ID: 947344764

View in Genome Browser
Species Human (GRCh38)
Location 2:229179275-229179297
Sequence GGGGCTGATGGGAGCCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 1, 2: 5, 3: 60, 4: 593}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947344764 Original CRISPR GGGGCTGATGGGAGCCATGG AGG (reversed) Intronic
900103907 1:974159-974181 GGGGCAGATGGAGGCCAGGGGGG + Intronic
900305830 1:2007224-2007246 GAGGCTGCGGGGAGCCATGATGG - Intergenic
900827923 1:4941398-4941420 GTTGCTGTTGGGAGCCATGATGG - Intergenic
900987052 1:6079159-6079181 GGGGCTGGTGTGGGCCAGGGAGG - Intronic
901055197 1:6445978-6446000 TGGGCTGATGGGGGCCAGTGAGG + Intronic
901161813 1:7183311-7183333 GGGCCTGATGGGAGTTATTGGGG - Intronic
901340544 1:8494918-8494940 TTGGCTGTTGGGTGCCATGGGGG - Intronic
901677158 1:10892230-10892252 GGTGCCAGTGGGAGCCATGGAGG - Intergenic
902771670 1:18648756-18648778 AGGGCAGCGGGGAGCCATGGAGG + Intronic
903115610 1:21176506-21176528 GGGGCTGGGGGGAGCCTGGGGGG + Intronic
903150865 1:21407621-21407643 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
903534860 1:24060227-24060249 GGGGCTGAGGGGCGCCTCGGTGG - Intronic
903766812 1:25740359-25740381 CAGTCAGATGGGAGCCATGGGGG + Intronic
903832627 1:26183949-26183971 GGGTCTGAAGGGAGCTAGGGGGG - Intronic
904304962 1:29582718-29582740 GGAGAAGATGGGAGCCATGGAGG - Intergenic
904472604 1:30745432-30745454 GGGGCTGAGGGGAGGGAGGGGGG - Intronic
904522086 1:31103311-31103333 GAGGCTGCAGGGAGCCATGATGG + Intergenic
904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG + Intronic
904874653 1:33644719-33644741 GGTGGTGGTGGGAGCAATGGAGG + Intronic
904887523 1:33752251-33752273 GGGCCTGGTGGGACTCATGGGGG + Intronic
904891692 1:33784218-33784240 GGGGCAGTGGGGAGCCATGGAGG + Intronic
905020528 1:34807998-34808020 GGGGCTGCCTGGAGCCTTGGGGG - Intronic
905370193 1:37478975-37478997 GGGGCAGCTGGGGGCCATGGAGG - Intronic
905895769 1:41544987-41545009 GGTGGTGATGGTAGCGATGGTGG - Intronic
905895818 1:41545218-41545240 GGTGGTGATGGTAGCGATGGTGG - Intronic
905895866 1:41545446-41545468 GGTGGTGATGGTAGCAATGGTGG - Intronic
905895877 1:41545503-41545525 GGTGGTGATGGTAGCGATGGTGG - Intronic
906511020 1:46410565-46410587 GAGGCTGAGGGAGGCCATGGGGG - Intronic
906517581 1:46448620-46448642 GGGCCGGACGGGAGCCAAGGCGG + Intergenic
906694410 1:47814470-47814492 GGGGCTTTGGGGAGGCATGGAGG + Intronic
906945631 1:50292011-50292033 GGGCCAGATGGGAGGCAGGGGGG + Intergenic
908267509 1:62393887-62393909 GGTGATGATGGAAGCCCTGGGGG - Intergenic
908642202 1:66237755-66237777 GGGTCTGCTGTGAACCATGGAGG + Intronic
911086284 1:93980077-93980099 GGAGCTGTTTGGAGCCTTGGTGG + Intergenic
911105923 1:94131524-94131546 GGGGATGGTGTGAGCCAGGGAGG - Intergenic
912360812 1:109093425-109093447 GAGGCTGCAGTGAGCCATGGTGG + Intronic
914521943 1:148425582-148425604 GAAGCTGGTGGGAGTCATGGCGG - Intergenic
915593111 1:156881701-156881723 GGGGCTGCTGGGAGCTATGGGGG - Intronic
915940478 1:160115572-160115594 GGGGTTGAGAGGAGCCAAGGGGG + Intergenic
916573193 1:166045137-166045159 AGAGATGATGGGGGCCATGGGGG + Intergenic
918180019 1:182079306-182079328 ACAGCTGATGGGAGCAATGGTGG + Intergenic
918899977 1:190402794-190402816 GAGGCTGCAGGGAGCCATGATGG - Intronic
919007776 1:191921755-191921777 GGGGATGAGGGGAGCGGTGGGGG - Intergenic
919752151 1:201044357-201044379 GGAGCTGGAGAGAGCCATGGTGG - Exonic
920284412 1:204869136-204869158 GGGGCTGGAGGGAGCCAGGGTGG + Intronic
920695640 1:208179621-208179643 GGGGCAGATGAGGGCCCTGGAGG + Intronic
920938123 1:210455049-210455071 GAGGCTGATGGGAGGCCAGGAGG + Intronic
921064400 1:211612441-211612463 GAGGCTGCTGTGAGCCATGATGG - Intergenic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
922224098 1:223630399-223630421 GGGGCTGCAGTGAGCCATGATGG - Intronic
923721883 1:236473833-236473855 GAGGCTGCAGTGAGCCATGGTGG - Intronic
924949028 1:248865855-248865877 GGGGCATATGGGAGACAGGGAGG + Intergenic
1062801150 10:381513-381535 GGGGCTGCTGTAACCCATGGTGG + Intronic
1063160764 10:3416428-3416450 GTGGGAGTTGGGAGCCATGGAGG + Intergenic
1063964450 10:11335722-11335744 GGGGATGTTGGGAGGCATGGGGG + Exonic
1064089004 10:12367596-12367618 GGGGGTGATGGGAGACAGTGAGG + Intronic
1064217967 10:13416556-13416578 GGGGCTGTTGGGTACCAAGGGGG - Intergenic
1067476932 10:46573557-46573579 GGGGCAGGAGTGAGCCATGGAGG + Intergenic
1067617806 10:47768224-47768246 GGGGCAGGAGTGAGCCATGGAGG - Intergenic
1068096630 10:52499457-52499479 GCGGCTGCTGGGAGGGATGGGGG + Intergenic
1068290908 10:55000761-55000783 GGGACTGACTGAAGCCATGGTGG - Intronic
1071043761 10:81347760-81347782 GGGGAGGATGGGAGAAATGGAGG - Intergenic
1072781826 10:98256824-98256846 GGGGCTCACCGAAGCCATGGTGG - Exonic
1073486052 10:103819838-103819860 GGGGGAGATGGGAGCCCAGGAGG + Intronic
1073592595 10:104771072-104771094 TGGGCTGATGGTTGCCATGTTGG + Intronic
1074163909 10:110858247-110858269 TGGGCAGATCAGAGCCATGGGGG - Intergenic
1075263190 10:120980151-120980173 GGGGCTGAGGGGCCCTATGGGGG + Intergenic
1075925011 10:126244502-126244524 GGGGATCATGGTAGACATGGTGG + Intronic
1076261859 10:129072828-129072850 AAGGCTGATGGTAGCCAAGGAGG + Intergenic
1076797516 10:132805407-132805429 GAGGCTGATGGGAGCCAGAAAGG + Intergenic
1076882166 10:133244974-133244996 GGGGCTGAGGGGCACCATGGGGG - Intergenic
1077033095 11:479020-479042 GGGGCTGAGCGGGGCCGTGGAGG + Intronic
1077062785 11:625175-625197 GCGGCTCATGGGTGCCGTGGGGG + Intronic
1077094370 11:793072-793094 GAGGATGGTGGGAGCCGTGGAGG + Intronic
1077097333 11:804657-804679 GGTGCTCCTGCGAGCCATGGCGG - Intronic
1077158826 11:1103489-1103511 GGGGACGGTGGGAGCCGTGGGGG - Intergenic
1077239334 11:1502463-1502485 GTGCCTGGTGGGAGTCATGGGGG - Intergenic
1077332699 11:1990369-1990391 GTGACTGTGGGGAGCCATGGTGG - Intergenic
1077378912 11:2218936-2218958 GGGCCTGATGTGAGCCGTTGGGG - Intergenic
1078180792 11:9008305-9008327 AGGGCTGATGGCAGCCCTGCTGG + Intergenic
1079129947 11:17741504-17741526 GAGCCTGAGGGGAACCATGGTGG - Intronic
1079350265 11:19686114-19686136 GGGGCAGAGAGGAGCCAAGGAGG - Intronic
1079574247 11:21983599-21983621 AGTGCTGATGGGAGCCAAGAAGG - Intergenic
1080688820 11:34538427-34538449 GGGAGTGAGGGGAGCCATGTGGG - Intergenic
1082941125 11:58706615-58706637 GGTGCTGTTGGGGGGCATGGTGG + Intronic
1083221997 11:61258713-61258735 GGGGCTGCTGGGGGCCAGGGTGG + Exonic
1083470053 11:62878349-62878371 GAGGCTGCAGTGAGCCATGGTGG - Intronic
1083630514 11:64092729-64092751 GGGGCTGCTGTGTGCCATGCAGG - Intronic
1083683017 11:64359899-64359921 GGGCCTGCTGCGAGGCATGGGGG - Intronic
1083776139 11:64895128-64895150 GGGGCTGACGGGCGCCGTGGGGG - Exonic
1083901567 11:65645983-65646005 GGGGCTTCCGGGAACCATGGAGG + Intronic
1083960815 11:66013877-66013899 GGAGCTCATGGGTGGCATGGGGG + Intergenic
1084180054 11:67441667-67441689 GGGGCTGCTGGGATGTATGGAGG + Intronic
1084254417 11:67929913-67929935 GAGGCTGCTGTGAGCCATGACGG + Intergenic
1084357240 11:68648108-68648130 GGGGCTGAAGTGAGCCAAGATGG - Intergenic
1084475605 11:69386972-69386994 GGGGTTGAAGGGAGGCCTGGAGG - Intergenic
1084558453 11:69889304-69889326 GGTGCTGATGGGAGCTCTGGGGG - Intergenic
1084818453 11:71665970-71665992 GAGGCTGCTGTGAGCCATGACGG - Intergenic
1084870705 11:72096967-72096989 GGGGGTGAAGGGAGACATGGCGG - Intronic
1085810156 11:79672643-79672665 TGGGCAGTGGGGAGCCATGGAGG + Intergenic
1086450140 11:86907528-86907550 GAGGCTGCAGGGAGCCATGATGG - Intronic
1086595330 11:88563944-88563966 GGAGCTCATGGAAGCCATAGAGG + Intronic
1088545690 11:110956477-110956499 GGGGATGGTGTGGGCCATGGGGG + Intergenic
1089128165 11:116191880-116191902 GGAGGGGGTGGGAGCCATGGAGG + Intergenic
1089309028 11:117545699-117545721 GGAGCTGAGGGGAGGCAGGGAGG + Intronic
1089466575 11:118689881-118689903 GGGGCTGCTGGGAGGCAGAGCGG - Intergenic
1089894759 11:121918950-121918972 TAGGGTGATGGAAGCCATGGTGG + Intergenic
1090332563 11:125943192-125943214 CAGGCTGATGTGAGCCCTGGGGG + Intergenic
1090625640 11:128606130-128606152 GTGGGAGAGGGGAGCCATGGAGG - Intergenic
1091057246 11:132430502-132430524 GCGGCTCCTGGGAGCCATGAGGG - Intronic
1091230437 11:133984567-133984589 GGGCTTGATGGGAGCCCTTGTGG - Intergenic
1202815682 11_KI270721v1_random:45545-45567 GTGACTGTGGGGAGCCATGGTGG - Intergenic
1091793093 12:3282705-3282727 GGGGCTCACAGGAGCCAAGGTGG - Intronic
1092257738 12:6936518-6936540 GGGGCTGATTGGAGACAGAGAGG - Exonic
1093488769 12:19681515-19681537 GGGGCTGTTAGGGGGCATGGTGG - Intronic
1094386281 12:29897109-29897131 GGGGCTAATTGGAGTCATGGGGG - Intergenic
1094488716 12:30945308-30945330 GGAGCTGACAGAAGCCATGGAGG - Intronic
1094523792 12:31218790-31218812 GGGGCTGAAGAGAGCCTGGGAGG + Intergenic
1094609480 12:31979600-31979622 GAGGCTGCAGTGAGCCATGGTGG - Intronic
1095399729 12:41800667-41800689 GGGGGAGATGGGAGGCATGGAGG - Intergenic
1095960838 12:47833335-47833357 GGGGCTGCTGGGAGCCTGGCTGG + Intergenic
1096238184 12:49943734-49943756 GAGGCAGCTGGGAGCCATTGTGG - Intergenic
1096618172 12:52846390-52846412 GGGGGTCTTGGGAGGCATGGTGG - Intronic
1097173112 12:57128451-57128473 GGGGCTGATGGGGGAGAGGGAGG - Intronic
1098105775 12:67068675-67068697 GGGGGTGATGGTGGGCATGGAGG - Intergenic
1098445523 12:70562217-70562239 GAGGCTGCAGGGAGCCATGATGG + Intronic
1099352943 12:81595042-81595064 GGAAATGAGGGGAGCCATGGTGG + Intronic
1100554970 12:95684361-95684383 GAGGCTGCAGTGAGCCATGGTGG - Intronic
1101326253 12:103718349-103718371 GGGGGTGGTAGGGGCCATGGAGG - Intronic
1101927069 12:108980973-108980995 GGGGCTGATGAGATCCTCGGAGG - Intronic
1102015110 12:109643117-109643139 GAGGGAGCTGGGAGCCATGGTGG - Intergenic
1102205780 12:111089931-111089953 GAGGGTGATGGGAGCCATGGAGG + Intronic
1102674725 12:114649809-114649831 GGGTCAGAAGGGAGCCCTGGCGG - Intergenic
1102923323 12:116808958-116808980 GGGGCTGATGGCAGCTGGGGCGG - Intronic
1103438716 12:120947233-120947255 GGGGCTGAGAGGAGTGATGGAGG - Intergenic
1103864048 12:124037350-124037372 GGGGGTGATGGGGCCCATGCTGG + Intronic
1103883836 12:124186431-124186453 GCAGCCGTTGGGAGCCATGGAGG + Intronic
1104729079 12:131095100-131095122 GGGACTGAAGGGAGAGATGGGGG - Intronic
1104831389 12:131754376-131754398 GGGGATGATGGCGGCCACGGGGG - Exonic
1104837028 12:131798237-131798259 GAGGCTGCTGTGAGCCATGACGG + Intronic
1104933511 12:132352714-132352736 GAGGCTGCTGGGAGCCGTGATGG + Intergenic
1107725373 13:43293486-43293508 GGAGGTGATGGTTGCCATGGTGG - Intronic
1109756775 13:66771327-66771349 GGGGCTGAAGGGAGGAATGGAGG - Intronic
1110983500 13:81934119-81934141 GGGGCTCAGGGGAGGCATAGAGG + Intergenic
1113742979 13:112724124-112724146 GGGGGTGAAGGGGGCGATGGGGG - Intronic
1113794726 13:113050638-113050660 GGGGGCGGTGGGAGCCGTGGGGG + Intronic
1117041745 14:51774563-51774585 GTGGTTCATGAGAGCCATGGGGG + Intergenic
1117807631 14:59511041-59511063 GTGGATAATGGTAGCCATGGTGG + Intronic
1118156619 14:63248846-63248868 GGAGCTGCTGGGAGCCATCTGGG - Intronic
1118720324 14:68589473-68589495 GGGGCTTGTGGCAGTCATGGGGG - Intronic
1119633695 14:76256834-76256856 GAGGCTGATGGGAGGCTTTGAGG - Intergenic
1119652225 14:76392102-76392124 GGGCCTGCTGAGAGCCATGGGGG - Intronic
1120999370 14:90440460-90440482 AGGGCTGATGGGAGCTCGGGAGG + Intergenic
1122017502 14:98808598-98808620 GGGGCAGATGGAAGCGAGGGAGG - Intergenic
1122065277 14:99168824-99168846 AGAGCTGTTGTGAGCCATGGGGG - Intergenic
1122196383 14:100089866-100089888 GAGGCTGCAGTGAGCCATGGTGG + Intronic
1122778082 14:104131611-104131633 GGGGGTGAGAGGAGCCAGGGTGG + Intergenic
1122976808 14:105174182-105174204 GGGGCTGCTGGCAGCCAGGAGGG + Intronic
1123027661 14:105435348-105435370 GGGGCTGCAGTGAGCCATGATGG - Intronic
1123044234 14:105503540-105503562 GGGGATGAGGGGGGCCACGGAGG + Intergenic
1123946311 15:25240534-25240556 GGGGCTATGGGGAACCATGGGGG + Intergenic
1124476312 15:30037997-30038019 GGGGTCGCTGGGAGCCATGCTGG + Intergenic
1124479759 15:30068221-30068243 GGGCCTGATGGGAAGCAGGGTGG - Intergenic
1125008594 15:34845968-34845990 GAGGCTGCTGTGAGCCATGGTGG - Intergenic
1125349556 15:38752977-38752999 GGGTCTGATGGGAGGCATTTGGG + Intergenic
1125503589 15:40253802-40253824 GGTGCTGCTGGGAGCACTGGAGG + Intronic
1125510679 15:40290946-40290968 GGGGCGAATGGGGTCCATGGGGG + Intronic
1125592599 15:40864185-40864207 AGGTCTGCTGGGAGCCAGGGAGG + Intergenic
1126152913 15:45539193-45539215 GGGCATGATGGGTGCCATGCAGG - Intergenic
1126599879 15:50417955-50417977 GGGACTGGTGGCAGCCATAGAGG - Intergenic
1127068585 15:55265790-55265812 GTGGCTGAAGGGATGCATGGAGG + Intronic
1127834181 15:62776862-62776884 GGGGCTGGTTGGGGGCATGGTGG + Exonic
1128220586 15:65965546-65965568 GGGGCTGGAGGGAGCCAGTGAGG + Intronic
1128482913 15:68054842-68054864 GGGGCTACTGGGATCCACGGAGG - Intronic
1128669503 15:69563939-69563961 GAGGCTGCTGTGAGCCATGATGG - Intergenic
1128943660 15:71807765-71807787 GGGGCTGAGGGGTGGCAGGGAGG - Intronic
1129184233 15:73896127-73896149 GGAGGAGATGAGAGCCATGGCGG + Intergenic
1129192600 15:73946340-73946362 GGGGCTGAGGGGGCCCATGCTGG + Intronic
1129228086 15:74181394-74181416 TGTGCTGGTGGGTGCCATGGTGG - Exonic
1129272516 15:74426898-74426920 TGGGCAGTTAGGAGCCATGGTGG - Intronic
1129466833 15:75728772-75728794 TGGGAGGGTGGGAGCCATGGAGG + Intergenic
1129720402 15:77874982-77875004 AGGGAGGGTGGGAGCCATGGAGG - Intergenic
1129771839 15:78207816-78207838 GGCCCTGATGGCAGCCATGAAGG + Intronic
1130008773 15:80130052-80130074 GGGGTAGTTGGGAGCCATTGAGG + Intronic
1130610897 15:85360123-85360145 GGGGCAGATGGGAGCCAGAAAGG + Intergenic
1130961755 15:88664048-88664070 TGGGATGATGGCAGCCATGGGGG + Intergenic
1132612608 16:824782-824804 GGGCCTGCTGAGAGCCCTGGTGG + Intergenic
1132629338 16:909266-909288 GGGGAAGATGGGAGCCACAGGGG + Intronic
1132698224 16:1211351-1211373 GGCGCTGCTGGGAGCCACGCTGG - Intronic
1132931739 16:2462250-2462272 TGGGCTTGTGGGAGCCCTGGGGG + Intronic
1133056155 16:3146344-3146366 TGGGCTGCTGGGAGCCAAGAGGG - Intronic
1133165971 16:3947466-3947488 GAGGCTGAAGTGAGCCATGAGGG - Intergenic
1133254878 16:4510452-4510474 GTGGCTGCTGGGAGCCATGATGG - Intergenic
1133473188 16:6095416-6095438 GGAGCTGATTGGACCCTTGGGGG + Intronic
1133921732 16:10159477-10159499 GGAGCTGATGGGATGCTTGGAGG + Intronic
1134432527 16:14224188-14224210 GGGCCTGGTGGGAATCATGGGGG - Intronic
1134501496 16:14772424-14772446 CAGACTCATGGGAGCCATGGAGG - Intronic
1134579064 16:15356455-15356477 CAGACTCATGGGAGCCATGGAGG + Intergenic
1134723522 16:16401095-16401117 CAGACTCATGGGAGCCATGGAGG - Intergenic
1134943907 16:18310775-18310797 CAGACTCATGGGAGCCATGGAGG + Intergenic
1135115153 16:19717902-19717924 TGGGCCCATGGGAGCCTTGGAGG - Exonic
1135425676 16:22333487-22333509 GTGGCTGGTAGTAGCCATGGTGG + Intronic
1136172573 16:28497636-28497658 AGAGGGGATGGGAGCCATGGTGG + Exonic
1136477056 16:30520021-30520043 GGATCTGGTGGGAGCCAGGGAGG + Intronic
1136626453 16:31464939-31464961 TGGGCCCATGGAAGCCATGGGGG - Intronic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1138391873 16:56676117-56676139 GGGGCAGGTGGGAGGCGTGGTGG - Exonic
1138679520 16:58674936-58674958 AGGGCTGCTGGGAGTCATCGAGG - Intronic
1139356022 16:66367425-66367447 GGTGCTGGTGGGAGGAATGGTGG - Intronic
1139434546 16:66928491-66928513 GGGGATGAAGGGAGTCATGGGGG - Intergenic
1139521579 16:67485757-67485779 GAGGCTGCAGTGAGCCATGGTGG + Intergenic
1140949274 16:79800590-79800612 GGGGCTGCTAGGAGCCACTGTGG - Intergenic
1141712606 16:85708695-85708717 GGTGCTGGGTGGAGCCATGGTGG - Intronic
1141767460 16:86067963-86067985 GGGAGGGGTGGGAGCCATGGGGG + Intergenic
1142418187 16:89954380-89954402 GGTGCTGGTGGGAGTCAGGGTGG + Intronic
1142427929 16:90010734-90010756 GGGGCTGAGGGGATCTGTGGAGG - Intronic
1142613835 17:1123962-1123984 GGGGCAGGTGGGAGGCAAGGGGG - Intronic
1142614249 17:1125571-1125593 GGGGCTGCTGGGAGGCGGGGAGG + Intronic
1142961174 17:3553382-3553404 AGGGCAGTGGGGAGCCATGGAGG - Intronic
1143088971 17:4437241-4437263 GGGGCTGAGAGGAGCCCAGGAGG + Intronic
1143229582 17:5341214-5341236 GAGGCTGTGGTGAGCCATGGTGG + Intronic
1143386553 17:6534478-6534500 GGGGCTGATGGCTGCAAGGGAGG + Intronic
1143406110 17:6678121-6678143 GGGGCTCATGTCAGCCATTGCGG - Intergenic
1143483340 17:7239261-7239283 GGCGATGCTGGAAGCCATGGCGG - Exonic
1143514989 17:7415035-7415057 GCGGCTGCTGGCAGCCAAGGTGG + Exonic
1144088448 17:11831878-11831900 GTGGGTGATGGGGACCATGGTGG - Intronic
1144389445 17:14780000-14780022 GGGGCTGATGCCGGCGATGGAGG + Intergenic
1144829182 17:18122066-18122088 GGCCCTGATGGGCGCCAAGGGGG - Exonic
1144830864 17:18130540-18130562 TTGGCTGGTGGTAGCCATGGGGG + Intronic
1144960105 17:19039976-19039998 AGGGCAGTTGGGAGCCATGGAGG - Intronic
1144975055 17:19134548-19134570 AGGGCAGTTGGGAGCCATGGAGG + Intronic
1145900999 17:28490498-28490520 GGGGCTGCTGGTGGCCATCGCGG + Exonic
1146172050 17:30641935-30641957 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146345508 17:32057971-32057993 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146642602 17:34552656-34552678 GAGGCAGATGGTAGCCATGGAGG + Intergenic
1147265410 17:39231625-39231647 GGGGCTGACAGCAGCCATGGTGG + Intergenic
1147433128 17:40386605-40386627 GGGGCTGCAGTGAGCCATGATGG - Intergenic
1147448198 17:40487796-40487818 AGGGCTCCTGGGAGTCATGGGGG - Intronic
1147769943 17:42860541-42860563 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
1148766876 17:50044677-50044699 TGGGATGATGGCGGCCATGGTGG - Intergenic
1149627569 17:58090610-58090632 GGAGCTTCTGGGAGCCTTGGAGG + Exonic
1150302152 17:64055697-64055719 GGGGCTGCTGCCAGCCTTGGAGG + Exonic
1150353870 17:64466756-64466778 GGGGTGGATGGGAGCAATGCAGG + Intronic
1150649609 17:67001321-67001343 GGAGCTGGAGGGAGCCATGTGGG - Intronic
1151552196 17:74828556-74828578 GAGGCTCTTGGGAGCCATAGAGG - Intronic
1152080994 17:78187114-78187136 GGCGCTGATTGGCCCCATGGCGG - Exonic
1152343368 17:79737498-79737520 GGGGCTGGAGGGAGCGAGGGTGG + Intronic
1153290678 18:3499011-3499033 GGGGCTGAGGGGGGCCCGGGGGG + Exonic
1153449977 18:5216434-5216456 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
1155062724 18:22242828-22242850 GGGGCCGCTAGGATCCATGGGGG - Intergenic
1155073171 18:22333949-22333971 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1160016136 18:75142006-75142028 GGCTCTGCTGGGAGCCACGGGGG - Intergenic
1160031965 18:75269816-75269838 GTGGCTGCTGGGAGCCAGGGGGG - Intronic
1160156448 18:76437336-76437358 GGGGCTGCTGGGCGGCAGGGAGG + Intronic
1160400174 18:78604767-78604789 GTGGCTGATATCAGCCATGGGGG + Intergenic
1160502683 18:79410186-79410208 GGGGCTCACGGGAGCCTTGTTGG + Intronic
1160508102 18:79438392-79438414 TGGGATGGTGGGTGCCATGGAGG - Intronic
1160559673 18:79748376-79748398 GGGCCTGGGGGGACCCATGGAGG + Intronic
1160671827 19:368795-368817 GAGGCTGGAGGGAGCCAGGGAGG - Intronic
1160747648 19:719509-719531 GCGGCTGCCGGGAGCCAGGGAGG + Intronic
1160758577 19:771465-771487 GAGGGAAATGGGAGCCATGGAGG - Intergenic
1160809692 19:1008023-1008045 GGGGCAGTGGGGAGCCACGGAGG + Intronic
1161038501 19:2098011-2098033 GAGGCTGAGGGGAGCCCTGGCGG + Intronic
1161195424 19:2983693-2983715 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161220307 19:3115338-3115360 GAGGCTGAAGTGAGCCATGATGG + Intronic
1161238846 19:3210804-3210826 AGGGCAGCTGGGAGCCATGGAGG + Intergenic
1161257329 19:3316595-3316617 GAGGAAGGTGGGAGCCATGGAGG + Intergenic
1161431254 19:4233592-4233614 AAGGCAGGTGGGAGCCATGGAGG - Intronic
1161477711 19:4495654-4495676 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161480041 19:4505871-4505893 GGGGCTGAGGGGAGGCCGGGCGG - Intronic
1161482976 19:4519889-4519911 GGAGAAGGTGGGAGCCATGGAGG - Intergenic
1161492110 19:4567786-4567808 GAGGCAGGTGGGAGCCATGGAGG - Intergenic
1161592841 19:5136545-5136567 GGGGCAGATGGGCTCCCTGGGGG + Intronic
1161596679 19:5154259-5154281 GAGGGAGGTGGGAGCCATGGAGG + Intergenic
1161599192 19:5170523-5170545 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161610213 19:5238135-5238157 TGGGCTGAGCGGAGCCAGGGAGG + Intronic
1161619180 19:5289482-5289504 GAGGCAGGTGGGAGCCATGGAGG - Intronic
1161619735 19:5291781-5291803 CGTGTTGATGGGAGCCATGGAGG - Intronic
1161620950 19:5296802-5296824 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161621396 19:5299174-5299196 GAGGGAGGTGGGAGCCATGGAGG - Intronic
1161644478 19:5444629-5444651 GAGGAAGATGGGAGCCATGGAGG - Intergenic
1161663843 19:5563195-5563217 GAGGGAGGTGGGAGCCATGGAGG + Intergenic
1161756450 19:6137544-6137566 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1162087875 19:8259464-8259486 GGGGGAGATGGGAGCCATGGAGG + Intronic
1162304463 19:9863326-9863348 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1162308071 19:9887719-9887741 AGGGGAGATGGGAGCCATGGAGG - Intronic
1162315246 19:9934844-9934866 GGGGGTGTTGGGAGGAATGGAGG - Intronic
1162337868 19:10072836-10072858 GGGGCTGAAGGGAGGGAGGGTGG + Intergenic
1162534088 19:11253057-11253079 GAGGGCGGTGGGAGCCATGGAGG + Intronic
1162871682 19:13591199-13591221 GAGTCAGGTGGGAGCCATGGAGG + Intronic
1162894663 19:13758000-13758022 GAGGAAGGTGGGAGCCATGGAGG - Intronic
1162990373 19:14298102-14298124 GCGGCTGCTGGGAGCCAGAGAGG + Intergenic
1163174534 19:15555185-15555207 AGGGCTTAAGGGAGCCCTGGGGG + Intergenic
1163365035 19:16871116-16871138 AGGGCTGTTGGGCCCCATGGGGG + Intronic
1163456036 19:17406129-17406151 GGGGACTATGGGAGACATGGAGG + Intronic
1163727989 19:18933203-18933225 GGGGCCACAGGGAGCCATGGAGG - Intronic
1164023919 19:21332979-21333001 GGGGCTGCAGTGAGCCATGATGG + Intergenic
1164539734 19:29113881-29113903 AGGGATGATGGGAACCATGCGGG + Intergenic
1164941038 19:32252497-32252519 GGCGGTGAGGGGAGGCATGGTGG - Intergenic
1165317585 19:35066043-35066065 GGTCCAGATGGGAGCCAGGGTGG + Intronic
1165468242 19:35987577-35987599 GAGGCTGCAGTGAGCCATGGTGG + Intergenic
1165808773 19:38597658-38597680 GGGGCTGAGGGAAGGGATGGAGG - Intronic
1166112735 19:40632837-40632859 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
1166203552 19:41253969-41253991 GGGGCTGAGGTGACCGATGGGGG + Intronic
1166558231 19:43715826-43715848 GGGGGTGATGGAGACCATGGAGG + Intergenic
1166665986 19:44680720-44680742 AGGGCACAGGGGAGCCATGGAGG - Intronic
1166673913 19:44727710-44727732 GAGGGAGATGGGAGCCATGGAGG - Intergenic
1166871152 19:45872100-45872122 GGAGTTGAGGGGGGCCATGGTGG - Exonic
1167036615 19:46998780-46998802 GGGGCTGATGGAAACAGTGGGGG - Intronic
1167043259 19:47035332-47035354 GGGAGTCATGGCAGCCATGGTGG + Intronic
1167497543 19:49828405-49828427 GGGGATGATGGCAACCCTGGGGG + Intronic
1167606274 19:50482482-50482504 GGGGCTGCATGGGGCCATGGGGG - Exonic
1167658596 19:50782557-50782579 GGGGGTGGGGGGTGCCATGGAGG - Intergenic
1168310371 19:55456917-55456939 GGGGCTGATGGTGACCAGGGCGG - Intronic
1168409204 19:56128157-56128179 GAGGCTGCAGTGAGCCATGGTGG + Intergenic
1168588643 19:57614758-57614780 GAGGACGATAGGAGCCATGGCGG + Intronic
925366440 2:3315148-3315170 GGTGATGATGGTAGGCATGGGGG - Intronic
926166478 2:10524414-10524436 AGGGCTGAGGGCAGCCATGGTGG + Intergenic
926741621 2:16115998-16116020 GGTGGTGAGGGGAGCAATGGTGG + Intergenic
927961460 2:27242846-27242868 GAGGGTGAGGAGAGCCATGGTGG - Intronic
928167445 2:28981399-28981421 GTGGCTGGTGGGGGCCAGGGTGG + Exonic
929499506 2:42478298-42478320 GGGGCTGCAGTGAGCCATGAAGG - Intronic
929711314 2:44269690-44269712 TGGGCTGAGGGGAGGCAAGGGGG + Intergenic
929830806 2:45344756-45344778 GGGGCTAGTGTGAGCCATGTGGG - Intergenic
932298996 2:70651000-70651022 GAGGCTGCAGTGAGCCATGGTGG + Intronic
932449261 2:71799153-71799175 GGCGGTGAAGGTAGCCATGGTGG - Intergenic
932481243 2:72040694-72040716 TGGGCAGTAGGGAGCCATGGTGG - Intergenic
933470374 2:82715521-82715543 GAGGCTGAGGTGAGCCATGATGG - Intergenic
934753620 2:96810282-96810304 GGGCCAGATGGGAGGCAGGGTGG - Exonic
935014164 2:99164296-99164318 GGGGAGGAGGGGGGCCATGGGGG - Intronic
935588643 2:104824611-104824633 GGTGGTGATGGCAGTCATGGTGG + Intergenic
935693524 2:105750854-105750876 GGGGCCAATGGCAGCCAGGGTGG + Intronic
935830799 2:106999170-106999192 GGGGATCTTGGGAGCCATGGAGG - Intergenic
936501802 2:113072551-113072573 TGGGCTGGTGGAAGCCTTGGTGG + Exonic
937241949 2:120467573-120467595 TGGGCTGCAGGGAGCCAGGGTGG + Intergenic
937318259 2:120945688-120945710 GGGGCTGCTGGAGGCCATGCAGG - Intronic
937928100 2:127183207-127183229 GGGGGTGGTGGGGCCCATGGGGG - Intergenic
940290554 2:152074225-152074247 GGTGCTGATGGTAGCTGTGGTGG - Intronic
941512795 2:166434623-166434645 GGCTCCTATGGGAGCCATGGAGG - Intronic
942951666 2:181728810-181728832 GAGGCTGATGGGAGCCATGGAGG - Intergenic
944412601 2:199458340-199458362 GGGGCGGGTGGGAGGCAGGGAGG + Intronic
946194402 2:218024487-218024509 GGAGCTGATGGGGGCAGTGGAGG + Intergenic
947344764 2:229179275-229179297 GGGGCTGATGGGAGCCATGGAGG - Intronic
947749818 2:232526239-232526261 GGGGCTGCTGGCTGCCCTGGCGG + Exonic
947856414 2:233327400-233327422 GGGGCTTACGTGAGCCCTGGAGG - Intronic
947939265 2:234035336-234035358 GGGGCTGTTGGGTCCCAGGGCGG - Intergenic
948135116 2:235630797-235630819 GGGGCTGAGCGTTGCCATGGTGG - Intronic
948423490 2:237874475-237874497 GGGGCTGGTGTGAGCAGTGGAGG - Intronic
948572761 2:238927741-238927763 AGGGGAGATGGGGGCCATGGGGG + Intergenic
948691911 2:239711544-239711566 GGGGGTGATGGGATCCACTGTGG - Intergenic
948728950 2:239951541-239951563 GGTGCTGAGGGGACCCAGGGAGG - Intronic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
1169375814 20:5065936-5065958 GGGGCTGATGTGAGGAAGGGTGG + Intergenic
1169731008 20:8785580-8785602 GGGTGTGATGGGAGCCAAGAGGG + Intronic
1172448122 20:35003644-35003666 GGGGCTGGTGGGAGCCCCAGTGG + Intronic
1172764081 20:37341810-37341832 GGAGGTGGTGGGAGCCACGGAGG - Intergenic
1172777259 20:37414904-37414926 GGTGCTGGTGAGAGCCATGCGGG - Intergenic
1172782919 20:37447809-37447831 AGGGCTGATGGAAGCCAAGGAGG - Intergenic
1173652872 20:44678494-44678516 GAGGGTGATGGGGGCCATGATGG + Intergenic
1173681349 20:44884828-44884850 GGAGGGGAGGGGAGCCATGGAGG + Intergenic
1173812481 20:45964451-45964473 AGGGCTGATGGGAGGGAAGGAGG + Intronic
1174160374 20:48546203-48546225 AGGGCTGAAGGGAGGAATGGTGG - Intergenic
1174196069 20:48773774-48773796 GGGTAAGGTGGGAGCCATGGAGG + Intronic
1174360913 20:50028504-50028526 GGGGCTGCAGTGAGCCATGATGG - Intergenic
1174396632 20:50250795-50250817 GAGGCTGATGTGAGCCAATGAGG + Intergenic
1174421267 20:50400554-50400576 GGGGTAGGTGAGAGCCATGGAGG + Intergenic
1174424647 20:50423456-50423478 GGGGGAGATGGCAGCCTTGGTGG - Intergenic
1175788486 20:61726590-61726612 GGTGATGATGGCAGCAATGGTGG - Intronic
1175939466 20:62531380-62531402 GGGGTGGCGGGGAGCCATGGGGG - Intergenic
1175988142 20:62774519-62774541 TGGGCTGGCGGGAGGCATGGAGG + Intergenic
1176030412 20:63008711-63008733 AGGGCTGGTGGGGGCCATGGGGG + Intergenic
1176051108 20:63120192-63120214 GGGGCAGCTGGGAGCCTGGGAGG - Intergenic
1176094311 20:63332976-63332998 GGGGCTGATGGGAGACGTGCAGG - Intronic
1176120343 20:63451752-63451774 GGGGCTGCAGGGGGCCATGCTGG - Intronic
1176654333 21:9576379-9576401 GGCTCTGCTGGGAGCCCTGGGGG - Intergenic
1178142529 21:29700272-29700294 GGGGATGATGGGTGCAATGAAGG + Intronic
1178742952 21:35220219-35220241 GGGCCTGTTGGGAGGCAGGGTGG + Intronic
1178767475 21:35467948-35467970 GGAGATGATGGGGGCCTTGGGGG - Intronic
1178839380 21:36126627-36126649 GAGGCTGTTGAGTGCCATGGGGG - Intergenic
1179101922 21:38361612-38361634 GAGGCTGAAAGCAGCCATGGTGG - Intergenic
1179192204 21:39133175-39133197 GGGGCTGAGGTGAGCCGAGGGGG + Intergenic
1179295929 21:40062410-40062432 GGAGCTGAAGGGTGCCCTGGTGG + Intronic
1179777021 21:43671428-43671450 GGGGCTGTAGTGAGCCATGATGG - Intronic
1181571127 22:23768237-23768259 GGGGTTGTTGCGAGCCCTGGAGG + Exonic
1181801522 22:25350795-25350817 GGGGCTGAAGGGAGTCACGGTGG - Intergenic
1182074845 22:27488456-27488478 GGTGCTGGTGGGGGCCAGGGAGG + Intergenic
1182109165 22:27710745-27710767 TGGGGCCATGGGAGCCATGGAGG - Intergenic
1182120847 22:27785752-27785774 GGGGCTGGGAGGGGCCATGGGGG - Intronic
1182318695 22:29464463-29464485 AGGGCTGATGGGAGCACTGCTGG - Intergenic
1182437114 22:30337775-30337797 GTGGATGATGGGCGGCATGGGGG + Exonic
1182930144 22:34165894-34165916 GAGGAGGATGGGAGCCAAGGGGG + Intergenic
1183362331 22:37389253-37389275 GGGGCCAGTGGGAGCCATTGTGG - Intronic
1183477931 22:38046291-38046313 GGGGCTACAGGGAGCCACGGAGG - Intergenic
1183485801 22:38087144-38087166 GGGGTTCATGGGTGTCATGGGGG + Exonic
1183543426 22:38443079-38443101 GGGGCTGAGGGGAGACTAGGAGG - Intronic
1183744673 22:39685735-39685757 GGGGGAGGTGGGAGCCGTGGAGG - Intronic
1184117826 22:42432287-42432309 GGGGCTGCGGGGAGCCCAGGAGG + Exonic
1184416669 22:44355872-44355894 GGGGCCGATGGGGGCCACTGTGG - Intergenic
1184492919 22:44820554-44820576 GGGGCTGGTGGGACCCCTGCAGG - Intronic
1184493721 22:44825424-44825446 GGGGCAGCTGGCAGCCACGGAGG - Intronic
1184508064 22:44916340-44916362 GGCGGTGCTGGGGGCCATGGCGG + Exonic
1185059189 22:48597258-48597280 CCGGGTGATGGGGGCCATGGTGG - Intronic
1185263517 22:49884877-49884899 TGGGCTGATGGAAGACGTGGCGG + Exonic
1185289768 22:50017458-50017480 GGGCCTGATGGGACCCACCGGGG + Intronic
949488799 3:4567551-4567573 GGGGCTGAGGTGGGTCATGGAGG + Intronic
950078936 3:10207497-10207519 GTGGGTGAGGTGAGCCATGGTGG - Intronic
950095307 3:10325647-10325669 GGGGTTGGCGGGAGCAATGGAGG + Exonic
950145506 3:10647061-10647083 GGGCTTGGTGGGAGCAATGGGGG + Intronic
950170322 3:10834671-10834693 GGGGCAGATGGAAGACATGCAGG + Intronic
950563398 3:13749091-13749113 GAGGAAGGTGGGAGCCATGGAGG - Intergenic
950664094 3:14484428-14484450 GGGGAAGGTGGGAGCCATGGAGG + Intronic
950884011 3:16347150-16347172 TGGGTTGAAGGGAGCCATAGTGG - Intronic
951601693 3:24383391-24383413 GGGGCTGAGGGAAGAAATGGGGG + Intronic
951880785 3:27479347-27479369 GGGGCTGCAGTGAGCCATGATGG + Intronic
952268163 3:31806791-31806813 GGGGGTGGGGGGAGCCATGTGGG + Intronic
952733840 3:36668045-36668067 GGGGATTATGGGAGCTACGGTGG + Intergenic
952879309 3:37973427-37973449 GGGGCAGGTGGGAGCCATCCAGG - Intronic
952882678 3:37994485-37994507 GGGGCAGGAGGGAGCCGTGGAGG + Intronic
953004541 3:38965888-38965910 GAGACTCATGGGAGCCCTGGAGG + Intergenic
953582575 3:44170476-44170498 GGGTAGGATGAGAGCCATGGAGG - Intergenic
953661377 3:44894044-44894066 GGGGTGGAAGAGAGCCATGGTGG - Intronic
953661445 3:44894232-44894254 GGGGTGGAAGAGAGCCATGGGGG - Intronic
954097211 3:48338237-48338259 GGATCAGATGGGAGCCAGGGAGG + Intergenic
954152147 3:48662882-48662904 GGGGCGGCCGGGAGCCATGTTGG - Exonic
955747646 3:62155894-62155916 GGGGCTGGTGGAAGCCATGAAGG + Intronic
955753148 3:62203198-62203220 CGAGCTGATGGGGGCCATGTCGG - Exonic
956813021 3:72883127-72883149 GGGGCTAATGGCTGCCATGTTGG - Intergenic
957304892 3:78444403-78444425 GGGGTTGAAGTGAGTCATGGTGG + Intergenic
958065118 3:88534855-88534877 GGGGGTGGTGGGTGCTATGGGGG + Intergenic
958915079 3:100040747-100040769 GGTGGTGCTGGGAGCCATGTGGG + Intronic
959963618 3:112330462-112330484 GAGGCTGAAGTGAGCCATGATGG - Intergenic
960055634 3:113274552-113274574 GAGGATGATGGGAGCCTCGGCGG - Exonic
960145381 3:114195134-114195156 GATGAAGATGGGAGCCATGGAGG + Intronic
960155026 3:114290866-114290888 GGGGGTGATGGGACACAGGGCGG + Intronic
960734913 3:120768361-120768383 GTGCCTGATGGGAGACATTGAGG + Intronic
961452728 3:127009669-127009691 GGGGCGGATGGTGGCCTTGGGGG - Intronic
961550752 3:127669426-127669448 GGGGCAGAAAGGGGCCATGGGGG + Intronic
962753472 3:138451304-138451326 GGGGCTTCTGGGAGCCAAGGTGG + Intronic
962834471 3:139175073-139175095 GGGGCTGATGGTAGTGATGATGG + Intronic
964345735 3:155752913-155752935 TAGGCTGATGGGATGCATGGGGG + Intergenic
964495712 3:157287419-157287441 GGGGCTGATGGAAAATATGGGGG + Intronic
968067685 3:195767841-195767863 GGGGGTGATGGTGGCGATGGTGG - Intronic
968716710 4:2165411-2165433 GGGGCTGGTGGGAGGGAGGGAGG + Intronic
968761036 4:2442886-2442908 GGGGGTGCTGGGGGCCTTGGGGG + Intronic
968761065 4:2442952-2442974 GGGGGTGCTGGGGGCCTTGGGGG + Intronic
968761094 4:2443018-2443040 GGGGGTGCTGGGGGCCTTGGGGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968874024 4:3255788-3255810 GCGGCTGCTGGAGGCCATGGTGG + Exonic
968894053 4:3388563-3388585 GGGGTGGGTGGGAGCCAGGGTGG - Intronic
968982841 4:3860029-3860051 GGGGGTGCGGGGAGCTATGGGGG - Intergenic
969262998 4:6045410-6045432 GGGGCTGATGGGTGCCAGGACGG + Intronic
969312848 4:6364136-6364158 GGGGCTCGAGGGAGTCATGGAGG + Intronic
969429299 4:7144961-7144983 GGGGCTGAGGGGAGCCAGGTGGG - Intergenic
969533031 4:7740065-7740087 CGGGCTGAAGGAAGCCAGGGAGG + Intronic
969818718 4:9705022-9705044 GGGGTGGGTGGGAGCCCTGGTGG - Intergenic
970169895 4:13278961-13278983 GAGGATGATGGGAGCCAGTGGGG - Intergenic
971241956 4:24897408-24897430 AGAGCTGACGGGAGCTATGGAGG + Intronic
973707489 4:53594774-53594796 GGGGCTGCAGTGAGCCATGATGG - Intronic
975549478 4:75596513-75596535 GGGGCTGCTGGGAGGCATGAGGG - Intronic
976915459 4:90368565-90368587 GAGGCTGAAGTGAGCCATGATGG + Intronic
978712223 4:111797919-111797941 GTGTCTGATGAGAGCCATGTGGG - Intergenic
982216957 4:153090900-153090922 GAGGCTGGTTGGTGCCATGGGGG - Intergenic
984116163 4:175683573-175683595 GGGCCTGATGGGAGGCATTTGGG + Intronic
984239420 4:177199835-177199857 GGACCTGATGGGAGGCATGATGG - Intergenic
985530587 5:431609-431631 GCCGCTGCTGGGGGCCATGGGGG - Intronic
985562294 5:594535-594557 GGGGCTCATGTCAGCCAAGGAGG + Intergenic
985631541 5:1016685-1016707 AGGGCAGGTGGGAGCCCTGGAGG - Intronic
985915508 5:2915672-2915694 GAGAGTGCTGGGAGCCATGGTGG + Intergenic
985985308 5:3510771-3510793 GGGGATGATGGGAGCGGTGAAGG + Intergenic
986728897 5:10620228-10620250 GGTGGTGATGCGGGCCATGGAGG + Intronic
987195913 5:15526040-15526062 GGGGGTGATGAAAGACATGGGGG + Intronic
989100950 5:37822380-37822402 AGGGCTAATGGGACCCATAGGGG + Intronic
991911827 5:71570372-71570394 GGGGCAGATGGGAGCCTCTGAGG - Intergenic
992249941 5:74866491-74866513 GGGGCTGGAGGGAGGCAGGGCGG - Intronic
992886140 5:81162191-81162213 GGGGGTGGTGGGGGACATGGGGG + Intronic
994197204 5:96934973-96934995 GGGGCTTATGGGGCCCCTGGCGG + Intronic
995139671 5:108721167-108721189 GGGGGTGAGGGGAGGAATGGGGG - Intergenic
996058774 5:119009812-119009834 GAGGGTGGCGGGAGCCATGGGGG + Intergenic
996532987 5:124545542-124545564 GGGGCTGCAGTGAGCCATGATGG + Intergenic
996930012 5:128874974-128874996 GGGCCTGGTGGGAGCCATTTTGG + Intronic
997303830 5:132824622-132824644 GGGGCCCCTGGGAGGCATGGGGG + Exonic
997629287 5:135354564-135354586 GAAGCTGAAGGAAGCCATGGGGG + Intronic
997915291 5:137918554-137918576 GTAGCTTATGGGAGCCATGTGGG - Intronic
998018417 5:138751259-138751281 GGGGCTGGTGGGAGGCATTTGGG - Intronic
998170533 5:139869903-139869925 AGGGCTGAGGAGGGCCATGGGGG - Intronic
1001428597 5:171642069-171642091 AGGGCAAAAGGGAGCCATGGAGG + Intergenic
1001441948 5:171750247-171750269 GGGGATGATGGGAGTGCTGGTGG - Intergenic
1001533288 5:172479851-172479873 GGGGCTCCAGGGAACCATGGTGG + Intergenic
1001991314 5:176117888-176117910 GGCGCTGCTGGGAGGCATGTGGG + Intronic
1002058536 5:176612481-176612503 GGGGTGGAAGGCAGCCATGGTGG + Intergenic
1002195088 5:177497089-177497111 GAGGCTGCTGGGAGCCAGGGCGG + Intronic
1002212372 5:177606673-177606695 GGGTAAGATGGGTGCCATGGAGG - Intronic
1002225561 5:177720248-177720270 GGCGCTGCTGGGAGGCATGTGGG - Intronic
1002268288 5:178050957-178050979 GGCGCTGCTGGGAGGCATGTGGG + Intronic
1002466291 5:179410462-179410484 TGAGCTGATTGGAGCCAGGGAGG + Intergenic
1002473747 5:179452541-179452563 GGGGCTGAAGGCAGCCATGGTGG - Intergenic
1002669544 5:180855542-180855564 GGGAGTGCTGGGAGCCATGAGGG - Intronic
1003619418 6:7684870-7684892 GAGGCTGCAGTGAGCCATGGTGG + Intergenic
1003869363 6:10390081-10390103 AGGGCTGATGGGAGCCAGCGAGG + Intergenic
1004623843 6:17356082-17356104 GAGGCTGGAGTGAGCCATGGTGG + Intergenic
1006025792 6:31145833-31145855 GGGAATGAGGGGAGGCATGGAGG - Intronic
1006055555 6:31381901-31381923 GGGGGTCATGGTAGACATGGGGG + Intergenic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1006439342 6:34043476-34043498 GGGTGTGATGGGAGCTGTGGGGG - Intronic
1006481412 6:34297506-34297528 GGGGCAGATGAGAGCCTTGGGGG + Intronic
1006811639 6:36824095-36824117 AGGGCTGAGGGGATCCATGCAGG - Intronic
1006898728 6:37486583-37486605 GGGGCTGGAGGTGGCCATGGTGG - Intronic
1006902298 6:37511028-37511050 GGGGATGGAGGGAGCCATGTAGG - Intergenic
1007629529 6:43265118-43265140 GGGGCTGGGGAGAGTCATGGAGG + Intronic
1007818225 6:44539968-44539990 GGTGCTGTTGGCAGCCATGTTGG + Intergenic
1010801166 6:80177161-80177183 GAGGCTGCAGTGAGCCATGGTGG + Intronic
1011983643 6:93417415-93417437 GGGGGTGATGGGAGGGAGGGTGG - Intronic
1012295201 6:97513531-97513553 TAGGCTGATGGGGACCATGGTGG - Intergenic
1013307578 6:108863870-108863892 GTGGCTGAGAGGGGCCATGGTGG - Intronic
1013351915 6:109313458-109313480 GGGGCTGCTATGAGCCCTGGAGG - Intergenic
1013414542 6:109913141-109913163 GGGGCAGATGTGAGTCATGATGG + Intergenic
1013787960 6:113803912-113803934 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
1015796045 6:137012373-137012395 GGGGCAGATGGGTGGAATGGTGG + Intronic
1016708231 6:147138743-147138765 GGGTTTGATGGGAAGCATGGTGG + Intergenic
1016988082 6:149909984-149910006 AGGGATGAGTGGAGCCATGGAGG + Intergenic
1016988549 6:149912987-149913009 AGGGATGAGTGGAGCCATGGAGG + Intergenic
1016991881 6:149935772-149935794 AGGGATGAGTGGAGCCATGGAGG - Intergenic
1016994423 6:149951661-149951683 AGGGATGAGTGGAGCCATGGAGG - Intergenic
1017007852 6:150040880-150040902 AGGGATGAGTGGAGCCATGGAGG + Intergenic
1017400068 6:154050613-154050635 GGGGCTGATGGGGGGCTGGGAGG + Intronic
1017416768 6:154229070-154229092 GGGGCTGGAGGCAGACATGGGGG - Intronic
1017765796 6:157606144-157606166 GGGGCTCATGGGAACCGTGAAGG - Intronic
1017798491 6:157869740-157869762 AGGTCTGATGGGGCCCATGGTGG - Intronic
1018869326 6:167769174-167769196 AGGGCTGACGGGAGTCATGGTGG + Intergenic
1018906381 6:168078669-168078691 GGGGGTGAGCAGAGCCATGGGGG - Intronic
1019112032 6:169724309-169724331 GGGGCTGAAGGGAGTCGCGGCGG - Intronic
1019230924 6:170562158-170562180 GGGGGTCATGGGAGTCATGGGGG - Exonic
1019597884 7:1866749-1866771 CGGGCTGACGGGAGCCCTGAGGG + Intronic
1019959621 7:4448347-4448369 GGGGCTGAAGTGAGAGATGGGGG - Intergenic
1019979264 7:4609111-4609133 GAGGCTGCAGTGAGCCATGGTGG + Intergenic
1020013024 7:4816656-4816678 GGGGCTGCTGGGAGCAGAGGTGG + Intronic
1020106797 7:5425968-5425990 GGGGCTGCTGGAAGCCCAGGCGG + Intergenic
1021106441 7:16644940-16644962 GGGGCTTCTGGAAGCCAGGGAGG + Intronic
1024528579 7:50371546-50371568 GAGGCTGATGGGAACCCTGATGG - Intronic
1024548291 7:50540101-50540123 CTGGCAGCTGGGAGCCATGGGGG - Intronic
1025280697 7:57625047-57625069 GGCACTGCTGGGAGCCCTGGGGG - Intergenic
1025304033 7:57840460-57840482 GGCACTGCTGGGAGCCCTGGGGG + Intergenic
1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG + Intergenic
1026817200 7:73522145-73522167 GGGGCTGCTGGGAGGCGCGGCGG - Exonic
1026977543 7:74507715-74507737 TGGGCAGTAGGGAGCCATGGAGG + Intronic
1028136728 7:87230445-87230467 GAGGCTGATGGGGGCCACTGAGG + Intergenic
1029456477 7:100674721-100674743 GGGGCTGCTGAGGGCCCTGGGGG + Intronic
1030061063 7:105621740-105621762 GGAGCTGCTGGGAGGCCTGGAGG - Intronic
1030111584 7:106031356-106031378 GGGGGTGATGAGAGCTCTGGAGG - Intronic
1030147066 7:106367644-106367666 GGGGTAGGTGGGAGGCATGGTGG + Intergenic
1032168557 7:129565137-129565159 GTGGCTGAAGGAAGCCATGTTGG - Intergenic
1032283305 7:130523518-130523540 GGGGCTGATGGAGGCCATCAGGG + Intronic
1032471453 7:132182066-132182088 AGGGCTGATGGGGTTCATGGAGG - Intronic
1032529391 7:132607847-132607869 GAGGATGATGGGAGTGATGGTGG - Intronic
1032988025 7:137360663-137360685 GTGTCTAATGGGAGTCATGGGGG + Intergenic
1033131492 7:138749282-138749304 GGTCATGATGGGGGCCATGGAGG + Exonic
1033936876 7:146596650-146596672 GGGGCTAATGTGAGCCATGGTGG + Intronic
1034893545 7:154860457-154860479 AGGGCTGCTGGGGGCCATGGTGG + Intronic
1035049560 7:155990624-155990646 GGAGATGATGGGAGCAATGTTGG + Intergenic
1035259906 7:157654342-157654364 GGTGCTGGTGGGAGTCAGGGTGG - Intronic
1035374074 7:158395834-158395856 GGGGCTGGTGGGATCCAAGGCGG - Intronic
1035701245 8:1640556-1640578 GGGCTTCATGGAAGCCATGGTGG - Intronic
1035750986 8:1996161-1996183 GGTGCTGATGGAGGCCATGTGGG + Intronic
1036391557 8:8328345-8328367 GGGGCTGCTGGGGGCCACTGGGG + Exonic
1036632641 8:10526039-10526061 GGTGCTGATGGGAGCCACAGAGG - Intronic
1036761179 8:11509489-11509511 GGGGCTGATAGGAAGCAGGGTGG + Intronic
1037855850 8:22370087-22370109 TGGGCTGATGGTAGCCAGGAAGG + Intronic
1037885292 8:22592936-22592958 GGGGCTGCAGTGAGCCATGACGG - Intronic
1037936005 8:22915428-22915450 GGGACAGATGGGAGCCAGGATGG - Intronic
1037990798 8:23320103-23320125 GGGGCTGATGGCAGCGTAGGGGG - Intronic
1038227562 8:25670876-25670898 GGGGCTGAGGGGAGTAATGTAGG - Intergenic
1038562881 8:28596003-28596025 GGGGGTGAAGAGAGCCATGTGGG - Intergenic
1038568201 8:28637329-28637351 GGGAGTGATGGGAGCCTGGGAGG - Intronic
1039229586 8:35428522-35428544 GGGGCAGAAGAGAGCCAAGGAGG - Intronic
1039709681 8:40043045-40043067 GAGGCTGATGTGAGCTATGGTGG + Intergenic
1039787407 8:40846270-40846292 TGGGATGATAGGGGCCATGGTGG - Intronic
1040458880 8:47627687-47627709 GGGGGTGCTGGGGGCCAGGGAGG - Intronic
1040493481 8:47946337-47946359 GTGGCTGATGGGAGATGTGGGGG - Intronic
1040569223 8:48592926-48592948 GGGGATGTTGGTAGGCATGGTGG + Intergenic
1042537089 8:69870019-69870041 TGGGCAAATGGGAGTCATGGAGG - Intergenic
1042595888 8:70447747-70447769 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
1042807361 8:72785415-72785437 GGGAGTGATGAGAGCCATTGAGG + Intronic
1042934356 8:74043896-74043918 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
1042936110 8:74060055-74060077 GGGGCTGAGGTGAGCCCAGGAGG + Intergenic
1043979136 8:86618019-86618041 GGGGGTGATGGGAGACAGTGAGG + Intronic
1044265160 8:90173422-90173444 GGGGTTGATGAGAGCTCTGGAGG - Intergenic
1045013754 8:97981118-97981140 GGGGCTGTAGTGAGCCATGATGG + Intronic
1045016185 8:98003576-98003598 GGGGCTCATGGGAGCCCCGAGGG + Intronic
1045347264 8:101304477-101304499 GGGCATGATGGGAGCCAGTGTGG - Intergenic
1046748031 8:117896955-117896977 GGGGGTGAAGGGAAACATGGAGG - Intronic
1047765768 8:127988692-127988714 GGGGATCATGTGAGCCATGGAGG - Intergenic
1047901906 8:129431948-129431970 GGTGCTGTTGGGGGGCATGGTGG - Intergenic
1048362696 8:133711837-133711859 TGGGCTGAGGGCAGCCCTGGAGG + Intergenic
1048986515 8:139737840-139737862 GGGAAGGTTGGGAGCCATGGTGG - Intronic
1048997414 8:139802463-139802485 GGTGGTGCTGGGAGCCAGGGTGG - Intronic
1049055622 8:140234369-140234391 GTGGCTGGTGGCTGCCATGGTGG + Intronic
1049405571 8:142450521-142450543 GTGGCTGTTGGGGGCCATGGGGG - Intronic
1049774132 8:144396934-144396956 CAGGATGAGGGGAGCCATGGGGG + Intronic
1050272634 9:3962153-3962175 GGGGCTGCCGTGAGCCATGCTGG + Intronic
1050359627 9:4817536-4817558 GAGGCTGAAGTGAGCCATGATGG - Intronic
1051531408 9:18108263-18108285 GGGGCTGCTGTGAGCCATGATGG - Intergenic
1052731464 9:32291234-32291256 GGGGCTGCTGTGGGGCATGGGGG + Intergenic
1052855710 9:33404934-33404956 GAGGCTGATGGGAGCCAGTAGGG + Intergenic
1053153849 9:35760243-35760265 GGGGCTGATGGGCGGGGTGGGGG + Intergenic
1055938752 9:81628390-81628412 GAGGCCTATGGGAACCATGGCGG - Intronic
1055987034 9:82062904-82062926 GGGACTGATGGCGTCCATGGTGG - Intergenic
1056135839 9:83628753-83628775 GGGGTTGATGGGAACCAGGCGGG + Intronic
1056499506 9:87194425-87194447 GGTGCTGATGGTAGTGATGGTGG - Intergenic
1056583866 9:87915250-87915272 GGGACTGATGGCGTCCATGGTGG + Intergenic
1056584358 9:87918719-87918741 GGGACTGATGGCGTCCATGGTGG + Intergenic
1056612511 9:88134203-88134225 GGGACTGATGGCGTCCATGGTGG - Intergenic
1056613003 9:88137671-88137693 GGGACTGATGGCGTCCATGGTGG - Intergenic
1056893421 9:90517561-90517583 AGGGCTGATGGGAGACTAGGAGG - Intergenic
1057160146 9:92883334-92883356 GGGACTGATGGCGTCCATGGTGG + Intergenic
1057414277 9:94847344-94847366 TGGGCAGAGGGGAGCCCTGGTGG + Intronic
1057420652 9:94909838-94909860 GGAGCTGCTGTGTGCCATGGCGG - Intronic
1057619110 9:96619435-96619457 GGGGCTGGCGGGAGCCTCGGCGG - Exonic
1057641493 9:96827392-96827414 GAGGCTGCAGTGAGCCATGGTGG - Intronic
1057854154 9:98589777-98589799 GAGGCTGCTGTGAGCCATGATGG - Intronic
1059194986 9:112362709-112362731 GGGTCTGATGGTGGCCATGATGG - Intergenic
1059441180 9:114307771-114307793 GGAGCTGATGGGTACCTTGGAGG - Exonic
1060109641 9:120897316-120897338 GAGGCAGATGGGAGTCAGGGAGG + Intergenic
1060152871 9:121299857-121299879 GGGGCGGTGCGGAGCCATGGTGG - Exonic
1060213301 9:121723521-121723543 TGGGCTCAGGGGAGCCCTGGAGG + Intronic
1060548450 9:124474318-124474340 GGGGTAGTTGGGAGCCATGCAGG + Intronic
1061313454 9:129778871-129778893 GAGGCTGCAGGGAGCCATGATGG + Intergenic
1061411519 9:130424684-130424706 GGGGCAGTGGGGAGCCATGACGG + Intronic
1061577160 9:131514315-131514337 AGGGCTGGGGGGAGCCAGGGTGG - Intronic
1061678614 9:132231757-132231779 TGGGGTGCTGGGCGCCATGGGGG - Intronic
1061898664 9:133661974-133661996 GGTGCACTTGGGAGCCATGGCGG + Intergenic
1062209532 9:135356204-135356226 GGCACTGACGGGAGCCACGGCGG + Intergenic
1062209541 9:135356250-135356272 GGCACTGACGGGAGCCACGGCGG + Intergenic
1062249835 9:135588535-135588557 GGGGGTGACCAGAGCCATGGTGG + Intergenic
1062432584 9:136532678-136532700 GGGGCTGTCAGGAGCCCTGGGGG + Intronic
1062454456 9:136629111-136629133 GGGGCTGCTGGGGGCCAAGGAGG - Intergenic
1062481387 9:136754093-136754115 TGGGCAGTGGGGAGCCATGGAGG + Intergenic
1062520363 9:136955156-136955178 GGGGCTGTTGGGAGCCGCTGTGG + Intronic
1062617884 9:137406398-137406420 GGGGCTGAGTGCAGCCAGGGCGG + Intronic
1203632054 Un_KI270750v1:79837-79859 GGCTCTGCTGGGAGCCCTGGGGG - Intergenic
1185433754 X:25198-25220 GGGGCTGTGGTGAGCCATGATGG + Intergenic
1185442960 X:237266-237288 GGGGCTGTGGTGAGCCATGATGG + Intergenic
1185644050 X:1604435-1604457 GGGGTTGATGGGAGAGAAGGTGG + Intergenic
1186195905 X:7110161-7110183 GGGGCTTATGGGAGGCATTAAGG + Intronic
1187533306 X:20116067-20116089 GCCGATGCTGGGAGCCATGGAGG - Intronic
1189711102 X:43812877-43812899 GGGGAAGATGGGAGTCATAGTGG + Intronic
1189730512 X:44015386-44015408 GGTCCTGAAGGGAGCCCTGGGGG - Intergenic
1190054990 X:47176124-47176146 GGGGGTGAGGGGAGACAGGGAGG - Intronic
1190339899 X:49287742-49287764 GGTGGTGGTGGGAGCCAGGGAGG + Exonic
1193635365 X:83943739-83943761 TGGGCTGGTGGGCTCCATGGTGG + Intergenic
1195316842 X:103687480-103687502 GGGACTGGTGAGAGCCACGGCGG + Intronic
1196016291 X:110944162-110944184 GGGGCTGGGGGGAGCGAGGGCGG - Intergenic
1197639293 X:128950414-128950436 GGGGCAGTGGGGAGCCATTGAGG - Intergenic
1197791230 X:130256065-130256087 GGGGCTGCAGTGAGCCATGAAGG + Intronic
1197865366 X:131011224-131011246 GAGGCAGATGGGAGCCAAGAGGG - Intergenic
1198458160 X:136837827-136837849 GGGGCTGATGGGAGGGCTTGGGG + Intergenic
1199275725 X:145939897-145939919 AAGGCTGATGGCAGCCTTGGTGG - Intergenic
1199760391 X:150899811-150899833 GGGGTTGGTGGGAGCCACTGAGG - Intergenic
1200088430 X:153623278-153623300 GGGACTGATGGAAGCCTTCGAGG + Intergenic
1201567876 Y:15385411-15385433 GGGGTTCATGGGAGGCATTGTGG + Intergenic