ID: 947342058

View in Genome Browser
Species Human (GRCh38)
Location 2:229150714-229150736
Sequence CTTTAACAGTATAAGCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947342056_947342058 23 Left 947342056 2:229150668-229150690 CCCAGTTATGTGTCAGTTTGTTT 0: 1
1: 0
2: 0
3: 32
4: 405
Right 947342058 2:229150714-229150736 CTTTAACAGTATAAGCACTGTGG 0: 1
1: 0
2: 0
3: 13
4: 134
947342055_947342058 24 Left 947342055 2:229150667-229150689 CCCCAGTTATGTGTCAGTTTGTT 0: 1
1: 0
2: 1
3: 13
4: 221
Right 947342058 2:229150714-229150736 CTTTAACAGTATAAGCACTGTGG 0: 1
1: 0
2: 0
3: 13
4: 134
947342057_947342058 22 Left 947342057 2:229150669-229150691 CCAGTTATGTGTCAGTTTGTTTG 0: 1
1: 1
2: 1
3: 19
4: 515
Right 947342058 2:229150714-229150736 CTTTAACAGTATAAGCACTGTGG 0: 1
1: 0
2: 0
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947342058 Original CRISPR CTTTAACAGTATAAGCACTG TGG Intronic
905255092 1:36675559-36675581 CTTGAACAGTATAAGGACTCAGG - Intergenic
906836925 1:49093943-49093965 CTTTAACAGAAATAGCAATGGGG + Intronic
907944167 1:59117995-59118017 CTAAAACAGTATAACCACTCTGG - Intergenic
908715239 1:67062851-67062873 TTTTAACAATATCAGCCCTGTGG + Intergenic
909747384 1:79114157-79114179 ATTTGTCAGAATAAGCACTGGGG + Intergenic
912036826 1:105326622-105326644 CTTTAACAATAAAGGCCCTGAGG + Intergenic
913612408 1:120520989-120521011 TTTTAACAGTGTAAGTACTCTGG - Intergenic
914578781 1:149001249-149001271 TTTTAACAGTGTAAGTACTCTGG + Intronic
917499284 1:175571512-175571534 GGTTAGCAGTATAAGCTCTGGGG - Intronic
919253614 1:195094014-195094036 CTTTAAGAATATAAGCAGTCTGG + Intergenic
919544899 1:198903426-198903448 CTTTGACTGTCTAGGCACTGGGG + Intergenic
923807648 1:237276398-237276420 TTTTAATAATATATGCACTGAGG - Intronic
1063763888 10:9114515-9114537 TTTTAACAATATAGCCACTGGGG - Intergenic
1065609235 10:27454894-27454916 GTTTTACAGTCTAAGCACAGAGG + Intergenic
1066353388 10:34658572-34658594 CCTTAACAGAATCAGCACCGAGG - Intronic
1066625771 10:37404064-37404086 CTTTAACAGTAGAAACCATGTGG + Intergenic
1067893870 10:50159263-50159285 CTGTAACAGTATGAACAATGTGG - Intergenic
1067954974 10:50781004-50781026 CTGTAACAGTATGAACAATGTGG + Intronic
1074173150 10:110964958-110964980 CTTTAATCGTATAACTACTGTGG + Exonic
1079742310 11:24078259-24078281 CTTTAGCTGAATAAACACTGTGG + Intergenic
1081047047 11:38288651-38288673 CTCTAACAGTATAACCTCTTAGG + Intergenic
1081826221 11:46055509-46055531 GTGTAACAGTAAAAGCTCTGTGG - Intronic
1082053754 11:47795582-47795604 ATTTTACAATATAATCACTGTGG - Intronic
1085376276 11:76064600-76064622 CTATAAAATTATAGGCACTGGGG - Intronic
1087565520 11:99852207-99852229 CTTTAAAAGTATAATTACTTTGG + Intronic
1088964622 11:114705830-114705852 TTTTCAAAGTATAACCACTGGGG - Exonic
1092676811 12:10930000-10930022 CTTTAACTAAATAAGCACTAAGG + Intronic
1095371482 12:41472759-41472781 CTTTAACAGTTAAAAAACTGTGG + Intronic
1098776298 12:74623177-74623199 CTTTTAAAGTATAAACAGTGTGG - Intergenic
1099653056 12:85454223-85454245 CTTTAACAGTGAAAGCATTGAGG + Intergenic
1102642790 12:114381680-114381702 ATTTATCAGTATGAGCCCTGGGG - Intronic
1108067861 13:46597220-46597242 CGTTTACAGTATGAGAACTGAGG - Intronic
1108269198 13:48742087-48742109 CATTAACTGTATATGCACTCAGG - Intergenic
1109489100 13:63071591-63071613 CTTTAACTGTATAAGGAATTTGG - Intergenic
1110165987 13:72443885-72443907 CTTTAAAAGAAAAAGCACTTCGG - Intergenic
1110426297 13:75370959-75370981 CTTTCAAACTGTAAGCACTGTGG - Intronic
1110503309 13:76254266-76254288 CTTTTATATTATAAGCACTCAGG + Intergenic
1110967906 13:81724732-81724754 CTTGAAGAGTGTAACCACTGTGG - Intergenic
1112775780 13:102842920-102842942 CTTTAACAGTAATAGCAGTAGGG - Intronic
1113099955 13:106706734-106706756 TTTCACCAGTATAAACACTGAGG - Intergenic
1120775222 14:88427576-88427598 CCTTCAAAATATAAGCACTGTGG - Intronic
1129496368 15:75985549-75985571 CCTGAACTGTATAAGCATTGTGG - Intronic
1129650515 15:77484073-77484095 CTTTAACAGCATAAGTAAAGAGG + Exonic
1133435382 16:5775065-5775087 CTGTGACTTTATAAGCACTGTGG - Intergenic
1134568829 16:15274265-15274287 GTTTCACAGTCTCAGCACTGTGG - Intergenic
1134733606 16:16482097-16482119 GTTTCACAGTCTCAGCACTGTGG + Intergenic
1134933894 16:18230185-18230207 GTTTCACAGTCTCAGCACTGTGG - Intergenic
1138526097 16:57608121-57608143 CTTTAAAATTATGAGCCCTGAGG + Intergenic
1138819509 16:60242194-60242216 GTTTATCAGTATACGCACTGGGG - Intergenic
1143564113 17:7711294-7711316 CTTTTACAGTAAAACTACTGAGG - Exonic
1153117796 18:1681103-1681125 CTATAAGAATATAAGCAATGAGG - Intergenic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1167496935 19:49825078-49825100 CTTGAACAGAAGAAGCACTATGG - Intronic
929745832 2:44657363-44657385 CTTTAAAAGTCTTAGCATTGAGG + Intronic
929835724 2:45396322-45396344 TTTTAACATTAAAAACACTGAGG + Intronic
930481255 2:51951517-51951539 CTTGAATAGTCTGAGCACTGTGG + Intergenic
932940909 2:76163969-76163991 GTTTAACGGTACAAGGACTGTGG - Intergenic
933069479 2:77839250-77839272 CATTTACAGAATAAGAACTGAGG - Intergenic
933426772 2:82123552-82123574 CTTGAAGAATATAAGCTCTGAGG + Intergenic
938161690 2:128989960-128989982 GGTTAACATTCTAAGCACTGGGG + Intergenic
939613918 2:144341075-144341097 CTTTAACAGTTTAAGAGCTCAGG + Intergenic
939917524 2:148065493-148065515 CTTTAACAGTAACAGCTCAGAGG + Intronic
940431617 2:153598021-153598043 ATTTAACATTTTAAGAACTGTGG - Intergenic
940737523 2:157470403-157470425 CTTCAACAGAAAAGGCACTGAGG + Intronic
943816692 2:192266636-192266658 ATTTAACAGTATAAAGACTTTGG - Intergenic
945382015 2:209151468-209151490 CTTTAACAGGATGAGCCCTGTGG + Intergenic
946912631 2:224480307-224480329 CTTTGACAGTAAAACCAATGTGG + Intronic
947342058 2:229150714-229150736 CTTTAACAGTATAAGCACTGTGG + Intronic
947910356 2:233796474-233796496 CTTTAACCTAATCAGCACTGTGG + Intronic
948152848 2:235757975-235757997 CTTTAACAGCACAAGGACTGTGG - Intronic
948978503 2:241479652-241479674 CTTCCAGAGTATAAGCACTGGGG - Intronic
1168991566 20:2101075-2101097 CTTTACCTGTATAACCTCTGTGG + Intergenic
1169760937 20:9093344-9093366 ATTTATCAGTAAAAGGACTGAGG - Intronic
1170183908 20:13565592-13565614 CTTTAACAGCATAATCATTATGG + Intronic
1177593678 21:23207791-23207813 CTTTTCAATTATAAGCACTGAGG + Intergenic
1178861865 21:36296528-36296550 TTTTAAAAGTATGAGGACTGGGG + Intergenic
1179361460 21:40713303-40713325 GTTTATCAGTATAAACACAGTGG + Intronic
1182881928 22:33741179-33741201 CTGCAACATTATAAGCACTGAGG + Intronic
1183741986 22:39673957-39673979 CTTCAACAGCTTCAGCACTGCGG - Exonic
949750975 3:7352594-7352616 CTTTAACAGTAGAAACGCTTTGG - Intronic
956677808 3:71752603-71752625 CTTTACCATGCTAAGCACTGGGG + Intronic
957989684 3:87612853-87612875 TTTTAACTTTATAAGTACTGGGG + Intergenic
961596405 3:128021530-128021552 CTTTAACAGTTTCACCACTTTGG - Intergenic
962385809 3:134931351-134931373 CTTCAAAAGTAAAAGAACTGTGG - Intronic
963348212 3:144121845-144121867 ATTTAACAGAAAAAGCCCTGGGG - Intergenic
963724996 3:148909892-148909914 CATTGGTAGTATAAGCACTGGGG - Intergenic
964437285 3:156667479-156667501 CTTTGACAGTATAAGAAGTGGGG + Intergenic
965168166 3:165223638-165223660 ATTTAATAGTATTAGCACTTTGG - Intergenic
965761791 3:172085761-172085783 CTTCCACAGTCAAAGCACTGAGG - Intronic
972919781 4:43924405-43924427 TTTTAATAGAATACGCACTGTGG + Intergenic
973034322 4:45386958-45386980 CTTTAACAAACTAAGCATTGAGG - Intergenic
974593815 4:63990760-63990782 TTTTAACAGTACAACCTCTGTGG + Intergenic
974854991 4:67450751-67450773 CATTTACAGTATAAACAGTGAGG + Intergenic
975609064 4:76186126-76186148 CCTTCACAGTAAACGCACTGTGG + Intronic
975786911 4:77900329-77900351 CTTTAAGAAGATAAACACTGAGG + Intronic
976303676 4:83538294-83538316 CTTTAAAAACATGAGCACTGAGG - Intronic
979467838 4:121060848-121060870 CTTTAATAGTATAAACACTTAGG - Intronic
979800662 4:124904725-124904747 CTGTAACAGTTTAAAAACTGGGG - Intergenic
982824715 4:159988149-159988171 TTTTAACTGTATACGCAGTGTGG - Intergenic
983434634 4:167697182-167697204 CTTTAAGATTAAAAGCAATGGGG - Intergenic
986518262 5:8586195-8586217 CTTTAACATTAAAACCAATGAGG + Intergenic
986825012 5:11511087-11511109 CTTGCACAGTAAAAGCCCTGTGG + Intronic
995375381 5:111468421-111468443 TTTTAATGGTATAAGCACTCTGG - Intronic
1000378295 5:160604924-160604946 CCTTTACAGAAAAAGCACTGGGG - Intronic
1001164503 5:169351343-169351365 CTTTAACAGAATCAGAAATGTGG - Intergenic
1001647907 5:173295829-173295851 CACTTACATTATAAGCACTGAGG - Intergenic
1005207764 6:23424205-23424227 CTTCAACAAAATAAGCAATGGGG + Intergenic
1008276288 6:49548288-49548310 CTTTAAGAGGATAAGCAATTTGG + Intergenic
1009895535 6:69745133-69745155 CTTTAAGAGTTACAGCACTGTGG - Intronic
1012026652 6:94002795-94002817 CTTCAACAGCAGAAGCACGGAGG - Intergenic
1012811475 6:103965026-103965048 GTTTTACAGTCTAAGCACAGAGG - Intergenic
1014886676 6:126790185-126790207 ATTTAATAGTATAACCACTGGGG - Intergenic
1017393439 6:153967803-153967825 CTTTAAGAGTGTAAGCACAAAGG - Intergenic
1018439899 6:163802012-163802034 CTTTAAAAATATATGAACTGGGG + Intergenic
1024303675 7:47907993-47908015 CTTGAACAGTATAAGTAAAGCGG + Intronic
1025984394 7:66435338-66435360 GTTTAAAACTAGAAGCACTGAGG - Intergenic
1028679091 7:93504963-93504985 CTTTTATAGTATAAGCAGTGGGG + Intronic
1030928125 7:115482654-115482676 CATTAACTGATTAAGCACTGTGG - Intergenic
1031785952 7:126032643-126032665 CTTTAGCAGCATCAGCAATGTGG + Intergenic
1033950012 7:146773126-146773148 CGTTAACATTAGAAGCACTTAGG + Intronic
1035578369 8:723794-723816 CTTTAAAATGATAATCACTGTGG + Intronic
1036126867 8:6070960-6070982 CTATAACTGTAGAAACACTGAGG + Intergenic
1037324813 8:17678100-17678122 CTTTTACAGTATGGGCACTGGGG - Intronic
1037442865 8:18934960-18934982 CATTAACAGGATGAGCTCTGCGG + Intronic
1038574153 8:28689593-28689615 CTTTAAAACTATAAGTATTGAGG - Intronic
1038753127 8:30315387-30315409 CTTTAACAGGAAAAGCTCTAGGG + Intergenic
1042811314 8:72828302-72828324 CTTTAACAATCCAAGCACTCAGG - Intronic
1044859612 8:96509834-96509856 CTGTCACAGTCTAAGCAGTGTGG + Intronic
1045089017 8:98719733-98719755 CTTGAAGAGTATCAGCGCTGTGG - Intronic
1045089497 8:98726469-98726491 CATTAACAGGATATGCATTGTGG - Intronic
1046836070 8:118802997-118803019 CTTTTACATTATCAGTACTGAGG + Intergenic
1047772454 8:128040281-128040303 CTTTAAGAGTAAAAAGACTGAGG + Intergenic
1048621786 8:136141600-136141622 CTCTAAAAGTAAGAGCACTGGGG + Intergenic
1054702752 9:68430387-68430409 CTTTAACAGAATAAACATTGTGG - Intronic
1055857117 9:80702556-80702578 CTTTAAGAGCAAAAGCCCTGTGG - Intergenic
1056993396 9:91431634-91431656 CTTGAACAGTTTAACCACAGTGG + Intergenic
1057068427 9:92075635-92075657 CTCTAAGAGTATAAGGGCTGTGG - Intronic
1057420524 9:94908464-94908486 CTCTAAGAGTATAAGAAGTGGGG + Intronic
1186823579 X:13315436-13315458 CTTGCTCAGTATAATCACTGTGG - Intergenic
1194461235 X:94170968-94170990 CTTTAAAAGTATAAGTCCAGTGG - Intergenic
1195081156 X:101372307-101372329 CTTTAAAAGTATTAGAAATGAGG + Intronic
1195600487 X:106741485-106741507 TTTCAACAGAATCAGCACTGTGG + Intronic
1196245556 X:113394837-113394859 CTTTAACACTCTAAGCATTATGG + Intergenic
1197280269 X:124527494-124527516 GGTGAAAAGTATAAGCACTGTGG + Intronic
1198082595 X:133253232-133253254 ATTTCACAGTATAGGCTCTGTGG + Intergenic
1198099301 X:133410550-133410572 CATTAACTGTTTTAGCACTGAGG - Intronic
1199273529 X:145914325-145914347 CTTTGACAGCATAATCACTCTGG + Intergenic
1202060174 Y:20878721-20878743 CTATAACAATTTAGGCACTGAGG - Intergenic