ID: 947335859

View in Genome Browser
Species Human (GRCh38)
Location 2:229082363-229082385
Sequence ACTCACTGACCTTTACCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947335854_947335859 17 Left 947335854 2:229082323-229082345 CCCACCTTCTGTGATAGGCAGAA 0: 1
1: 0
2: 4
3: 11
4: 181
Right 947335859 2:229082363-229082385 ACTCACTGACCTTTACCCCATGG 0: 1
1: 0
2: 1
3: 25
4: 145
947335856_947335859 13 Left 947335856 2:229082327-229082349 CCTTCTGTGATAGGCAGAATTCT 0: 1
1: 3
2: 21
3: 64
4: 319
Right 947335859 2:229082363-229082385 ACTCACTGACCTTTACCCCATGG 0: 1
1: 0
2: 1
3: 25
4: 145
947335855_947335859 16 Left 947335855 2:229082324-229082346 CCACCTTCTGTGATAGGCAGAAT 0: 2
1: 1
2: 3
3: 17
4: 163
Right 947335859 2:229082363-229082385 ACTCACTGACCTTTACCCCATGG 0: 1
1: 0
2: 1
3: 25
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947335859 Original CRISPR ACTCACTGACCTTTACCCCA TGG Intronic
901488223 1:9580335-9580357 ACTCACTGACCTTACCTGCAGGG - Intronic
902673781 1:17994226-17994248 GCTCAGTGACCTTGCCCCCACGG - Intergenic
907949264 1:59165300-59165322 ATTCACAGACTTTTGCCCCAAGG + Intergenic
909231445 1:73095612-73095634 TCTCAGTAACCTTTACTCCAGGG - Intergenic
910065357 1:83144296-83144318 ACTCACTGACCATTTTCCCGAGG + Intergenic
915498085 1:156295170-156295192 CCCCACTGCCCCTTACCCCAGGG - Intronic
916641029 1:166729356-166729378 TCTCACTCACCCTTTCCCCATGG - Intergenic
917458247 1:175204398-175204420 ACTCACTGTCCTTTGCTTCAAGG - Intergenic
921719598 1:218455735-218455757 ACTCACTGACTATGATCCCAAGG - Intergenic
922351089 1:224735093-224735115 CCTCACTGTCCCTTGCCCCAAGG + Intronic
1064556652 10:16553182-16553204 ACACACTAACATTTACACCATGG - Intergenic
1065508609 10:26455200-26455222 ACTCACAGTACTTTACTCCATGG - Intronic
1067342340 10:45416238-45416260 ACTCCTTGACCTTGACCCCTTGG - Intronic
1067465454 10:46494938-46494960 ACTCACTAAAATTTACCCCCAGG - Intergenic
1067621733 10:47889663-47889685 ACTCACTAAAATTTACCCCCAGG + Intergenic
1070868255 10:79723714-79723736 ACTCACTCACCTGCAACCCAGGG + Intergenic
1071230682 10:83581174-83581196 ACTCACTCACCTTTTCCTCATGG + Intergenic
1071341943 10:84657668-84657690 TCTCTCTTATCTTTACCCCAAGG + Intergenic
1071635168 10:87245914-87245936 ACTCACTCACCTGCAACCCAGGG + Intergenic
1071660077 10:87492080-87492102 ACTCACTCACCTGCAACCCAGGG - Intergenic
1072265462 10:93722683-93722705 AGTCCCTTACATTTACCCCATGG - Intergenic
1072503319 10:96041014-96041036 ACTCACAGAACTTTACGCCGTGG - Intergenic
1073654920 10:105403802-105403824 ACTCCTTGATATTTACCCCAAGG + Intergenic
1074125222 10:110523851-110523873 CCTCACCGACATTTCCCCCATGG - Intergenic
1074648989 10:115497402-115497424 ACTCACTTATCATTTCCCCATGG + Intronic
1077519017 11:3020210-3020232 ACTCGCTCACCTTTCCCCAAGGG + Exonic
1078435549 11:11321949-11321971 ACTGACTCTCCTTGACCCCATGG - Intronic
1079163382 11:18013961-18013983 ACTCACTGCCCTTCACCCCTGGG + Intergenic
1080870727 11:36234622-36234644 TCTCACTGACCTTTTCCCTAAGG - Intergenic
1081069609 11:38595071-38595093 AGTCGCTGACCTTTCCCACAAGG + Intergenic
1083525615 11:63361773-63361795 TCTCACTCACCCTTTCCCCATGG + Intronic
1085445596 11:76598653-76598675 ACTCACTGAGGTTTGCCCCTTGG + Intergenic
1085894851 11:80626804-80626826 AGACACTGACTTTCACCCCAAGG + Intergenic
1087895687 11:103583370-103583392 ACTCAGTTACCTTTAGACCAGGG - Intergenic
1088555863 11:111059955-111059977 GCTTACTCACCTTAACCCCAAGG + Intergenic
1088600130 11:111466808-111466830 ACCCACTGACCTTTCTGCCAGGG + Intergenic
1089715504 11:120354948-120354970 ACTAACAGACCTTTACCCCACGG - Intronic
1089801746 11:121036416-121036438 ATTCACTGACTTTTACTCCAAGG - Intronic
1090874395 11:130775863-130775885 TCTCAGTGACCTTTATGCCACGG - Intergenic
1093607952 12:21117182-21117204 ACTCAATGAACACTACCCCAAGG - Intronic
1094399158 12:30042533-30042555 ACACACAGACCTTGACCTCATGG + Intergenic
1096189185 12:49603982-49604004 ACTGAATGACCTTTACTGCATGG - Intronic
1104505182 12:129325288-129325310 CCTCACTTACCTTTTCTCCATGG - Intronic
1114316046 14:21511028-21511050 AGTCACTGCCCTTTACCAAACGG - Intronic
1118006461 14:61568292-61568314 ACAGACTGAACTCTACCCCAGGG - Intronic
1119319987 14:73724900-73724922 TCTCAGTGGCCTTCACCCCAGGG + Intronic
1119650371 14:76378764-76378786 TCTTTCTGACCTCTACCCCATGG + Intronic
1121032469 14:90670869-90670891 ACTCAATGACCTTTAACCTTTGG + Intronic
1124142892 15:27093019-27093041 AGTCACTGAACCCTACCCCACGG + Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128565649 15:68699156-68699178 TCTCACTGACCACCACCCCAGGG - Intronic
1129490433 15:75920058-75920080 ACTATCTGACCTTTTCCCAAAGG - Intronic
1132664176 16:1074095-1074117 ACTCACAGAGCTGGACCCCAAGG + Intergenic
1132666195 16:1082353-1082375 ACTTACTGCCCTTGACCCCCTGG + Intergenic
1137501895 16:49018247-49018269 CCTCACTGACCTCATCCCCAAGG + Intergenic
1138533148 16:57645983-57646005 ACCCACAGACCTTTGCCCCTTGG - Intronic
1138867755 16:60844313-60844335 ACTCGCTCACCTCTATCCCAGGG + Intergenic
1139541932 16:67624562-67624584 TCTCACTGGCCTTAACTCCAAGG + Intronic
1141170535 16:81687893-81687915 ATTCACTGACCGTGACCACAGGG - Intronic
1141493364 16:84390021-84390043 TCTCACTTTCCTTTATCCCACGG + Intronic
1146583048 17:34056947-34056969 ACTCTTTGACATTTCCCCCAGGG - Intronic
1151133450 17:71922450-71922472 ACTCACTGATAGTTACTCCATGG - Intergenic
1151533765 17:74725418-74725440 ACTGACTGCACTTTTCCCCAAGG - Intronic
1156791226 18:40976799-40976821 ACACACTGTCCTGTACCCCAGGG - Intergenic
1156893860 18:42221075-42221097 ACCCACTGAACTTTACACAAAGG - Intergenic
1162322944 19:9980638-9980660 ACACACTCACCTTTTCTCCAGGG + Exonic
1166427399 19:42691795-42691817 GCTCACTGTCCTTCACCACATGG - Intronic
1167612266 19:50513262-50513284 GGTCACTGACCTTTCCCCAAGGG + Exonic
1167856478 19:52245687-52245709 ACTCACAAACCTTTATCTCAGGG - Intergenic
928404131 2:31001407-31001429 TCTCAGTGACCTTTACCCTGAGG - Intronic
929818613 2:45256376-45256398 AGTCACTGATCTTTTCCCCCTGG + Intergenic
938323599 2:130382277-130382299 TCTCACTGCCTTTTAACCCAAGG - Intergenic
939747370 2:145992543-145992565 ACTCACTCACCATACCCCCAAGG + Intergenic
944667388 2:201968940-201968962 ACTCAGTGACCTTTAACTCAAGG + Intergenic
946534862 2:220615963-220615985 ACTCAGTGACATTTATCACAAGG - Intergenic
947136143 2:226978627-226978649 CCTCACTGTCCTTGCCCCCATGG + Intronic
947335859 2:229082363-229082385 ACTCACTGACCTTTACCCCATGG + Intronic
1168904048 20:1390101-1390123 ACAGACTGACCTTTACCACATGG - Intronic
1171278896 20:23880255-23880277 ACCCAGTGAACTTTACCCAAAGG - Intergenic
1172294433 20:33798624-33798646 ACTCCCTGGACTTTACCCCAGGG - Intergenic
1173073327 20:39791594-39791616 ACCCCCTGCCCTTTCCCCCACGG - Intergenic
1174876009 20:54227153-54227175 ACTCACTGCCTCTTAGCCCAAGG - Intronic
1175141374 20:56862692-56862714 CCTCCCTGACCTCTACCCCCTGG + Intergenic
1176009485 20:62885128-62885150 CCTCAGTGCCCTTCACCCCAGGG - Intronic
1176231482 20:64035415-64035437 AGTCACTGACTTTTCCCCCTGGG + Intronic
1176734433 21:10531280-10531302 ACTCACTCACCCTCACTCCAAGG - Intronic
1178345903 21:31827843-31827865 ACCCATTCACCTTTACCCCACGG - Intergenic
1179782288 21:43709330-43709352 ACTCCTTGATCTTTACCCAAAGG - Intergenic
1180158724 21:45989766-45989788 CCTCACTCACCTTCTCCCCACGG - Exonic
1180562174 22:16626756-16626778 ACTCACTCACCCTCACTCCAAGG - Intergenic
1183415276 22:37678216-37678238 AGTCACTGACCTTGACCAAACGG + Intronic
952277411 3:31890956-31890978 GCTCACCCACTTTTACCCCAGGG - Intronic
957810045 3:85210310-85210332 ACTAAATGGCATTTACCCCAGGG - Intronic
958550347 3:95604717-95604739 CCTCTCTGTCCTTTGCCCCATGG - Intergenic
959003141 3:100988436-100988458 ACTCACTGAGCTTTGGCCCCTGG + Intronic
961654790 3:128435311-128435333 TCTCACTGCCCTCTCCCCCAGGG + Intergenic
962816289 3:139004282-139004304 ACTCACTCACCTTCACCGCATGG - Intergenic
963875968 3:150474766-150474788 ACTCACTCAGCTTTTCCCCCTGG - Intergenic
966661631 3:182420886-182420908 TTACACTGACCTTTACCACAGGG - Intergenic
967947639 3:194816774-194816796 CCACTCAGACCTTTACCCCAGGG - Intergenic
972828496 4:42787667-42787689 ACTCACTCACCATTTCCTCATGG + Intergenic
982399240 4:154947691-154947713 ACTCACTGGCATTGACCTCATGG + Intergenic
983119086 4:163858256-163858278 ACTCACTTTATTTTACCCCAAGG + Intronic
985947176 5:3194878-3194900 TCTCACTGACCTTTCCGCCTGGG - Intergenic
986938091 5:12916929-12916951 TCTCATTGACCTTTATCACAGGG + Intergenic
988537856 5:32085027-32085049 GCTCACTGACCTCTACCTCCTGG + Intronic
991384533 5:66070409-66070431 AGCCACTGATCTTTACCCCCAGG - Intronic
992615287 5:78541330-78541352 ACTCACTGACCAAGGCCCCATGG + Intronic
994136282 5:96290897-96290919 GCTCACTGTCATTTCCCCCAAGG - Intergenic
994281383 5:97907626-97907648 ACTCCCTGACCATTACCTGATGG - Intergenic
997068332 5:130589840-130589862 ACTCAGTGTCCTATACCCCAGGG + Intergenic
999265162 5:150262192-150262214 CCTCACTGACCTGGACCCCTGGG + Intronic
999524972 5:152394966-152394988 ACTTACTGACCTTTCCACCATGG + Intronic
1001008032 5:168072300-168072322 TTTCGCTGACCTTGACCCCAAGG + Intronic
1002333258 5:178460281-178460303 ACCCACAGTTCTTTACCCCAAGG + Intronic
1003481939 6:6542689-6542711 ACTCCTTGACATTTACCCAAAGG - Intergenic
1003708564 6:8563103-8563125 ACTCAATGACATCTACCCCAAGG + Intergenic
1003719257 6:8682108-8682130 GCTCAAAGAACTTTACCCCATGG + Intergenic
1005664472 6:28037442-28037464 TCTCATTGACCCTTACCTCAAGG - Intergenic
1005899608 6:30206143-30206165 TCTCACGGAAGTTTACCCCATGG - Intronic
1007173449 6:39880257-39880279 CCACACTGACCTTTATCCCATGG + Intronic
1008206062 6:48658786-48658808 ATTCTCTGACATTTACCTCAGGG + Intergenic
1010445736 6:75946494-75946516 CCTCCCTGACTTTTACCCCAGGG + Intronic
1014884489 6:126763320-126763342 ACTCACATACCTTTAACTCAGGG + Intergenic
1015680251 6:135799518-135799540 ACTCACTCACCTTGCCCCCAGGG - Intergenic
1016957758 6:149642927-149642949 ACTCAATGACCTTTGCCTCTTGG + Intronic
1018068552 6:160141099-160141121 ACTCACAGACCTGTACCCAAGGG - Intronic
1020567667 7:9818130-9818152 ACACACTGAACTTCACCTCAAGG + Intergenic
1021053302 7:16016157-16016179 ACTGCCAGACCTTTACCCAAAGG - Intergenic
1023774210 7:43588463-43588485 ACTCACTGATTTTTACGCCTAGG + Intronic
1024257268 7:47548385-47548407 AGTCACTGCCCCTTACCCCAAGG + Intronic
1026058298 7:67004343-67004365 ACTCACTCACCCCTCCCCCAGGG - Intronic
1026719792 7:72820683-72820705 ACTCACTCACCCCTCCCCCAGGG + Intronic
1026982709 7:74536085-74536107 ACACACAGACCTTTACCCAGGGG + Intronic
1027476554 7:78639067-78639089 ACTCAGTGACCTTCATCGCATGG + Intronic
1030304543 7:108004636-108004658 CCTCACTCACCTAGACCCCAAGG - Intergenic
1030988780 7:116274270-116274292 ACTCAGTGACATTTTCCCAAAGG + Intergenic
1031201501 7:118693571-118693593 ACTCCCTGACCTGGACCCTAAGG - Intergenic
1031442792 7:121813973-121813995 ACTTACTCACCATTTCCCCATGG - Intergenic
1032508183 7:132451625-132451647 GCTCACTGCCCTTTACCCACTGG - Intronic
1035598083 8:877353-877375 ACTCTCTGCCCTGTCCCCCATGG + Intergenic
1037586844 8:20282816-20282838 AATCACTGATCTTTACACCCTGG + Intronic
1039128252 8:34229612-34229634 CCTCACTGACCATTTCCCTAAGG + Intergenic
1041683206 8:60614569-60614591 TATCACTGACATTTACCCAAGGG - Intronic
1042887080 8:73564112-73564134 TTCCACTCACCTTTACCCCAAGG - Intronic
1042958504 8:74277611-74277633 ACTCACTAGCCTGTAACCCAGGG + Intronic
1044929305 8:97236514-97236536 ACTCAGGGAACTATACCCCAAGG - Intergenic
1046175978 8:110575462-110575484 ACTCACTGGCCTTCATGCCAGGG + Intergenic
1046255867 8:111695012-111695034 TCTCACTCACCATTTCCCCATGG + Intergenic
1050581447 9:7061669-7061691 ACTTACTGACCTTTTCCCTAAGG - Intronic
1050766057 9:9135092-9135114 ACTCACTACCCTTTACCTCAAGG - Intronic
1050810086 9:9734037-9734059 ACACACTGATCTTTTCCACATGG - Intronic
1051603485 9:18897236-18897258 ACTCACTGCCCCTTCCCCCGGGG - Intronic
1056316496 9:85395412-85395434 ACTCAATGACCTTTCCTTCATGG - Intergenic
1059236532 9:112764976-112764998 TCTCCCTGACCTTTTCCCCTGGG - Intronic
1060177211 9:121505823-121505845 ACTCACTGCCCCTTCCCCCCAGG - Intergenic
1060925721 9:127453983-127454005 AGACACTGACCCTTACCCCATGG + Intronic
1186374985 X:8988989-8989011 CCTCACTCACCTTTTCCCCATGG + Intergenic
1186996666 X:15131115-15131137 ACTCTCTGACCTCTAGACCAGGG + Intergenic
1188402234 X:29759885-29759907 AATAACTGGCCATTACCCCAAGG - Intronic
1189615858 X:42783176-42783198 ACTAACTGACATTTACCAGAGGG + Intergenic
1191627291 X:63283038-63283060 AGTCACTCACCCTTTCCCCATGG - Intergenic
1192051546 X:67728905-67728927 ACTGACTGAGATTTACCACAGGG + Exonic
1193196697 X:78640054-78640076 ACTCACTCACCCTTTCCCAATGG + Intergenic
1193969955 X:88039072-88039094 ACTCAGTGTCCTATATCCCAGGG + Intergenic
1194195339 X:90884434-90884456 ACTCACTTACCATTTCCCCATGG + Intergenic
1194201389 X:90957389-90957411 ACTCACTTGCCATTTCCCCATGG - Intergenic
1195587959 X:106587597-106587619 ACTCACTCACCTTTTCTCCAAGG + Intergenic
1197334712 X:125198932-125198954 ACACACTGACCTTTTCAGCAAGG - Intergenic
1197563141 X:128048319-128048341 GCTCACTCACCTTTTCCCCATGG + Intergenic
1199969435 X:152848385-152848407 TCAAACTGGCCTTTACCCCAGGG - Intronic
1200135062 X:153870784-153870806 ACTCACTGGCCTTGACCCGGAGG + Exonic