:40981336-40981358 GTGTGTGTGTTGTGGGGAGGGGG + Intronic
1108075151 13:46671821-46671843 GTGTGGGAGTAGAGGGTATGTGG - Intronic
1108420546 13:50244768-50244790 GAATGTGACAAGAGGGAAGGTGG - Intronic
1108660200 13:52578106-52578128 GTGTCTGTGTAGAGGGGATGGGG + Intergenic
1109725703 13:66338632-66338654 GTGTGTGTGTAGAGGGGTGGGGG + Intronic
1109989459 13:70034656-70034678 GTGTTTGTGTAGAGGGGAAGAGG + Intronic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1110798678 13:79669986-79670008 GTGTGTGTGTTGGGGGATGGGGG - Intergenic
1110870220 13:80443555-80443577 GTGTATGAAAAGAGAGAAGGAGG - Intergenic
1110873052 13:80474870-80474892 GTGGGTGTGGAGAGAGAAGGCGG + Intergenic
1111141892 13:84129611-84129633 GAGAGTAAGTAGAGGGAAGTAGG + Intergenic
1111437595 13:88231073-88231095 GGGTTTGTGTAGAGGGAATGTGG + Intergenic
1111705880 13:91748938-91748960 GTGTGTGAATAGAGAGAAGGGGG + Intronic
1112036387 13:95500478-95500500 GTGTTGGAGTAGAGTGAGGGTGG + Intronic
1112246333 13:97737360-97737382 GTGTGTGTGTAGGGGGCATGAGG - Intergenic
1112426509 13:99306512-99306534 GTGTGTGTGTTGGGGGAGGGGGG - Intronic
1112675736 13:101699541-101699563 GTATGAGAGTCGAGTGAAGGGGG - Intronic
1113106102 13:106772851-106772873 GTGTGTGTGTGGAGGGAGAGGGG - Intergenic
1113371448 13:109728907-109728929 GTCTGTGAGGAGAGGGAGGCAGG + Intergenic
1113420940 13:110170894-110170916 GTGTGTTATTAAAGAGAAGGAGG - Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114555674 14:23561040-23561062 GTGAGTGGGTAGTGGGAAAGTGG + Intronic
1115398441 14:32934340-32934362 GTGTGTGTGTAGAGGGGGGCGGG + Intergenic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1115605320 14:34995179-34995201 GTGTGTGTGTAGAGAGAGAGAGG + Intronic
1115652495 14:35413034-35413056 GTGTGAGAAAAGAGGGAATGGGG + Intergenic
1118019656 14:61696961-61696983 GTGTGTGTGTTGGGGGATGGGGG - Intronic
1118130303 14:62955709-62955731 GTGACTGAGTGGAGGGAAAGAGG - Intronic
1118235943 14:64005063-64005085 GTGTTTGAGGAAAGGCAAGGAGG + Intronic
1118295675 14:64566706-64566728 ATGTGTGTGCAGAGGGAATGGGG - Intronic
1118693684 14:68363759-68363781 GTGTGTGGGTGCAGTGAAGGTGG + Intronic
1118892638 14:69922767-69922789 GTGTGTGTGTAGGGAAAAGGAGG + Intronic
1119217035 14:72876926-72876948 GGGAGTGGGGAGAGGGAAGGAGG - Intronic
1119483834 14:74975729-74975751 GTGTATGTGTGGTGGGAAGGAGG - Intergenic
1119557789 14:75566908-75566930 GGGGCTGAGCAGAGGGAAGGAGG + Intergenic
1120262904 14:82210514-82210536 GTGTGTGTGTAGAGAGAGAGAGG - Intergenic
1120271171 14:82315107-82315129 GACTGTGAGTATAGGTAAGGAGG + Intergenic
1120370806 14:83632487-83632509 GTGTGTGTGTAGGGAGAGGGTGG + Intergenic
1120731095 14:88002373-88002395 GTGTGGCAGTAGTGGGAAGTGGG - Intergenic
1120928176 14:89819333-89819355 TTATCTGAGAAGAGGGAAGGGGG + Intronic
1121113952 14:91330853-91330875 GTGTGTGGGCTAAGGGAAGGCGG + Intronic
1121172254 14:91864322-91864344 GTAGGGGAGTAGGGGGAAGGAGG + Intronic
1121321695 14:92995266-92995288 GTGGGTGAGCAGAGGGCAGGGGG - Intronic
1121729080 14:96173864-96173886 CTCTGTGAGGAGAGGGCAGGTGG + Intergenic
1121733532 14:96202738-96202760 GTGTGTGGGTGGATGGATGGAGG + Intergenic
1122210175 14:100168395-100168417 GTGTGTGTGTTGAGGGTTGGGGG - Intergenic
1122210200 14:100168491-100168513 GTGTGTGTGTTGAGGGTTGGGGG - Intergenic
1122440196 14:101726613-101726635 GGGTGTGAGTTGGGGGAGGGAGG - Intergenic
1122748647 14:103916799-103916821 GTGAGTGGGTGGAGGGAGGGAGG - Intronic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1122879470 14:104683603-104683625 GTGTGTGTGTGGTGGGGAGGGGG - Intergenic
1123432647 15:20231685-20231707 GTGTGTGTGTAGAGAGAGAGGGG - Intergenic
1124496376 15:30190072-30190094 GTGTCTGAGTAGCAGGAAGTGGG - Intergenic
1124747199 15:32348576-32348598 GTGTCTGAGTAGCAGGAAGTGGG + Intergenic
1125035029 15:35113374-35113396 GTGTGTGTGTAGGAGGGAGGTGG + Intergenic
1125114392 15:36072352-36072374 GCATGTGTGTAGGGGGAAGGTGG - Intergenic
1125382289 15:39099643-39099665 ATGTGTTAGGAGAGGGAAAGTGG - Intergenic
1125485321 15:40107566-40107588 GTGTGTGTGTATGGGGAGGGGGG + Intronic
1125680758 15:41528811-41528833 TTTTGTGAGCAGAGGGAAGCTGG + Intronic
1125910395 15:43432753-43432775 GTGTGTGTGTAGTGGCAAGGGGG + Intronic
1126202065 15:45997781-45997803 TTGTGTGTGGAGAGGGATGGGGG - Intergenic
1126257761 15:46647947-46647969 GTGTGTGAGTGGGTGGGAGGTGG + Intergenic
1126282401 15:46970019-46970041 GTGTGTGTGTTGGGGGAGGGAGG - Intergenic
1126319317 15:47405208-47405230 GTGTGTTAGTAGCAGGGAGGAGG + Intronic
1126367485 15:47910802-47910824 ATGAGAGAGTAGAGGGGAGGAGG - Intergenic
1126506824 15:49414392-49414414 GTGTGTGGGGGGAGGGAGGGGGG + Intronic
1126568860 15:50128529-50128551 CTGTGACAGTAGAGGGAAGTGGG - Intronic
1126759947 15:51960888-51960910 GAGTGTGGGGAGAGGGAAGGGGG + Intronic
1126801162 15:52297757-52297779 ATGTGTGAATAGAGGTAAGGAGG + Intergenic
1126825395 15:52543149-52543171 GTGAGTGACTAGAGGTCAGGTGG - Intergenic
1126892745 15:53223563-53223585 GTGTGTGAGTAGAGGACAATAGG + Intergenic
1128419039 15:67474096-67474118 GTGTGTGTGGAGAGGGAGAGAGG + Intronic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1129747368 15:78033253-78033275 GTGTGTGCGTATAAGTAAGGTGG - Intronic
1130071914 15:80654668-80654690 GTGCTAGGGTAGAGGGAAGGAGG - Intergenic
1130261433 15:82356983-82357005 GTGTGTGATTGTGGGGAAGGAGG + Intergenic
1130279803 15:82512028-82512050 GTGTGTGATTGTGGGGAAGGAGG - Intergenic
1130471177 15:84228214-84228236 GTGTGTGATTGTGGGGAAGGAGG - Intergenic
1130478671 15:84342784-84342806 GTGTGTGATTGTGGGGAAGGAGG - Intergenic
1130493099 15:84445347-84445369 GTGTGTGATTGTGGGGAAGGAGG + Intergenic
1130593471 15:85232851-85232873 GTGTGTGATTGTGGGGAAGGAGG - Intergenic
1130613595 15:85382486-85382508 GTGTGTGATTGTGGGGAAGGAGG + Intronic
1130933621 15:88450282-88450304 GTGTGAGGGAAGAGGGAACGTGG + Intergenic
1131433182 15:92402758-92402780 GTGTGAGAGGAGAGGAAATGTGG - Intronic
1131518839 15:93098373-93098395 GTGTGTGAGTGTGGGGAAGGAGG + Intergenic
1131573837 15:93566655-93566677 GTGTGTGTGTTGGGGGACGGAGG - Intergenic
1131783066 15:95881090-95881112 GTGTGTGCGTGGAGTGGAGGGGG + Intergenic
1132078526 15:98844634-98844656 GTGTGTATTTAGAGAGAAGGAGG + Intronic
1132644795 16:993924-993946 GTGGGTGAGTGGATGGATGGGGG - Intergenic
1132664770 16:1076331-1076353 GGGTGGGAGAAGAGGGGAGGTGG - Intergenic
1132794568 16:1713022-1713044 GTGTGTGGATAAAGGGAAGCCGG + Intronic
1133029025 16:3000956-3000978 GTGAGTGAGAAGAGGCCAGGAGG + Intergenic
1133327308 16:4949524-4949546 GTGTTTGAGTATTGGGGAGGCGG - Intronic
1133732117 16:8586900-8586922 GTGTGGGAGTTGAGGAAAGGTGG - Intronic
1134090852 16:11390986-11391008 GAGTGTCAGCACAGGGAAGGGGG - Intronic
1134444078 16:14317595-14317617 GTGTGTGTGTAGGGAGAGGGTGG + Intergenic
1134523274 16:14927992-14928014 GGGGGAGAGGAGAGGGAAGGGGG - Intronic
1134523281 16:14928010-14928032 GGGGGAGAGGAGAGGGAAGGGGG - Intronic
1134523288 16:14928028-14928050 GGGGGAGAGGAGAGGGAAGGGGG - Intronic
1134782415 16:16910184-16910206 GTGGGTGAGTGGATGGAGGGAGG + Intergenic
1134804730 16:17114546-17114568 GTGTGAGAGCAGAGGAAAAGTGG + Intronic
1134998826 16:18759803-18759825 GTGGGTGAGTGGAGAGTAGGTGG + Intergenic
1135293962 16:21263508-21263530 GGGGGTGAGGAGAGGGAAAGGGG - Intronic
1135294764 16:21269749-21269771 GTGGGAGAGAAGAGGGAAGGGGG - Intronic
1136851981 16:33619411-33619433 GTGTGTGTGTAGAGAGAGAGGGG + Intergenic
1137731328 16:50692946-50692968 GTGTGTGAGTGTTGGGAAGCAGG + Intergenic
1137936531 16:52640229-52640251 GTCTGTGAGAAGAAGGAAGAGGG + Intergenic
1138484107 16:57325052-57325074 ATGTGAGAGAAAAGGGAAGGAGG + Intergenic
1140199501 16:72883044-72883066 GTGTGTGTGTAGCGGGTAGTGGG + Intronic
1141181193 16:81754290-81754312 GTGGGGGAGGCGAGGGAAGGAGG - Intronic
1141601154 16:85127157-85127179 GTGTGTGGGTGGGTGGAAGGGGG - Intergenic
1141622838 16:85246422-85246444 GTGTGTGTGTAGAGAGCATGGGG - Intergenic
1141776614 16:86127374-86127396 GTGTTGGCGGAGAGGGAAGGGGG + Intergenic
1141840940 16:86573664-86573686 GGGTGTGTGAAGAGGGAAGGGGG + Intergenic
1142124153 16:88401888-88401910 GTGGGTGAGTGGATGGATGGAGG + Intergenic
1142152351 16:88518250-88518272 GTGGGTGAGTAGATGGATGGTGG + Intronic
1142478624 17:204589-204611 GTGAGTGAGGAGATGGATGGAGG - Intergenic
1142603588 17:1069789-1069811 GTGTGTGAGTCCAGGGGCGGGGG - Intronic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1143193091 17:5054889-5054911 GTGTGTGACTGGAGGGAGGTAGG + Intergenic
1143252297 17:5532716-5532738 GAGTGTGAGTTGGGGGTAGGGGG + Intronic
1143365453 17:6405622-6405644 GCTTGTGGGCAGAGGGAAGGAGG - Intronic
1143479435 17:7220051-7220073 GTGTGTGACAAGAGGGACGGTGG + Intronic
1143714652 17:8758216-8758238 TTGACTGAGGAGAGGGAAGGGGG - Intronic
1144391211 17:14795234-14795256 GTGTGTGAGAACATGGAAGGAGG + Intergenic
1144456881 17:15426099-15426121 GTGTGTGTGTTGGGGGTAGGGGG - Intergenic
1145851664 17:28104934-28104956 GTGTGGGAGTTTGGGGAAGGTGG - Intronic
1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG + Intronic
1146460680 17:33043833-33043855 GTGTGTGATTCCAGGGCAGGAGG - Intronic
1146691863 17:34882399-34882421 GGGTGAGGGCAGAGGGAAGGGGG - Intergenic
1146710998 17:35041282-35041304 GTGTGTGTGTTGAGGGGAGGAGG - Intronic
1146799896 17:35809851-35809873 GTGTGTGAGTCGGGGGGCGGAGG + Intronic
1146954798 17:36931297-36931319 GTGTGTGAGAGGCAGGAAGGTGG - Intergenic
1147034653 17:37671081-37671103 GAGTGTGAGTAGGGGGTGGGTGG - Intergenic
1147163369 17:38580265-38580287 GTGTGTGTGTTGGGGGCAGGTGG - Intronic
1147314234 17:39611970-39611992 GAGTGTGTGTGGAGGGGAGGTGG + Intergenic
1147609734 17:41794314-41794336 GTGTGTGAGCTGGGGGAAAGGGG + Intergenic
1147977343 17:44255355-44255377 GTGGGTGAATATAGGGCAGGAGG - Intronic
1148688400 17:49513279-49513301 GTGTGGGAGAAGGGGGCAGGTGG - Exonic
1149117991 17:53122198-53122220 ATGTGTGTGTAGAGGGGTGGGGG + Intergenic
1149345355 17:55728796-55728818 GTGTGTGTGTAGGGGGTAGGGGG + Intronic
1149458340 17:56807635-56807657 GTTTGTGTTTAGAGGGAAGAAGG - Intronic
1150711919 17:67538284-67538306 TTGTGTGTGTAGTGTGAAGGAGG - Intronic
1150982404 17:70157222-70157244 GTGTGTGGATAGCAGGAAGGAGG + Intergenic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151208931 17:72529285-72529307 GTGTGTGTGTAGGGGGGTGGGGG - Intergenic
1151293252 17:73165330-73165352 GTGTGTGATAAGAGAGATGGAGG + Intronic
1151384514 17:73746984-73747006 GTGTGTGCGTAGTGGGAACTTGG + Intergenic
1151661739 17:75522522-75522544 GTGAGTCAGGAGAGGTAAGGAGG + Intronic
1151784068 17:76266401-76266423 GTGTGTGTGGAGGGGGAGGGGGG - Intronic
1151788407 17:76287984-76288006 TTGGGTTAGTAGAGGGAACGGGG - Intronic
1151896448 17:76983730-76983752 GTGTCTGACTAGAGGCAACGTGG + Intergenic
1152077733 17:78169264-78169286 GTGTGTGTGTGGCGGGGAGGGGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1152421208 17:80194138-80194160 GTGTGTGTGTTGGGGGCAGGGGG - Intronic
1152436825 17:80281419-80281441 GTGTGTGAGTGGTGTGAATGGGG - Intronic
1152442923 17:80320175-80320197 GTGGGTGACTAGAGGGGAGGAGG - Intronic
1152655248 17:81516438-81516460 GTGTGGGAGAAGAGGGAGGTGGG - Intronic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1153051761 18:907495-907517 GGGTGGGAGCAGAGGTAAGGAGG - Intronic
1153289157 18:3483335-3483357 GTGCGTGTGTACATGGAAGGAGG + Intergenic
1153328168 18:3843120-3843142 GTGTGTGTATATAGGGAAGGTGG + Intronic
1153456059 18:5283019-5283041 GTGTGAGAGGAGAGGAAATGTGG + Intergenic
1153953921 18:10080247-10080269 GTGTGTGTGTACAGGGTAGTGGG + Intergenic
1154115632 18:11610582-11610604 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1154120079 18:11644797-11644819 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1154245735 18:12695839-12695861 GTGTGTGTGGAGAAGGAATGAGG - Intronic
1154433176 18:14324008-14324030 GGGTGGGGTTAGAGGGAAGGGGG + Intergenic
1154484868 18:14865515-14865537 GTTTTTGGGTAGATGGAAGGGGG - Intergenic
1156111419 18:33731847-33731869 ATGTGTGAGGAGGAGGAAGGGGG - Intronic
1156202751 18:34852881-34852903 GTGTGTGTGTTGGGGGCAGGAGG + Intronic
1156310018 18:35913231-35913253 GTGTGTGTGTGGTGGGATGGGGG - Intergenic
1157198685 18:45640951-45640973 CTGGGTGAGAAGAGGCAAGGAGG - Intronic
1157469358 18:47976701-47976723 GTGTGTGTGTGGAGGGGCGGGGG + Intergenic
1157515310 18:48306995-48307017 GTGGGAGAGTGGAGGGAAGGTGG - Intronic
1157700659 18:49759926-49759948 GTGTGTGTGTAGGGGGTGGGGGG + Intergenic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1158067775 18:53433767-53433789 GTGTGTGTACAGGGGGAAGGTGG - Intronic
1158395924 18:57078316-57078338 GTGTGTGTGTACAGGGAGGGAGG - Intergenic
1159532388 18:69670966-69670988 GTGTGTGTGTTGGGGGAGGGAGG - Intronic
1159648413 18:70947682-70947704 ATTTGAGAGTAGAGGGTAGGAGG + Intergenic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1160514860 18:79472638-79472660 GTGTGTGGGGTGAGGGGAGGGGG - Intronic
1160901018 19:1428772-1428794 GGGTGTGTCTAAAGGGAAGGGGG + Intronic
1161347731 19:3776547-3776569 ATGTGTGAGTGGATGGTAGGTGG + Intergenic
1161846884 19:6716799-6716821 GAGTGTGTGTAGCGGGGAGGGGG + Intronic
1161873279 19:6887092-6887114 GTTGGTGAATAGAGGGAGGGAGG + Intergenic
1161974472 19:7600555-7600577 GTGTGTGGGTGGATGGATGGGGG - Intronic
1162765013 19:12913911-12913933 ATGTGCGAGGAGAGGGAAGCTGG + Intronic
1162854789 19:13460050-13460072 GCGGGTGAGCAGAGGGAGGGGGG - Intronic
1163371453 19:16903491-16903513 CTGTGTGATTGGAGGGAATGGGG + Intronic
1163676927 19:18660021-18660043 GTGTGTCAGTAGTGAGCAGGTGG + Intronic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1164935524 19:32207538-32207560 ATTTGTGGGTAGAAGGAAGGCGG + Intergenic
1165144298 19:33721642-33721664 GTGGGTGGGTAGATGGATGGAGG + Intronic
1165808767 19:38597604-38597626 GTGTGTATGTAGGGGGAAGCAGG + Intronic
1165813964 19:38629824-38629846 GTGAGTGAGTAGCGAGTAGGTGG + Intronic
1165823785 19:38693933-38693955 GGGTGTGAGTGCGGGGAAGGGGG - Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1165981519 19:39728354-39728376 GTGTGTGAGTGAATGTAAGGGGG - Intergenic
1166197093 19:41214245-41214267 GGGCAGGAGTAGAGGGAAGGTGG - Intergenic
1166224078 19:41384099-41384121 GTGTGTGGGAGGATGGAAGGGGG + Intronic
1166670245 19:44705544-44705566 ATGGGGCAGTAGAGGGAAGGAGG - Intronic
1167037121 19:47001133-47001155 GGGTGTGTGCAGATGGAAGGTGG - Exonic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167284775 19:48592850-48592872 GGGTGTGAGCAGAGGGTATGGGG - Intronic
1167608850 19:50496565-50496587 GTGTGTGAGGAGAGGCGAGGAGG + Intergenic
1168319291 19:55499726-55499748 GTGAGTGACTGGAGAGAAGGAGG + Intronic
1168323978 19:55528834-55528856 GTCTGTCAGCAGACGGAAGGCGG + Intergenic
925055187 2:851804-851826 GTGTGTGTGTAGGGGCAAGGGGG + Intergenic
925059192 2:878163-878185 GTGTGTGTGTAGGGGTGAGGGGG - Intergenic
925059205 2:878209-878231 GTGTGTGTGTAGGGGTGAGGGGG - Intergenic
925059269 2:878574-878596 GTGTGTGTGTAGGGGCAAGAGGG - Intergenic
925188697 2:1866401-1866423 GTGGGGGAGGAGAGAGAAGGAGG + Intronic
925238557 2:2300689-2300711 GTGTGGGAGGAGAGGGGAAGTGG + Intronic
925291212 2:2749808-2749830 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925291246 2:2749933-2749955 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925462681 2:4077313-4077335 GTGGGTGATAAGAGGGGAGGTGG - Intergenic
925713005 2:6759694-6759716 GTGTGTGAGCTGAGAGTAGGGGG + Intergenic
925783244 2:7403221-7403243 GTATGTGCGCAGGGGGAAGGTGG - Intergenic
926637923 2:15203920-15203942 GTGTGTGAGTGGGGAGGAGGAGG + Intronic
927089764 2:19701330-19701352 GTGTGTGAGAAAGGGGAAAGTGG - Intergenic
927275525 2:21259268-21259290 GTGTGTGTGTGTCGGGAAGGGGG + Intergenic
927291833 2:21412357-21412379 GTGTGTGTGTGGAGGGGGGGTGG - Intergenic
927489528 2:23511556-23511578 GTGTGTGAGGACAGGGAGGCTGG + Intronic
927595330 2:24391807-24391829 GAGTATGAAGAGAGGGAAGGAGG - Intergenic
928087515 2:28355290-28355312 GGGTGTGGGCAGAGGGAATGGGG - Intergenic
928099950 2:28431160-28431182 GTGTGAGAGGAGAGGACAGGAGG - Intergenic
928427187 2:31189077-31189099 GTTTGTGAGTGGAAGGAGGGTGG + Intronic
928504943 2:31941223-31941245 GTGTTTGAGGAGAAGCAAGGAGG - Intronic
929056337 2:37880113-37880135 GTGTGGGAGTAGAGGTGAGAAGG - Intergenic
929512693 2:42577271-42577293 GTGTGTTTGTAGAGGGGAAGAGG + Intronic
929723015 2:44390519-44390541 GTGTGTGTGTGGGGGGGAGGTGG + Intronic
930343368 2:50146107-50146129 GTGTATGAGAGGAGAGAAGGCGG + Intronic
930361867 2:50390746-50390768 ATGTGTGTGTTGAGGGGAGGTGG - Intronic
930739104 2:54811146-54811168 GGGTGTTAGGAGAGGCAAGGTGG - Intronic
931183791 2:59930152-59930174 GTCTGTGAGTAGGGGTGAGGGGG + Intergenic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932120816 2:69098074-69098096 GTGTGGGAGTGGAGGTAGGGAGG + Intronic
932363643 2:71131020-71131042 GTCTGTGTGTAGAGGGATGGGGG - Intronic
932429231 2:71664084-71664106 GTGTGTGTGTAGGGGGAAGGGGG - Intronic
932638864 2:73421014-73421036 GTGTGTGTGTGATGGGAAGGTGG - Intronic
932641358 2:73450515-73450537 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
932641388 2:73450800-73450822 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
932771712 2:74504070-74504092 GAGAGTGAGTACAGCGAAGGCGG - Intergenic
932801896 2:74748250-74748272 GTGTGTGTCTAGAGGGATGGGGG - Intergenic
933150682 2:78911308-78911330 GTGTGTGTGATGGGGGAAGGGGG - Intergenic
933608268 2:84407052-84407074 GTGTGTGTGTTGGGGGAGGGGGG - Intergenic
933762790 2:85684737-85684759 GTGTGTGTGTAGTGGAATGGGGG + Intergenic
934897211 2:98129251-98129273 GTGTGTGTGGAGAGAGAGGGAGG + Intronic
935716742 2:105945925-105945947 GTGTGGGTGTAGGGGGATGGTGG + Intergenic
936789601 2:116135388-116135410 GTGTGTGGGCAGAGGGAGCGAGG + Intergenic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937207730 2:120247144-120247166 GTCTGCGGGAAGAGGGAAGGGGG + Intronic
937855131 2:126666698-126666720 GTGTGTGTGTGTAGGGAGGGAGG - Intronic
937862827 2:126724398-126724420 GTGTGTTTGTGGAGGAAAGGAGG - Intergenic
938090359 2:128427327-128427349 GTGTGTGTGTGAAGGGTAGGAGG + Intergenic
938241199 2:129743535-129743557 GTGTGTGTGTAGGGGGAGTGGGG - Intergenic
938468906 2:131542591-131542613 GTGTTTGGGTAGATGGAGGGGGG - Intergenic
938841941 2:135172802-135172824 GTGTGTGAGTTGGAGGCAGGAGG - Intronic
938905126 2:135829847-135829869 GTGTGTGTGTAGGGGGCGGGGGG + Intronic
939095135 2:137825603-137825625 TTGAGTGAGTAGTGGGAAAGGGG + Intergenic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939270668 2:139935349-139935371 GTCTGTGAGGAGAGGAAAGAGGG - Intergenic
939417761 2:141923478-141923500 GTGTGTGTGTAGAGAGAGGGAGG + Intronic
939571788 2:143848498-143848520 GAGTGAGAAAAGAGGGAAGGAGG - Intergenic
940000588 2:148963198-148963220 GTGTGTGTGTAGGGGAATGGCGG + Intronic
940005946 2:149009826-149009848 GGGTGTGTGTAGAGGAAAGGGGG - Intronic
941574399 2:167212900-167212922 GTGTGTGTGCAGAGGGGTGGGGG - Intronic
941809207 2:169738935-169738957 GAGGGGGAGGAGAGGGAAGGAGG - Intronic
941860317 2:170272503-170272525 GTGGGTGAGTAAACTGAAGGAGG - Intronic
942218288 2:173744293-173744315 GGCAGTGAGTAGAGGGACGGAGG - Intergenic
942264724 2:174211168-174211190 GTGTGTGTGTTGTGGGGAGGAGG - Intronic
942285522 2:174412290-174412312 TTGTCTGAGGAGAGGGAAGGTGG + Intronic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
943731994 2:191311840-191311862 GAATGTGGGTATAGGGAAGGAGG + Intronic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
944426722 2:199591171-199591193 GTGTGTGGGTGGAGGGAGGTTGG - Intergenic
944453386 2:199867478-199867500 ATTTGGGAGTAGAGGGGAGGTGG - Intergenic
944650889 2:201829242-201829264 CTGTGTGAGTAGGGGGAGAGAGG - Intronic
945078796 2:206067708-206067730 GTGGGTGAGTAGAGAAAAGATGG - Intronic
945193563 2:207216108-207216130 GTGTGTGAAGAAAGGGAAGCAGG + Intergenic
945592925 2:211756103-211756125 GTGTGTGGGTTCAGGGAGGGGGG + Intronic
946088134 2:217195163-217195185 GTGTGTGTGTAGGGGGTGGGGGG - Intergenic
946092623 2:217243497-217243519 GTGTGTGTGTTGGGGAAAGGGGG - Intergenic
946356441 2:219188538-219188560 GTGTGTGTGTAGAGCAGAGGTGG - Intergenic
946611181 2:221459538-221459560 GTGTGTGTGTTGGGAGAAGGGGG - Intronic
946976614 2:225160039-225160061 GTGTGTGTGTGGAGGGGTGGGGG - Intergenic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
948186363 2:236024473-236024495 GGGTGCGAGGGGAGGGAAGGAGG - Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948309721 2:236975953-236975975 GAGAGTGAGGAGAGGGAAAGCGG - Intergenic
948870285 2:240794422-240794444 GTGTGTGGGTAAAGGGCAGATGG - Intronic
1170100659 20:12695975-12695997 GTGTGTGGCAAGAGGGAGGGAGG - Intergenic
1170161657 20:13319729-13319751 GTGTGTGTGCAGGGGGGAGGGGG - Intergenic
1170405605 20:16032668-16032690 ATGGATGAGAAGAGGGAAGGAGG + Intronic
1170525084 20:17228481-17228503 GTGTGGGTGCAGAGAGAAGGTGG + Intronic
1170566858 20:17612468-17612490 GTGTGTGAGGTGAGGGAGGCTGG - Intergenic
1170639469 20:18138565-18138587 GAGAGTGAGTACGGGGAAGGGGG - Intronic
1170740389 20:19050896-19050918 TGGTGTGATTAGAGAGAAGGGGG - Intergenic
1170747231 20:19111073-19111095 GTGTGTGGGGAGGGGGGAGGGGG + Intergenic
1170914352 20:20608237-20608259 GTGTGTTGGTAGAGTGAAGTAGG - Intronic
1171232396 20:23498023-23498045 GTGTGTGTGTAGAGAGAGAGAGG + Intergenic
1171342996 20:24445179-24445201 GTGGGTAGGAAGAGGGAAGGGGG - Intergenic
1172099554 20:32476965-32476987 GGGTTTGAGGAGAGGCAAGGAGG + Intronic
1172461227 20:35120420-35120442 GCCTGTGAGGAGAGGGGAGGAGG - Intronic
1172590438 20:36113800-36113822 GTATGTGCGCATAGGGAAGGTGG + Intronic
1172744225 20:37194203-37194225 CTGTGTGGGAAGAGAGAAGGTGG + Intronic
1172946105 20:38690678-38690700 GTGTGTGTGTTGGGGGGAGGGGG + Intergenic
1173134089 20:40423942-40423964 ATGTGTGTGCAGAGGGGAGGAGG - Intergenic
1173354013 20:42270208-42270230 GTGTATGCATAGAGGGATGGAGG + Intronic
1173355398 20:42282888-42282910 ATGAGTGAGCAGATGGAAGGAGG + Intronic
1173502974 20:43566885-43566907 GTGGGTGGGTAGAAGGAGGGAGG + Intronic
1173547850 20:43913390-43913412 GTGTGTGTGTAGGGGGGTGGTGG + Intergenic
1173839765 20:46149825-46149847 GTGTGTGAGCAGAGGTTTGGGGG - Intergenic
1174210489 20:48874411-48874433 GTGTGTGTGTAGGGGGTGGGTGG + Intergenic
1174353439 20:49983504-49983526 GTGTGTGAGGAGGGGGATTGGGG + Intronic
1174829516 20:53799776-53799798 GTGTGTGTGTTGGGGGAGGGAGG - Intergenic
1175515604 20:59568100-59568122 GTGTGTGTGTAGAGTGGGGGTGG + Intergenic
1175711629 20:61225923-61225945 GTGTCGGAGGAGAGGGAGGGAGG + Intergenic
1175766168 20:61594255-61594277 GTGGGGGGGAAGAGGGAAGGGGG + Intronic
1175817855 20:61892986-61893008 ATGGGTGAGTAGAGGGATGGTGG + Intronic
1175817876 20:61893069-61893091 ATGGGTGAGTAGAGGGATGCTGG + Intronic
1175817896 20:61893148-61893170 GTGGGTGAATAGAGGGATGGTGG + Intronic
1175817938 20:61893306-61893328 GTGGGTGAATAGAGTGATGGTGG + Intronic
1175817959 20:61893385-61893407 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175817978 20:61893468-61893490 GCGGATGAGTAGAGGGATGGTGG + Intronic
1175818037 20:61893706-61893728 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818051 20:61893757-61893779 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818064 20:61893804-61893826 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175934626 20:62509265-62509287 GTGGAGGAGTAGAGGGATGGAGG - Intergenic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176723625 21:10412868-10412890 GTTTTTGGGTAGATGGAAGGGGG - Intergenic
1176796460 21:13373960-13373982 GTTTTTGGGTAGATGGAAGGGGG + Intergenic
1177688019 21:24465483-24465505 GAGTGTGTGAAGAGCGAAGGGGG - Intergenic
1178059261 21:28834362-28834384 GAGTGTGAGTTCAGGAAAGGAGG - Intergenic
1178623643 21:34197987-34198009 GTGTGTGTGTTGAGAGGAGGAGG + Intergenic
1178897216 21:36568760-36568782 GTCTGTGAGAAGAGGAAAGAGGG - Intronic
1179786544 21:43733537-43733559 GTGTGTGAGGACAGAGAGGGAGG - Intronic
1180053151 21:45342835-45342857 GTGTGTGTGTTGCGGGTAGGGGG + Intergenic
1180085974 21:45508084-45508106 GTGGGTGAGTGGATGGATGGTGG + Intronic
1180304781 22:11065643-11065665 GTTTTTGGGTAGATGGAAGGGGG - Intergenic
1180871205 22:19148333-19148355 GTGTGGGAGTGGAGCCAAGGTGG + Intergenic
1181063201 22:20291832-20291854 GTGTGTGTGAAGAGGGAGGCAGG - Intergenic
1181527877 22:23500483-23500505 GTGGGGGAGGAGAAGGAAGGTGG + Intergenic
1181901551 22:26160323-26160345 GAGAGGAAGTAGAGGGAAGGAGG + Intergenic
1181982986 22:26779356-26779378 GCCTGTGATTAGAGGGCAGGGGG + Intergenic
1182658284 22:31906786-31906808 GTGTCTGGGAAGAGGGCAGGCGG + Exonic
1182850131 22:33466681-33466703 GTGTGTGTGTAGAGAGAGAGAGG - Intronic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1183110282 22:35643777-35643799 GTGTGTGTGTTGAGGGGATGGGG - Intergenic
1183131479 22:35840648-35840670 GTGTGTGTGTAGGGGGGAGGAGG + Intronic
1183339790 22:37273886-37273908 GTTTCTGAGTAGAGAGGAGGAGG - Intergenic
1183700890 22:39450379-39450401 GGATGAGAGTAGAGGGGAGGAGG + Intergenic
1184096356 22:42318412-42318434 CTGTGAGAGGAGAGGGGAGGAGG + Intronic
1184117805 22:42432200-42432222 GCGAGAGAGTAGAGAGAAGGAGG + Intronic
1184334252 22:43844134-43844156 GTGTGAGAGCAGAGGAAAAGCGG + Intronic
1184449405 22:44574207-44574229 GTTTCTAAGGAGAGGGAAGGAGG - Intergenic
1184755170 22:46511766-46511788 GAGGGTGAGATGAGGGAAGGAGG + Intronic
1184781423 22:46651572-46651594 GTGTGTGAGCAGAGTCCAGGTGG - Intronic
1184864835 22:47196305-47196327 GTGTCTGGGTGGAAGGAAGGAGG + Intergenic
1184885908 22:47344387-47344409 GTCTGTGAGGACAGGGATGGTGG - Intergenic
1185108619 22:48888193-48888215 GTGGGTGAGTGGATGGATGGAGG - Intergenic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
950023804 3:9807118-9807140 GTGTGTGAAAGGAGGGGAGGTGG + Intronic
950119395 3:10471559-10471581 GAGTGGGAGGAGAGGGAGGGAGG + Intronic
951078700 3:18425803-18425825 GTGTGTGAGTGGGAGGGAGGAGG + Intronic
951216371 3:20029339-20029361 GTGTGTGAGTTGTGAGATGGGGG - Intergenic
951240056 3:20276472-20276494 ATGTGTGAGATGATGGAAGGGGG + Intergenic
951318558 3:21217064-21217086 GTGGGGGCGTAGAGGAAAGGGGG + Intergenic
951360123 3:21715226-21715248 GGGTGAGAGGAGAGGGAATGAGG - Intronic
952075654 3:29694145-29694167 GTTTGTGTGTTGAGGGAAGGGGG + Intronic
952297415 3:32073527-32073549 GTGAGTGAGTTTAGGGAAGTAGG - Intronic
952588589 3:34923575-34923597 GAGTGTCAGTTGAAGGAAGGTGG + Intergenic
953337988 3:42110309-42110331 GTGTGTGTGTTGAGGGGTGGGGG + Intronic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
953748861 3:45594766-45594788 GTGTGTGTGTTGAGGGCAGCGGG - Intronic
954397112 3:50298772-50298794 GTGTGGGAGGTGAGGGGAGGGGG - Intronic
955762573 3:62303633-62303655 GAGTGTGAGTTGAAGAAAGGAGG - Intergenic
956125310 3:66005521-66005543 GTGGGTGAGGAGAGGCAAAGAGG - Intronic
956219332 3:66884809-66884831 GAGAGTGGGGAGAGGGAAGGAGG + Intergenic
956638443 3:71390565-71390587 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
956779953 3:72595967-72595989 CTGTGGGAGTCGAGGGATGGAGG - Intergenic
959317847 3:104831824-104831846 GTTTGGGAATAGAGTGAAGGTGG + Intergenic
959717986 3:109454440-109454462 GGGTGTGTGTAGGGGGAAGTGGG + Intergenic
959781119 3:110234295-110234317 GGGGGTGGGTGGAGGGAAGGGGG + Intergenic
960402854 3:117225005-117225027 GTGTGTGTGTATGTGGAAGGAGG - Intergenic
960692662 3:120363183-120363205 GTGTGTGTGTGGTGGGGAGGAGG + Intergenic
960939407 3:122923580-122923602 GTGTGTGAAGACAGGGAAAGAGG + Intronic
961141843 3:124562727-124562749 GTGTGAGAGCAGAGGTAAGGAGG - Intronic
961484112 3:127205507-127205529 GGGTGTGAGTGGAGGTGAGGTGG - Intergenic
961514554 3:127424603-127424625 GTGTGTGAACAGAGAGAGGGAGG - Intergenic
961588931 3:127960327-127960349 GTGTGTGCGTAGTGGAAAGGGGG - Intronic
961603723 3:128078501-128078523 GTGGCTGAGGAGAGGGAGGGAGG - Intronic
961649884 3:128412036-128412058 GTGTGGGAGTGGGGTGAAGGAGG + Intergenic
961659920 3:128463258-128463280 GGGTGAGAGGAGAGGGAACGTGG + Exonic
962060800 3:131925222-131925244 GTGTGTGTGTAGAGTGCAAGGGG - Intronic
962174214 3:133135850-133135872 GTTTGGGAGTGGAGGGAGGGTGG + Intronic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203077 3:133415850-133415872 GAGGGTGAGTAGAGGGGAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962242906 3:133766434-133766456 GTGAGTGAATATTGGGAAGGAGG + Intronic
962613554 3:137102285-137102307 TTGTGGGAGATGAGGGAAGGAGG - Intergenic
962776660 3:138667422-138667444 GTGTGTGTGTTGTGGGGAGGAGG + Intronic
962920942 3:139949940-139949962 ATGTGTGTGTAGAGGCAAGAAGG + Intronic
963263777 3:143218892-143218914 GTGTGTGTGTAGAGAGAGAGAGG + Intergenic
964276151 3:155010950-155010972 GTGTGTAAGCAGATGGAAGGAGG - Intergenic
964586497 3:158311564-158311586 GTATGTGTGTAGAGGAAAAGGGG - Intronic
965065696 3:163845477-163845499 GTGTGTGAGAAAAAGCAAGGTGG - Intergenic
966224379 3:177582275-177582297 GTGTGTGAGTTGGGGGAACCTGG + Intergenic
967006755 3:185391223-185391245 GTGTGTGGGGAGGGGGAATGGGG - Intronic
967195520 3:187022305-187022327 GTGTGAGAGCAGAGGAAAGATGG + Intronic
967276470 3:187780330-187780352 GTGTGTGTGTAGGGGGCAGAAGG - Intergenic
967947897 3:194818587-194818609 GTGGGTGAGGAGAGGGGAGAGGG - Intergenic
968764277 4:2459917-2459939 GTGTTGAAGCAGAGGGAAGGTGG + Intronic
968978661 4:3835056-3835078 GAGAGAGAGAAGAGGGAAGGAGG + Intergenic
969548453 4:7848065-7848087 GTGAGTGGGTGGACGGAAGGAGG + Intronic
970143053 4:13003509-13003531 GTGTGTGTGTGGGGGGAGGGGGG + Intergenic
970652432 4:18193497-18193519 GTGTGTGTGTATTGGGTAGGGGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
971447591 4:26767544-26767566 GTGTGTGAGAAGAGTGAGAGGGG - Intergenic
972446355 4:39148044-39148066 GTGTGTGTGTGGAGGGGGGGCGG - Intergenic
972661544 4:41121580-41121602 GTGGCAGAGTAGAGGGCAGGTGG - Intronic
973663263 4:53130581-53130603 GTGTGTGTGTAGAGGGAGAGGGG - Intronic
974456414 4:62134168-62134190 ACATGTGACTAGAGGGAAGGAGG + Intergenic
975359416 4:73450539-73450561 GTCTGTGAGAAGAAGCAAGGCGG + Intronic
975554196 4:75644291-75644313 GTTTGTGGGGAGAGGGAAGGAGG - Exonic
977397010 4:96484006-96484028 GTCTGTGGAAAGAGGGAAGGAGG - Intergenic
977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG + Intergenic
977826926 4:101543576-101543598 GGGTGTGTGTTGAGGGCAGGGGG + Intronic
978618544 4:110618764-110618786 GCGTGTGTGTCGGGGGAAGGCGG - Intronic
979275047 4:118806052-118806074 GTGTGTGAATATTGAGAAGGAGG - Intronic
979701573 4:123674091-123674113 TGGTGTGAGTGGAGGGGAGGAGG - Intergenic
979986966 4:127327130-127327152 GTGTGTGGGGAGGGGGGAGGGGG + Intergenic
980098080 4:128513691-128513713 ATGTGTGAGTACAGGGAGGGAGG - Intergenic
980320508 4:131266937-131266959 GTTTAGCAGTAGAGGGAAGGTGG - Intergenic
980478002 4:133345059-133345081 ATTTGTATGTAGAGGGAAGGAGG + Intergenic
980825833 4:138071411-138071433 GCGTGTGGGTTGGGGGAAGGGGG + Intergenic
981012372 4:139938571-139938593 TTGTGGGAGTAGAGTGATGGTGG + Intronic
982558289 4:156897445-156897467 GTGTATGTGTAGAGAGAGGGAGG - Intronic
982717447 4:158823879-158823901 GACTGAGAGTAGAGGGAAGATGG + Intronic
982965063 4:161896456-161896478 GTGTGTGTGTATGTGGAAGGGGG - Intronic
983278050 4:165643065-165643087 GGGTGTTAGTAGAGGAAAAGTGG - Intergenic
983506853 4:168562692-168562714 ATGTTTGAAGAGAGGGAAGGAGG + Intronic
983535156 4:168849875-168849897 GGGGGTGAGAAGAGGGAATGGGG - Intronic
984150382 4:176122881-176122903 GTGTGTGTATTGAGGGTAGGAGG + Intronic
984679746 4:182593714-182593736 GTGTGAGATGAGAGGAAAGGAGG - Intronic
985002922 4:185503526-185503548 GTGTGTGAGTTCATGGCAGGAGG + Intronic
985171437 4:187154189-187154211 AAGTGTGAGGAGAGTGAAGGAGG + Intergenic
985184599 4:187302213-187302235 GTGTGAGAGTGTTGGGAAGGGGG - Intergenic
985477728 5:89216-89238 GTGTGTGGACAGAGGGGAGGAGG - Intergenic
985781169 5:1872553-1872575 GTGTGTGTGTAGTGGTAGGGGGG + Intergenic
985968001 5:3352258-3352280 GTGTGTGGGTTGAGGGAGGGGGG + Intergenic
986298747 5:6461842-6461864 GTGTGTGACTGGAGCCAAGGTGG - Intronic
986898795 5:12406008-12406030 GTGTGAGGGTAGGGGGAAGATGG - Intergenic
986929573 5:12801508-12801530 GGGTGTGTGTAAAGGGAGGGGGG - Intergenic
986980943 5:13447589-13447611 GAGTGGGTGTAGGGGGAAGGAGG - Intergenic
987615426 5:20267942-20267964 GAGAGTGGGAAGAGGGAAGGAGG - Intronic
988185901 5:27861612-27861634 GTGTGTGCATGAAGGGAAGGGGG - Intergenic
988963362 5:36391424-36391446 GTGCGTGAGGAGAGGGAAAAAGG + Intergenic
989104149 5:37845271-37845293 GTGTGTGTGTGTATGGAAGGGGG + Intergenic
989242899 5:39220602-39220624 ATGAATGAGTAGAAGGAAGGTGG - Intronic
989697830 5:44224614-44224636 GGTGGTGGGTAGAGGGAAGGTGG + Intergenic
990257410 5:53985219-53985241 GAGTGTGAGCAGAGGGAGTGAGG - Intronic
990563424 5:57005867-57005889 GTGTGTGGTTAGAAGAAAGGAGG + Intergenic
991124876 5:63059193-63059215 GTGTTTGTGTAGGGGGATGGGGG - Intergenic
991385026 5:66077747-66077769 GTGTGTGTGTAGAGGGAGGGAGG - Intronic
991584780 5:68190810-68190832 GTGTGTGGGTGGAGGGTTGGGGG - Intronic
992857814 5:80881255-80881277 GTGTTTGAGCAGAGGGTATGTGG - Intergenic
993462765 5:88204641-88204663 GTGTGTGTGCAGAGAGGAGGGGG + Intronic
993503032 5:88683340-88683362 GTGTGTGTGTAGGGAGAAGTAGG + Intergenic
994611065 5:102040347-102040369 TTGTGTGTATAGAGGGGAGGGGG - Intergenic
995064092 5:107840896-107840918 TTGTCTGAGGAGAGGGAAGGTGG - Intergenic
995314222 5:110749498-110749520 GTGTGGGAGCGGTGGGAAGGGGG + Intronic
995506279 5:112863550-112863572 GTGTGTGGGTAGGGGTAGGGAGG + Intronic
995908844 5:117161013-117161035 GTTTGTGAGTAGAGAAAATGAGG - Intergenic
996004956 5:118408310-118408332 GTGTGTGTGTATGGGGGAGGTGG + Intergenic
996090916 5:119351026-119351048 GTGTGTGTGTAGAGAGAGAGAGG + Intronic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
996887113 5:128370453-128370475 GTGTGTGCTTAAATGGAAGGAGG + Intronic
997782832 5:136677127-136677149 GTGTGAGTGTAGAGGAAAGCAGG - Intergenic
997824675 5:137095979-137096001 GTGGGTGGGCAGGGGGAAGGAGG + Intronic
998187514 5:139993114-139993136 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
998532743 5:142900595-142900617 GTGGGAGAGTAGGGGGAGGGGGG + Intronic
999288281 5:150407093-150407115 GTCTCTGAGTTGAGGGATGGTGG + Intronic
999298791 5:150477469-150477491 GTGTGTGTGTTGGGGGAGGGAGG + Intergenic
999651659 5:153774067-153774089 GTGTGTGTGTGGGGGGAGGGGGG - Intronic
1000143462 5:158429632-158429654 GTGTGTGTGTGTAGGGGAGGAGG - Intergenic
1000227856 5:159285185-159285207 GTGTGTGTGTGGTGGGAGGGTGG - Exonic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000809008 5:165837584-165837606 GTATGTGAGAAGAGGGAGAGAGG + Intergenic
1000824152 5:166023183-166023205 GTGTGTGTGGAGACGGTAGGAGG + Intergenic
1000857153 5:166412788-166412810 TTTTCTGAGAAGAGGGAAGGTGG + Intergenic
1000968747 5:167690961-167690983 GTGTGTGTGTAGAGAGAGAGAGG + Intronic
1001209186 5:169794283-169794305 GTGGGGAAGTGGAGGGAAGGAGG - Intronic
1001229601 5:169974832-169974854 GTGTGTGTGTCGGGGGGAGGGGG - Intronic
1001304667 5:170563011-170563033 GTGTGTGGGTGGAGGTGAGGAGG - Intronic
1001314558 5:170633079-170633101 GGGGGAGAGCAGAGGGAAGGGGG + Intronic
1001600555 5:172925604-172925626 GTGTTTGAATAGAAGGAAGGAGG - Intronic
1001686386 5:173597680-173597702 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001686461 5:173597880-173597902 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001686493 5:173597964-173597986 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001756710 5:174175881-174175903 GTGGGTAAGAAGAGGGCAGGTGG + Intronic
1001827065 5:174753525-174753547 GTGTGTGTGTGTAGGGAGGGAGG + Intergenic
1001900177 5:175420589-175420611 GTGTGTGGGTGGATGAAAGGAGG - Intergenic
1001913422 5:175540092-175540114 GTGTGAGAGCAGAGGGGTGGAGG + Intergenic
1001980997 5:176037001-176037023 GTTTTTGGGTAGATGGAAGGGGG + Intergenic
1002210468 5:177595883-177595905 GTGTGTGAGTTGAGGGTGGGTGG + Exonic
1002236464 5:177807065-177807087 GTTTTTGGGTAGATGGAAGGGGG - Intergenic
1002339166 5:178503642-178503664 GTGTGTGCGAAAAGGGAGGGAGG + Intronic
1002723574 5:181280821-181280843 GTTTTTGGGTAGATGGAAGGGGG - Intergenic
1003036741 6:2646546-2646568 GTGTGTGTGTAGTGGGTGGGTGG + Intergenic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003513752 6:6802204-6802226 ATGAGTGAGTGGAGGCAAGGGGG + Intergenic
1003874440 6:10423625-10423647 GTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1004009058 6:11663909-11663931 GTGTGTGTGTGTAGGGGAGGCGG + Intergenic
1004415221 6:15417146-15417168 GTGGGTGAGTAGGGGGAAGAGGG + Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1004848574 6:19672759-19672781 GTGTTTAAGTAGAGTTAAGGGGG + Intergenic
1004980906 6:21022599-21022621 TTGTGTGTGAGGAGGGAAGGGGG + Intronic
1005042917 6:21615484-21615506 GTGTGTGTGTGTAGGGAATGTGG - Intergenic
1005501336 6:26431428-26431450 TTGTGTGACCAGAGGGGAGGAGG - Intergenic
1005505904 6:26468635-26468657 TTGTGTGACCAGAGGGGAGGAGG - Exonic
1005879315 6:30043034-30043056 GTGTGTGGGGACAGGGAAGATGG + Intergenic
1006043646 6:31274481-31274503 GTGGTTGAGTGAAGGGAAGGGGG - Intronic
1006082637 6:31576228-31576250 GGGTGTGAGAAGAGAGATGGGGG + Intronic
1006299817 6:33187743-33187765 GTGAGTGAGTATATTGAAGGAGG + Intronic
1006586548 6:35118561-35118583 ATGGGTGAGTAGAGTGCAGGGGG - Intronic
1006700987 6:35972970-35972992 GGGTATGTGTAGATGGAAGGAGG - Intronic
1006829556 6:36960646-36960668 GGGTGGGGGTAGAGGGAGGGGGG - Intronic
1006917361 6:37603145-37603167 GTGTGTGTGTGGAGGGGGGGCGG + Intergenic
1007018198 6:38490723-38490745 GTCAGTGAGAAGAGGGAAGAAGG + Intronic
1007363773 6:41375835-41375857 GGGTGTGAGATGAGGGAAGTTGG + Intergenic
1007384206 6:41509779-41509801 GTGTGTGTGTAGCGGGGAGGGGG - Intergenic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1008289206 6:49692969-49692991 GTGTGTGGGGAGGGGGTAGGAGG + Intronic
1008299959 6:49824397-49824419 GTGAGTGAGTTGAAGCAAGGAGG + Intergenic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1009569131 6:65358630-65358652 GTGTGTGTGTTGGGAGAAGGGGG + Intronic
1010828688 6:80504010-80504032 GTGTGGGAGTATAGGGTATGGGG + Intergenic
1010837696 6:80610673-80610695 GTGTGTGTGTAGGGTGATGGTGG + Intergenic
1011009908 6:82692128-82692150 GTGTGTATGTGGAGGGGAGGAGG - Intergenic
1011099928 6:83709200-83709222 GTGTGTGAGTAGCTGGGAGGGGG - Exonic
1011241606 6:85277409-85277431 GTGTGTATGTATAGGGATGGAGG + Intergenic
1011715485 6:90100674-90100696 GTGTGTGTGTAGAGAGAGAGAGG - Intronic
1012269490 6:97191125-97191147 GTGTGGGAGTAGAGAGGTGGGGG - Intronic
1012617779 6:101298669-101298691 GTGTGTGTGTATAGGGAGGTGGG + Intergenic
1012663553 6:101936560-101936582 GTGTGTTAGATGAGGAAAGGGGG - Intronic
1012790102 6:103682412-103682434 GTGTGTGTGTAGGGGGGTGGGGG - Intergenic
1012802116 6:103843601-103843623 TTGTGTAAGTATAGGGAGGGTGG + Intergenic
1014120398 6:117718915-117718937 GTGTGTGTGTGAAGGGATGGGGG + Intergenic
1015022545 6:128493579-128493601 GTGTGTGTGTAGGGGGCGGGAGG - Intronic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1015469780 6:133590820-133590842 GTCTGTGAGTGGAGGCAATGGGG + Intergenic
1015560903 6:134514871-134514893 GTGTGTGAGTAGGAGTGAGGGGG + Intergenic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1016376862 6:143430222-143430244 GTGTGCGAGTGGAGTGGAGGGGG - Intronic
1016410081 6:143773641-143773663 GCGTCTGAGTAGAGGAAAGGAGG + Intronic
1016678468 6:146799716-146799738 ATGTGTGTGTAGGAGGAAGGGGG + Intronic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017195784 6:151698569-151698591 ATTTGTGGGTAGAGGGAAGGAGG + Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017752034 6:157496968-157496990 GTGTGTGGGTAGAGGTAGGGTGG + Intronic
1017878019 6:158539749-158539771 GCCTGTCAGGAGAGGGAAGGTGG + Intronic
1017883817 6:158581990-158582012 GTGTGAGAACAGAGAGAAGGGGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018170377 6:161139403-161139425 GTGGGTGAGTGGAGGGCAAGGGG - Exonic
1018212869 6:161498929-161498951 GTGTGTGTGTATGGGGATGGGGG + Intronic
1018245187 6:161815763-161815785 GTCTGTGTGTAGGGGGAAGACGG + Intronic
1018677478 6:166235672-166235694 GTGTGTGGGTAGAAAGAGGGAGG + Intergenic
1019067602 6:169315441-169315463 GTGTGTGTGTGGACGGAGGGAGG - Intergenic
1019067638 6:169315757-169315779 GTGTGTGTGTGGACGGAGGGAGG - Intergenic
1019180810 6:170186480-170186502 GTGTGTGGGGAGTGGGGAGGAGG - Intergenic
1019332354 7:466666-466688 GTGAGGGAGGAGAGTGAAGGAGG - Intergenic
1019463210 7:1172444-1172466 CTGAGTGAGTAGGGGGAAGCTGG - Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019510480 7:1415193-1415215 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019510510 7:1415289-1415311 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019770308 7:2880300-2880322 GTGTGTGTGTAGGGATAAGGTGG + Intergenic
1019842966 7:3466967-3466989 GTGTGTGTGTAGAGAGAGAGAGG - Intronic
1020631267 7:10643091-10643113 GTGTGTGTGTAGAGGGGGTGGGG - Intergenic
1020893199 7:13905640-13905662 GTATGTGGGGAGTGGGAAGGAGG + Intronic
1020967617 7:14891618-14891640 GGTTGTGAGTAGAGAGAAGTAGG + Intronic
1022109128 7:27217281-27217303 GTGTGTGTGTGTGGGGAAGGTGG + Intergenic
1022138629 7:27472833-27472855 GTGTGTGTGTAGGGGAATGGTGG - Intergenic
1022412654 7:30151086-30151108 GTGGGTCACTCGAGGGAAGGTGG - Intronic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1022624919 7:32025366-32025388 GAGTGGGAGTTGAGGGTAGGGGG + Intronic
1022712254 7:32862972-32862994 GTGTGTGATTAGCGAGAAAGAGG + Intergenic
1022886759 7:34654697-34654719 GTGTGTGTGTGTAGGGAGGGGGG + Intergenic
1022911623 7:34904393-34904415 GTGTGTGATTAGTGAGAAAGAGG - Intergenic
1023063207 7:36349514-36349536 GTGGGTGTGTGGAGGCAAGGAGG - Intronic
1023243208 7:38171777-38171799 GTTTGGGAGTAGGGGGAGGGTGG - Intergenic
1023457144 7:40352457-40352479 ACTTGAGAGTAGAGGGAAGGAGG - Intronic
1023473351 7:40549695-40549717 GTGTGTGAGTTGTGGAAAGCAGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024337072 7:48219871-48219893 GTGTGTGTGTTTGGGGAAGGTGG - Intronic
1026849624 7:73716814-73716836 GTCTCTGAGTTGAGGGGAGGAGG + Intronic
1027597114 7:80187245-80187267 GTGTGTCTGGAGAGGGAAAGAGG + Intronic
1027828083 7:83142033-83142055 GTGTGTGTGTCGGGGGGAGGGGG - Intronic
1028487924 7:91380281-91380303 GTGTGTGTGTTGGGGGGAGGGGG - Intergenic
1028892881 7:96008307-96008329 GGGAGAGAGCAGAGGGAAGGGGG + Intronic
1029977501 7:104848612-104848634 GTGTCTGAGGAAAGGGAGGGAGG + Intronic
1030061315 7:105623546-105623568 GTGTGTGTGTTGAAGGAAAGAGG - Intronic
1030422231 7:109321998-109322020 ATGTGAGAGTAGAGTGAAGCAGG + Intergenic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1031284331 7:119844724-119844746 GTGTGTGTGTGGGTGGAAGGCGG + Intergenic
1031664926 7:124472301-124472323 GTGTGTGTGTAGTGAGACGGAGG + Intergenic
1033151309 7:138917040-138917062 CTCTGTGGGCAGAGGGAAGGGGG + Exonic
1033181331 7:139182088-139182110 GTGTGTGTGTGGAGGGGCGGGGG + Intronic
1033233499 7:139620114-139620136 ATGTGGGAATAGGGGGAAGGGGG - Intronic
1033662332 7:143410716-143410738 GTGTGGGAGTAGAGGGAGAGAGG - Intergenic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034694685 7:153043217-153043239 TTGTGTGTGTTGAAGGAAGGAGG - Intergenic
1034697165 7:153064012-153064034 GTGTGAGAGTGGAGGCAATGTGG - Intergenic
1034749241 7:153553541-153553563 GTGTGTGTGTGGAGGTAGGGCGG - Intergenic
1035332665 7:158106463-158106485 GTGTGTGTGTGGAGGCAGGGAGG - Intronic
1035341613 7:158166264-158166286 GGGTGTGAGGACAGGGAACGCGG - Intronic
1035341630 7:158166317-158166339 GGGTGTGAGGACAGGGAACGCGG - Intronic
1035341643 7:158166369-158166391 GGGTGTGAGGACAGGGAACGCGG - Intronic
1035341659 7:158166421-158166443 GGGTGTGAGGACAGGGAACGCGG - Intronic
1035341687 7:158166524-158166546 GGGTGTGAGGACAGGGAACGCGG - Intronic
1035341702 7:158166576-158166598 GGGTGTGAGGACAGGGAACGCGG - Intronic
1035768424 8:2127121-2127143 GAATTTGAGCAGAGGGAAGGGGG + Intronic
1035815920 8:2540300-2540322 GTGTGTGCGGAGAAGGGAGGCGG + Intergenic
1035894906 8:3388861-3388883 GTGTGTATGTAGAGAGAGGGAGG - Intronic
1036102923 8:5807118-5807140 GTGTTTGAGGTGTGGGAAGGAGG + Intergenic
1036141202 8:6210344-6210366 GTGTGTGTGTAGAGAGGAGTTGG - Intergenic
1036374513 8:8188842-8188864 GTGTTTGTCTTGAGGGAAGGCGG - Intergenic
1036410330 8:8494011-8494033 GTGTGTGCGTGGATGGATGGTGG + Intergenic
1036678424 8:10853176-10853198 GTGTGGGAGGGCAGGGAAGGTGG + Intergenic
1036737668 8:11332093-11332115 CTGTGAGAGGACAGGGAAGGTGG + Exonic
1036855029 8:12234305-12234327 GTGTTTGTCTTGAGGGAAGGCGG + Intergenic
1036876390 8:12476793-12476815 GTGTTTGTCTTGAGGGAAGGCGG + Intergenic
1037118425 8:15253941-15253963 GTGTGTGTGTGAAGGGATGGGGG - Intergenic
1037547967 8:19941646-19941668 TTGGGTGAGTAGAGTGAAAGTGG - Intronic
1037878456 8:22561064-22561086 GTGTGTGGGAACAGGGAGGGAGG + Intronic
1038533822 8:28339588-28339610 GTGTGTGTGGAGTGGGGAGGGGG - Intronic
1039058676 8:33556461-33556483 GTGTGTGTGTGGTGGGCAGGGGG + Intronic
1039064686 8:33598469-33598491 GTGTGTGTCTTGAGGGGAGGGGG + Intronic
1039256105 8:35720566-35720588 TTAATTGAGTAGAGGGAAGGTGG + Intronic
1039468076 8:37797601-37797623 GGGTGGGAGCAGGGGGAAGGGGG + Intronic
1039596328 8:38793020-38793042 GTGTGTGTGTTTGGGGAAGGGGG - Intronic
1040356064 8:46619443-46619465 GTGTGTGAGACCAGGGATGGGGG - Intergenic
1041046772 8:53895018-53895040 CTGTGCGGGGAGAGGGAAGGAGG + Intronic
1041256801 8:55985799-55985821 GTGTGTGGTTGGATGGAAGGGGG + Intronic
1041578121 8:59423063-59423085 ATGTATGAGCAGAGGGCAGGGGG - Intergenic
1041718993 8:60959497-60959519 GGGTGAGAGAAGAAGGAAGGTGG - Intergenic
1042153175 8:65811725-65811747 GTGTGTAGTTAGAGGGAAGAAGG + Intronic
1043400888 8:79883128-79883150 GTGTGGAAGGAGAGGCAAGGAGG - Intergenic
1043638342 8:82414830-82414852 TAATGTGAGTAGAGGGAGGGAGG - Intergenic
1043845671 8:85160759-85160781 GTGTTTGAGGAGAGGTGAGGAGG - Intergenic
1043894331 8:85725758-85725780 GTTGGTGAGTGCAGGGAAGGAGG + Intergenic
1043894687 8:85728843-85728865 GTTGGTGAGTGCAGGGAAGGAGG + Intergenic
1043895043 8:85731928-85731950 GTTGGTGAGTGCAGGGAAGGAGG + Intergenic
1043897633 8:85749883-85749905 GTTGGTGAGTGCAGGGAAGGAGG - Intergenic
1043897989 8:85752968-85752990 GTTGGTGAGTGCAGGGAAGGAGG - Intergenic
1043901565 8:85780441-85780463 GTTGGTGAGTGCAGGGAAGGAGG - Intergenic
1045081368 8:98629402-98629424 GTTTGTGAGAGGAAGGAAGGTGG - Intronic
1045327546 8:101127799-101127821 GTGTGGGAGCAGAGGGATGGGGG + Intergenic
1045420397 8:102008905-102008927 GTGTGTGTGTAGGGGGGCGGGGG - Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1046790235 8:118313901-118313923 GTGTGTGTGTAGAGGGAGAGAGG + Intronic
1047192054 8:122687139-122687161 GCGTTTAAGTAGAGGGAAGAAGG - Intergenic
1047212782 8:122853565-122853587 GTGGCTGAGACGAGGGAAGGTGG - Intronic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1048171622 8:132112166-132112188 TGGTGTGGGTAGAGGGAATGGGG - Intergenic
1048871938 8:138806392-138806414 GGGTGTGAGATGAGGGAGGGAGG + Intronic
1049197456 8:141323596-141323618 GTGTGTGAGCAAAGGACAGGAGG - Intergenic
1049371954 8:142272229-142272251 GTGGATGGGTAGATGGAAGGAGG - Intronic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049582277 8:143418200-143418222 GTGTGTGGGTAGGGGGTTGGAGG - Intergenic
1049582367 8:143418453-143418475 GTGGGTGAGTAGGGGGTATGGGG - Intergenic
1050811888 9:9758749-9758771 GGGTGGGAGTAGTGGGATGGGGG - Intronic
1051181130 9:14412989-14413011 AGGTGTGATTTGAGGGAAGGAGG - Intergenic
1051431889 9:16987788-16987810 TTCTGTGAGTAGAAGGAATGTGG + Intergenic
1051604796 9:18908647-18908669 GTGTGTGTGGAGTGGGGAGGGGG - Exonic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1053009216 9:34623863-34623885 CTGGGTGCGTAGAGTGAAGGCGG + Exonic
1053089346 9:35259777-35259799 GTGTGTGTGTAGGGGGATGCGGG + Intronic
1053303426 9:36967720-36967742 GTGAGTGAGTGGAGGTGAGGGGG + Intronic
1053437482 9:38086064-38086086 GTGTGGGAGTATGGGGAATGAGG - Intergenic
1053885777 9:42644371-42644393 GTTTTTGGGTAGATGGAAGGGGG - Intergenic
1054224795 9:62451820-62451842 GTTTTTGGGTAGATGGAAGGGGG - Intergenic
1054702824 9:68431232-68431254 GTTGGCGAGTAGTGGGAAGGCGG - Intronic
1054812347 9:69444927-69444949 GTGTGTGATTAGAGAGAAAAGGG - Intronic
1055008282 9:71534483-71534505 GTGTGTGTGTGGAGGGGTGGTGG + Intergenic
1055028217 9:71744952-71744974 GTGTGAGAGGAGAGTGAGGGTGG - Intronic
1055058550 9:72045935-72045957 GTGTGTGGGGGGAAGGAAGGTGG + Intergenic
1055092942 9:72381097-72381119 GTGTTTGTTTTGAGGGAAGGTGG + Intergenic
1055430761 9:76241110-76241132 GTTTGTGGGTAGAGGGAGGGGGG + Intronic
1056085761 9:83148005-83148027 GTATGTGGGTAGAGGATAGGAGG + Intergenic
1056177543 9:84050018-84050040 TTAGGTGAGTAGAGGAAAGGAGG + Intergenic
1056241976 9:84656809-84656831 GTGTGGAAGAAGATGGAAGGTGG + Intergenic
1056327936 9:85496165-85496187 GTGTGTTAGTAGGGGGAAGGAGG - Intergenic
1057314319 9:93958889-93958911 GGGTGTGGGTGGAGGGGAGGTGG - Intergenic
1057677434 9:97146899-97146921 GGGTGGGAGTAGTAGGAAGGGGG - Intergenic
1057851480 9:98570131-98570153 GTGAGGGAGTGGAGGCAAGGAGG - Intronic
1057966809 9:99512303-99512325 GTTTGTGGGTTGGGGGAAGGTGG - Intergenic
1058117337 9:101099095-101099117 GTGTGTGTGTCGGGGGGAGGCGG + Intronic
1058189704 9:101898335-101898357 GTGTGTGGCAAGAGGGCAGGGGG + Intergenic
1058714740 9:107713605-107713627 GTGGAGGAGTAGAGGGAGGGAGG + Intergenic
1058910530 9:109516524-109516546 GGGTGTGTGTAGGGGGATGGTGG + Intergenic
1059210193 9:112507090-112507112 ATTTGTGGGTAGAGGGAAGGAGG + Intronic
1059516544 9:114901045-114901067 GTGTGTGTGTGGTGGGGAGGTGG + Intronic
1059787749 9:117604844-117604866 TTGTTTGCGTAGAGGTAAGGTGG - Intergenic
1060319891 9:122548739-122548761 GGGTGGGGGTAGAGGGGAGGGGG - Intergenic
1060416215 9:123432556-123432578 GTGAGTGAGCAGAGGTACGGTGG - Intronic
1060428944 9:123531542-123531564 GTGTGTGTGTAGAGAGAGAGGGG - Intronic
1060995460 9:127873007-127873029 GTGGGTGAGTTGCGGGCAGGCGG - Exonic
1061498363 9:130988840-130988862 GTGTGTGTGTTGGGGGAGGGGGG - Intergenic
1061499047 9:130991813-130991835 GTGTGTGAAAGGAGGGAGGGAGG - Intergenic
1061716238 9:132520131-132520153 GAGTGAGAGGAGAGGGGAGGGGG - Intronic
1062119481 9:134826610-134826632 GTGTGTGTGTAGATGGCATGTGG + Intronic
1062185651 9:135216873-135216895 GTGAGTGAGGAGGGGGAAGGGGG + Intergenic
1062201378 9:135304567-135304589 GAGGGTGAGTGGAGGGATGGAGG + Intergenic
1062649862 9:137569902-137569924 GTGGGTGAGTGGATGGATGGTGG - Intronic
1185542643 X:915804-915826 GTTTCTGAGAAGAGGGAAGCAGG - Intergenic
1185566595 X:1099686-1099708 GGGTGTGGGCAGAGGGCAGGAGG + Intergenic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1185734301 X:2485626-2485648 GGGAGGGAGGAGAGGGAAGGAGG + Intronic
1185762735 X:2700950-2700972 GTGGGTGGGTAGACGGATGGAGG - Intronic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186819502 X:13272463-13272485 GTGTGTAAGGAGTGGGGAGGCGG - Intergenic
1187331666 X:18345850-18345872 GTGTGTGTGTCGGGGGTAGGGGG - Intronic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1187812962 X:23200424-23200446 GGGTGTGAGTACAGGGGAGCAGG - Intergenic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1188153094 X:26703750-26703772 GTATGTGAGTGGAGGGAGGGAGG + Intergenic
1188489503 X:30722771-30722793 GTGTGTGTGAAGAGAGAGGGGGG + Intronic
1188955537 X:36431596-36431618 GTGTGTGGGTAGAGGGAGGGAGG + Intergenic
1189279619 X:39812025-39812047 GTGTGTGGGTAGGGGGAGGTGGG - Intergenic
1189654396 X:43226842-43226864 GGGTGTAAGTAGAGGGAAATTGG + Intergenic
1190107414 X:47570214-47570236 GGATGTGAGAAGAGGGAAGTTGG - Intronic
1190291931 X:48998915-48998937 GAGTGTGAGTAGAGGATGGGAGG + Intronic
1190454760 X:50616860-50616882 GTGTGTGTGGTGAGGGATGGGGG - Intronic
1190942977 X:55061390-55061412 GTTTGAGAGTAGAGAGCAGGAGG - Intergenic
1191682210 X:63852750-63852772 GTGTGTGGTTTGAGAGAAGGAGG - Intergenic
1191821310 X:65311990-65312012 GTCTGGGAGTAGGGGGCAGGGGG + Intergenic
1192354378 X:70386429-70386451 GTTTGTGTGTAGAGGGGAAGTGG - Intronic
1192545350 X:72008294-72008316 GTCGGTGAGTAGAGGACAGGAGG + Intergenic
1193197614 X:78653105-78653127 GTGTGTGTGTAGGGTGGAGGTGG - Intergenic
1193679633 X:84502301-84502323 GTGGGTGAGAAGGGCGAAGGAGG - Intronic
1194098356 X:89671995-89672017 GGGAGTGAGGAGAGGGAACGCGG - Intergenic
1195133417 X:101877685-101877707 GTGTGTGTGTTGAGGGAGGGCGG - Intergenic
1195150333 X:102061436-102061458 GTGTGTGTGTATGGGGCAGGGGG - Intergenic
1195611380 X:106871481-106871503 GTGTGAGAGTAGAGGAAAAAAGG - Intronic
1195940811 X:110166460-110166482 GTGAGTGAGTTGAAGGAAGCAGG + Intronic
1196015623 X:110937437-110937459 GTGTGTCAGTATTGGGAAGTGGG + Intergenic
1196150490 X:112368238-112368260 GTGTGTTAGTGAAGAGAAGGTGG + Intergenic
1196482675 X:116167795-116167817 GTGTGTGGGTGGAGGTGAGGCGG + Intergenic
1196684298 X:118496836-118496858 GTGTGTCAGTCCAGGGATGGAGG + Intronic
1197456165 X:126678086-126678108 GGGTGGGAGTAGTGGGAGGGAGG + Intergenic
1197751085 X:129963981-129964003 GTCTGTTAGCAGAGGGCAGGAGG + Intergenic
1197781605 X:130165681-130165703 GCGTGAGAGGAAAGGGAAGGAGG - Exonic
1198700527 X:139392651-139392673 GTGTGTGTGCACATGGAAGGAGG - Intergenic
1198847585 X:140929348-140929370 GTATGTGTGTGGAGGGGAGGAGG + Intergenic
1199677304 X:150199347-150199369 GCCTGTGAGGGGAGGGAAGGTGG + Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1200860759 Y:7989264-7989286 GTGTGTGTGTAGTGGGGATGGGG - Intergenic