ID: 947344986

View in Genome Browser
Species Human (GRCh38)
Location 2:229181131-229181153
Sequence CAGAATTAGCTGGAGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 275}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947344986_947344992 -6 Left 947344986 2:229181131-229181153 CCTTCACCCTCCAGCTAATTCTG 0: 1
1: 0
2: 1
3: 18
4: 275
Right 947344992 2:229181148-229181170 ATTCTGATATGGGATAATGTTGG 0: 1
1: 0
2: 0
3: 9
4: 169
947344986_947344993 5 Left 947344986 2:229181131-229181153 CCTTCACCCTCCAGCTAATTCTG 0: 1
1: 0
2: 1
3: 18
4: 275
Right 947344993 2:229181159-229181181 GGATAATGTTGGAGAATCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 237
947344986_947344994 13 Left 947344986 2:229181131-229181153 CCTTCACCCTCCAGCTAATTCTG 0: 1
1: 0
2: 1
3: 18
4: 275
Right 947344994 2:229181167-229181189 TTGGAGAATCTCAGGACTAAAGG 0: 1
1: 0
2: 0
3: 23
4: 173
947344986_947344995 14 Left 947344986 2:229181131-229181153 CCTTCACCCTCCAGCTAATTCTG 0: 1
1: 0
2: 1
3: 18
4: 275
Right 947344995 2:229181168-229181190 TGGAGAATCTCAGGACTAAAGGG 0: 1
1: 0
2: 0
3: 21
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947344986 Original CRISPR CAGAATTAGCTGGAGGGTGA AGG (reversed) Intronic
900133858 1:1105127-1105149 CAGAATAAACTGGAGTCTGATGG + Intronic
900183676 1:1323331-1323353 CAGAAACAGCTGGAGGGACATGG - Intronic
900621756 1:3590736-3590758 CAGCAGGGGCTGGAGGGTGATGG + Intronic
900659495 1:3775568-3775590 CAGGATGGGGTGGAGGGTGATGG - Intronic
901684243 1:10934878-10934900 CAGGATTTGCTGAAGGCTGAGGG - Intergenic
903219577 1:21861721-21861743 CAGAAGTAGGGGGAGGGTGGAGG - Intronic
903861375 1:26366806-26366828 AAAAATTAGCTGGGGGGTGGTGG - Intronic
904193932 1:28770437-28770459 AAAAATTAGCTGGAGGATGGTGG + Intergenic
904385574 1:30139939-30139961 GAGAATCTGCTGGAGGCTGAAGG - Intergenic
905102734 1:35539735-35539757 CAGAGTCAGCTGGAGGCTTATGG - Intronic
905263955 1:36738480-36738502 CAGAACCTGCTGGAGGGAGACGG + Intergenic
905580060 1:39077442-39077464 AAAAATTAGCTGGGGGGTGGTGG - Intergenic
906235529 1:44205799-44205821 CAGAATTTGATGGGGGGTGGGGG + Intergenic
911015722 1:93330083-93330105 AAAAATTAGCTGGGGTGTGATGG - Intergenic
911085513 1:93974127-93974149 AAAAATTAGCTGGGGGGTGGTGG + Intergenic
911153169 1:94614773-94614795 CAGAAATAGATGGTGGGTTAAGG - Intergenic
913979087 1:143492360-143492382 AAGAATTATCTGGATGGTGGTGG - Intergenic
914073492 1:144318010-144318032 AAGAATTATCTGGATGGTGGTGG - Intergenic
914105663 1:144648350-144648372 AAGAATTATCTGGATGGTGGTGG + Intergenic
916411137 1:164548407-164548429 CAAAATTAGCTGGGGTGTGGTGG - Intergenic
917691355 1:177472761-177472783 CGGAAGTTGCTGGAGGGAGAAGG + Intergenic
917908343 1:179612781-179612803 AAGAATTAGCTGGGGTGTGGTGG + Intronic
918086281 1:181247896-181247918 CCGAAATAACAGGAGGGTGAGGG - Intergenic
918434458 1:184496960-184496982 TACAAATAGATGGAGGGTGAGGG + Intronic
918902659 1:190444078-190444100 CAAAATTAGCTGGGGGGTGGTGG + Intronic
919650563 1:200144982-200145004 CAGAATCATCTGGGGGTTGAGGG + Intronic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
922879991 1:228973640-228973662 CAGAATTAGATCCAAGGTGAGGG + Intergenic
923435823 1:233966741-233966763 CAGAATTAGCTTGTGAGAGAAGG - Intronic
923631532 1:235651745-235651767 CAGAATTACCTGGAGGGTTTGGG - Intergenic
923800657 1:237205535-237205557 CAGAATTTGGTCCAGGGTGAGGG + Intronic
923831178 1:237559287-237559309 TAGAATTAGAGAGAGGGTGATGG - Intronic
1063046182 10:2394435-2394457 CAGAATCCGCTGGAGGAGGAAGG + Intergenic
1065652519 10:27907543-27907565 CAGATTTATCTGGTGGGAGAGGG - Intronic
1066569942 10:36760475-36760497 CAGAAATAGATGCAGGCTGAGGG - Intergenic
1069160123 10:65083301-65083323 CAGAATTTTCTGGCTGGTGAAGG - Intergenic
1070389416 10:75956302-75956324 GAGAACAAGCTGGAGGATGAGGG + Intronic
1071436315 10:85651073-85651095 CAGAATCACCTGGAGGGTTGTGG - Intronic
1071717134 10:88108304-88108326 CTGAATTAGCTGTTGGGGGAGGG + Intergenic
1072241087 10:93496396-93496418 CAGAATTAGCTGGCGGGCCCGGG + Intergenic
1072406655 10:95160752-95160774 AAGAATAGGGTGGAGGGTGAAGG - Intergenic
1074374102 10:112924918-112924940 TTAAATTAGCTGGAGGGTGGTGG + Intergenic
1074881728 10:117664944-117664966 CAGGATTAAGTGGAGGGAGAGGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076054470 10:127360353-127360375 CACAACTAGCAGGAGGGGGAGGG + Intronic
1078783596 11:14464119-14464141 CAGAATGGGTTGGAGGATGATGG - Intronic
1078840658 11:15073540-15073562 CAGAGATAGCTGGAGGGGGGGGG - Exonic
1079323189 11:19469543-19469565 CAGAATATTCAGGAGGGTGAAGG - Intronic
1079640996 11:22805527-22805549 CAGAAGTGGTTGGTGGGTGAGGG - Intronic
1082803612 11:57432424-57432446 AGGGATTAGCTGGAGGGAGAAGG + Intergenic
1083254302 11:61486804-61486826 TAGAATTGGCTGGAAGGGGAAGG + Intronic
1084773279 11:71357861-71357883 CAGGCTTTGCTGGAAGGTGATGG + Intergenic
1085219892 11:74864995-74865017 CAGGATTTGCTGTAGGGTAAAGG - Intronic
1086241536 11:84699441-84699463 CAGGATGAGCTGTATGGTGAGGG + Intronic
1087506070 11:99022746-99022768 GACAAATAGCTGGAGTGTGAGGG + Intronic
1088793598 11:113248541-113248563 GAGAGTAAGCTGGGGGGTGAGGG + Intronic
1090150116 11:124375071-124375093 CAGAATGAGCTGGAAGATGGGGG - Intergenic
1091281187 11:134382830-134382852 CAGAATGAGCCGCAGGTTGACGG + Exonic
1091629344 12:2147616-2147638 CAGAACTAACTGGAGGAAGAGGG + Intronic
1092286580 12:7132145-7132167 CTGAATTGGCTGGTGGTTGAAGG + Intronic
1092829452 12:12429691-12429713 GAGAAAAAGGTGGAGGGTGAGGG - Intronic
1093916895 12:24813402-24813424 AAGTATTAGCTTGAAGGTGATGG - Intronic
1094042875 12:26135596-26135618 CAAAGTTGGCTTGAGGGTGAGGG - Intronic
1094193584 12:27721934-27721956 AAAAATTAGCTGGGGTGTGATGG + Intronic
1094214253 12:27923563-27923585 AAGTATCAGCTGGAGGGAGAAGG - Intergenic
1094494227 12:30979472-30979494 TAGAATTAGCTGGGGGGAGTTGG + Intronic
1098278455 12:68837510-68837532 AAAAATTAGCTGGGGTGTGATGG - Intronic
1100468798 12:94873030-94873052 CAGCCTTGGCTGGAGGGTGGGGG + Intergenic
1100831341 12:98519032-98519054 AAAAATTAGCTGGGGGGTGGTGG - Intronic
1100963590 12:99989235-99989257 TAGAATCAGCAGGATGGTGATGG - Intergenic
1101120765 12:101577441-101577463 CAAAATTAGCTGGGGCGTGGTGG - Intronic
1101859327 12:108469797-108469819 CAGAATGAGCTCTATGGTGATGG + Intergenic
1102067931 12:109994449-109994471 GAGAATTACCTGTAGGGTTAGGG - Intronic
1102613781 12:114135147-114135169 GAGAATAAGCTGGAGCTTGAAGG + Intergenic
1103663745 12:122543895-122543917 CAAAATTAGCCGGGGGGTGGTGG + Intronic
1104230314 12:126878091-126878113 CAGAATAATCAGGCGGGTGAGGG + Intergenic
1108540878 13:51444235-51444257 AAAAATTAGCTGGGGGGTGGTGG - Intronic
1108738579 13:53311125-53311147 CACAATTACCTGGTGGGTCAGGG - Intergenic
1108884277 13:55160038-55160060 CTAAATTAGATGGAGGATGAAGG + Intergenic
1109969000 13:69739886-69739908 CACAATGAGGTGGTGGGTGAGGG + Intronic
1111102772 13:83609565-83609587 CAGGATTAGCAGGAGTATGAGGG + Intergenic
1113098061 13:106687476-106687498 CAGAATTGACTGGAGGCTGCAGG - Intergenic
1113144081 13:107187445-107187467 CAGAATTATCTGCAGGGTGAGGG + Intronic
1113732816 13:112654469-112654491 CACAATTAACTGGGGGTTGAGGG + Intronic
1113927815 13:113951166-113951188 GAGCATTCGCTGGAGGGGGACGG - Intergenic
1118618016 14:67588425-67588447 GGGAATTAGTTTGAGGGTGAGGG + Exonic
1120994587 14:90407093-90407115 CAGCATTCCCTGGAGGGGGAGGG - Exonic
1122134607 14:99625620-99625642 CAGCATTGGATGGAGGGTGGGGG - Intergenic
1122906194 14:104802680-104802702 CGGAATGAGTTGGAGAGTGAGGG - Exonic
1125142118 15:36420441-36420463 TAGAATTAGGATGAGGGTGAGGG - Intergenic
1126066073 15:44827423-44827445 CAGAGTGAGCGGGTGGGTGAGGG - Intergenic
1126093762 15:45073141-45073163 CAGAGTGAGCGGGTGGGTGAGGG + Intronic
1127187183 15:56492014-56492036 GAGGAGTAGCTGGAAGGTGAGGG + Intergenic
1127807619 15:62535492-62535514 CAGAATTACCTGGAGAGAGAGGG - Intronic
1130147038 15:81282307-81282329 CAGAATGTGCTGGAAAGTGAGGG - Intronic
1130981364 15:88813918-88813940 CAGAGGGAGCTGGAGGGTCAGGG - Intronic
1131944769 15:97608120-97608142 CTGAATTTGCTGGAGGGAGGTGG + Intergenic
1133986448 16:10672438-10672460 AAAAATTAGCTGGGGCGTGATGG + Intronic
1135267048 16:21036171-21036193 AAAAATTAGCTGGGGGGTGGCGG + Intronic
1137445042 16:48526525-48526547 CAGAGTTAAATGGAGGGTGCTGG - Intergenic
1139474967 16:67198571-67198593 CAGGAGGAGCTGGAGGGTCAGGG - Exonic
1142499336 17:323612-323634 CTACATTAGCTGGAGGGTGGAGG - Intronic
1143669508 17:8386711-8386733 CAGACTAGGCTGCAGGGTGAAGG - Intergenic
1144566622 17:16364623-16364645 CAACATCAGCTGGAGGATGATGG + Intergenic
1144680250 17:17188486-17188508 CAGCATGAGCTGGAGGGTCAAGG - Exonic
1146024931 17:29311854-29311876 CAGAAATAGCTGCAGTGTCATGG + Intergenic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146789578 17:35743697-35743719 TGGAATTAGCTGGAGGGTTTGGG - Intronic
1147115785 17:38298435-38298457 CAGAACTGGCTGGAAGGTAAAGG - Exonic
1147188791 17:38726867-38726889 GGGAAATAGCTGGTGGGTGAGGG - Exonic
1147513813 17:41097371-41097393 CAGAGTCAGCGGGATGGTGATGG + Exonic
1148413890 17:47491184-47491206 CAGAACTGGCTGGAAGGTAAAGG + Intergenic
1148753091 17:49957156-49957178 CAGGATTAGCTGGAGAATAAAGG + Intergenic
1148891746 17:50812544-50812566 CAGGGTTTCCTGGAGGGTGATGG + Intergenic
1149538475 17:57450911-57450933 GAGACTTAGCTGGAGGAAGAGGG + Intronic
1151292103 17:73157646-73157668 CAGCATTTGGTGGAGGGTGGGGG + Intergenic
1151934357 17:77252976-77252998 AATAATTAGCAGGAGGGTGCTGG + Intergenic
1151942850 17:77303558-77303580 AAAAATTAGCCGGAGCGTGATGG + Intronic
1151965596 17:77429644-77429666 GATAATGAGCTGGAGGGTGCTGG + Intronic
1152740651 17:82016983-82017005 CAGACTTAGGTGCAGGGTCAGGG - Exonic
1153937918 18:9947570-9947592 CAGAATAAGCTGGAAGGTCAAGG - Intronic
1155391155 18:25338207-25338229 CAGAATTACGTGGATGGTTAGGG + Intronic
1155682127 18:28501227-28501249 CAGAATTTGTTAGAGGGAGAAGG + Intergenic
1156901510 18:42305766-42305788 CAGGTGTAGCTGGATGGTGATGG + Intergenic
1159080040 18:63726389-63726411 CAGAAATAGCAGGTGGGTGAGGG - Intronic
1159378751 18:67629085-67629107 CACAATAAGCCAGAGGGTGATGG - Intergenic
1159488873 18:69103205-69103227 CAGAAGTAGCAGCAGTGTGAGGG + Intergenic
1159605769 18:70473255-70473277 CAGAAATATCTGGGGAGTGATGG + Intergenic
1160437391 18:78862200-78862222 CAGAAGAGGCTGCAGGGTGAGGG + Intergenic
1160539899 18:79614866-79614888 CAGACGTAGCTGGGGGGTGGGGG - Intergenic
1163538703 19:17893794-17893816 CAGAAGGAGCTGGAGGGGGCTGG + Exonic
1165182902 19:33987976-33987998 GTGAATTAGCTGGAGAGGGAAGG + Intergenic
1165597883 19:37026158-37026180 CAAAATTAGCTGGCGGGGGTGGG + Intronic
1166467129 19:43042460-43042482 CCGAATTAGCTGGGGTTTGATGG - Intronic
1166732467 19:45066932-45066954 CAGGATGAGGTGGTGGGTGAGGG + Intronic
1167278402 19:48552439-48552461 CAGACTTAGCTGGAGGGGCTGGG + Intronic
1167315977 19:48762879-48762901 CAGGATGAGCTGCAGGGTGTGGG + Intergenic
1167598518 19:50440064-50440086 CGGAAGTAGCTGGGGTGTGATGG + Intronic
1168048385 19:53810394-53810416 CAGCAGCAGCTGGAGGGTGGGGG - Exonic
925588795 2:5489708-5489730 AATAATTAGCTGGCGGGGGATGG - Intergenic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
925708467 2:6713942-6713964 CAGAAATAGGGGGAGGGTGAAGG + Intergenic
925860365 2:8169425-8169447 CACAATTAGATGGATGGTGTTGG + Intergenic
926583977 2:14665109-14665131 CTGAATTACCAGGAGGGTAAGGG + Intergenic
927357293 2:22187816-22187838 CAGAATTAGCGGGAGGTAGGGGG + Intergenic
927479056 2:23436001-23436023 TAGAAATAGCCGGAGGATGAGGG - Intronic
927851738 2:26503862-26503884 CAGAATGAGGTGCAGGGAGAGGG + Intronic
928445555 2:31330883-31330905 CATAATGAGGTGTAGGGTGATGG - Intergenic
929515167 2:42600362-42600384 AAGAATCAGTTGGAGGGTAAAGG - Intronic
931550260 2:63436939-63436961 CAGTTATAGCTGGAGGGGGAGGG + Intronic
934104774 2:88685696-88685718 CAGGATTATCTGGAGCTTGATGG - Intergenic
934183807 2:89653441-89653463 AAGAATTATCTGGATGGTGGTGG - Intergenic
934294093 2:91727612-91727634 AAGAATTATCTGGATGGTGGTGG - Intergenic
936004950 2:108877314-108877336 CAGAATTAGCCAGGCGGTGATGG + Intronic
936489358 2:112957135-112957157 CAGTAAGAGCAGGAGGGTGAAGG - Intergenic
937460571 2:122082195-122082217 CAGAATTGTCAGGAGGGAGAAGG - Intergenic
937596207 2:123677242-123677264 CAGAATGAGATGGATGGTCAAGG + Intergenic
937971404 2:127552048-127552070 CAGTATTCGCAGGAGGGTGACGG + Intronic
938083143 2:128380882-128380904 CAGGATGAACTGGAGGGTGAGGG - Intergenic
938932679 2:136100520-136100542 CAGGATGAGGTGGAAGGTGACGG + Intergenic
939363615 2:141205344-141205366 CAGAATTACATGGAGAGTCAAGG - Intronic
941945979 2:171097770-171097792 CAAAATTAGCTGGGTGTTGACGG + Intronic
943023674 2:182603498-182603520 CAAAATTAGCTGGGGTGTGGTGG - Intergenic
944684886 2:202109552-202109574 CAGAATCAGCAGGAAGGAGAAGG - Intronic
946179290 2:217940244-217940266 CAGAAATGGGTGGAGGGAGAGGG - Intronic
946436796 2:219662406-219662428 CAGAATTACCTGGAGGGCTTGGG - Intergenic
947344986 2:229181131-229181153 CAGAATTAGCTGGAGGGTGAAGG - Intronic
947570407 2:231229237-231229259 CAGCCTTAGCTGCAGGATGAGGG - Intronic
1169049066 20:2560860-2560882 CAGAATAGGCTGGAGGCTGTAGG + Intronic
1171457095 20:25278286-25278308 CAGAGCAAGCTGGAGGGTGCAGG - Intronic
1172468682 20:35175329-35175351 GAGAAGTGGCTGGAGGGTGGGGG - Intronic
1173262196 20:41446560-41446582 CAGAGGCAGCTGGAGGGGGAGGG - Intronic
1173963026 20:47089585-47089607 CAGAATCACCTGGGGGGTGGGGG + Intronic
1174835409 20:53852135-53852157 AAGAAACAGCTGGAGGGAGAAGG - Intergenic
1176864051 21:14032853-14032875 CAGACTTAGCTGGACAGGGACGG + Intergenic
1177580528 21:23016500-23016522 CTGAATTACCTGGAAGGTAAAGG + Intergenic
1181323029 22:22023185-22023207 CGGAATGAGCAGGAGGGCGATGG + Intergenic
1182525762 22:30917851-30917873 AAAAATTAGCTGGGGTGTGATGG - Intergenic
1182906827 22:33945241-33945263 GAGAAGTAGCTTGAGGGTCAGGG + Intergenic
1183994443 22:41622182-41622204 CAGAATTATCTGGGAGGAGAAGG - Intronic
1184098410 22:42329012-42329034 CAGAGTGAGGTGGAGGGTGCTGG - Intronic
1184656837 22:45946185-45946207 CAGGAGAGGCTGGAGGGTGAGGG - Intronic
1184763308 22:46557882-46557904 CAGAGTTAGCTGGAGGGAAGAGG + Intergenic
1184877068 22:47282725-47282747 CAGAGTAAGCTGGAGGCTGGGGG - Intergenic
951112556 3:18821886-18821908 CATATGTAGCTGGAAGGTGAAGG + Intergenic
952324538 3:32309167-32309189 CAGAAATGGGTGGAGGGTGGTGG + Intronic
952981673 3:38741123-38741145 CAGACTTAGGTGGAGGGGGAAGG - Intronic
953614836 3:44480581-44480603 CAGAAAAAGATGGAGGGTGGAGG - Intergenic
955763603 3:62316760-62316782 CACAAAAAGCTGGAGGATGATGG - Intergenic
957713003 3:83888587-83888609 GAAAATTAGCTGGGGGGTGGTGG - Intergenic
958725642 3:97902609-97902631 CAGGATTTGCTGGGGAGTGAGGG - Intronic
958733271 3:97980503-97980525 CTGAATTAGTTGGGGGGTGGGGG + Intergenic
959323012 3:104903698-104903720 CTGAATTAGCTGAATGGTAAAGG - Intergenic
960126866 3:114008495-114008517 CAGCATTATGTGGAGGGTGGAGG + Intronic
961200258 3:125039778-125039800 TGGAATAAGCTGGAGTGTGATGG - Intronic
961546013 3:127633865-127633887 GAGAATTAGCAGGTGGGTGGTGG + Intronic
962290708 3:134134287-134134309 CAGAATCATCTGGAGAGTGAAGG + Intronic
962357767 3:134709477-134709499 CAGAAATAACTGGGGGGTGGGGG + Intronic
962558146 3:136577487-136577509 CAGAATTACTTGGAGGATGGGGG - Intronic
964791675 3:160458918-160458940 CAAAAAAAGGTGGAGGGTGAAGG + Intronic
965360014 3:167727244-167727266 CAGAATTAGCTGATGGGAAATGG + Intronic
965553377 3:169993720-169993742 CAGCATTTGTTGGAAGGTGATGG + Exonic
965819552 3:172671311-172671333 CAGAATCAGATGGAGGGTTTAGG + Intronic
967119963 3:186374031-186374053 CAGACATACCTGGAGGGTGAGGG + Intergenic
970434919 4:16023918-16023940 CAGAAATGGCTGGATGGAGAGGG - Intronic
975691298 4:76966709-76966731 AAGAATTAGCTGGGAGGTGGTGG + Intronic
975904175 4:79189552-79189574 CAGAATTACCTGCAGGGACATGG - Intergenic
977060592 4:92253818-92253840 CAGAATTTGCTGGAGGGGTGGGG - Intergenic
977260994 4:94797078-94797100 CAGAATCATGTAGAGGGTGAAGG + Intronic
977573044 4:98649394-98649416 AATAATTAACTGGAGGGTTAGGG + Intronic
977608085 4:99002912-99002934 AAAAATTAGCTGGGTGGTGATGG + Intronic
980070684 4:128240550-128240572 CTGACTTGGCTGGAGGATGAAGG - Intergenic
980106660 4:128594721-128594743 CAGAGTAAGCTGGAGGGAGGGGG - Intergenic
980301617 4:131002671-131002693 CACGATTAGCTGGAAGGTGAAGG - Intergenic
980342510 4:131568731-131568753 CAGAATTATCTGGTGAGGGATGG - Intergenic
980493368 4:133559975-133559997 CAGGACTAGCTGCAGGGTGTGGG - Intergenic
982159956 4:152558527-152558549 CAGAGATAGCTGAAGGGAGAAGG - Intergenic
982722907 4:158877784-158877806 TAGAATTAGCAGGGGCGTGATGG + Intronic
983650377 4:170031123-170031145 CACAATTAGAAGGAGGGTTAGGG + Intronic
983778360 4:171637516-171637538 AAAAATTAGCTGGAGAGTGGTGG - Intergenic
985036462 4:185845163-185845185 AAAAATTAGCTGGGGGGTGGTGG - Intronic
985068373 4:186144773-186144795 CGGGATTAGCTGGCGGGCGAGGG + Intronic
985230543 4:187811252-187811274 CTGATTTAGTTGGAGGGTTAAGG - Intergenic
989016626 5:36942586-36942608 AAAAATTAGCTGGGGGGTGGTGG + Intronic
990666449 5:58077851-58077873 AAGGATTACCTGGAGTGTGAGGG + Intergenic
992208592 5:74455101-74455123 AAGAATTAGCTGGTGCGTGGTGG + Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993113604 5:83690424-83690446 CAGAATTAGCTGTTTGGTCACGG + Intronic
993558218 5:89368221-89368243 GAGAAATGGCAGGAGGGTGAAGG - Intergenic
993584822 5:89711125-89711147 CAAAATTAGCCGGGGGGTGGTGG + Intergenic
993929874 5:93924743-93924765 AGGATTTAGCTGGAGGGTCAGGG + Intronic
995710426 5:115029901-115029923 CAGAGGTAGCTGGAAGCTGAAGG - Intergenic
998959539 5:147470171-147470193 CAGAATTGGGTAGAGGGAGAAGG - Intronic
999566550 5:152868909-152868931 CAAAATTAGCTGGGGCATGATGG + Intergenic
999826407 5:155277776-155277798 CAGCTTTAGTTGGAGGGTAAAGG - Intergenic
1001463897 5:171944916-171944938 CATAATAAGCTGGAATGTGAAGG - Intronic
1001861672 5:175061208-175061230 AAAAATTAGCTGGACGGTGGTGG - Intergenic
1002329678 5:178432910-178432932 CAGAATTGGTTGGTGGGTGAAGG - Intronic
1002454354 5:179337840-179337862 CAGAGTCAGCTGGGAGGTGAAGG - Intronic
1002454376 5:179337939-179337961 CAGAGTCAGCTGGGAGGTGAAGG - Intronic
1003359039 6:5406014-5406036 TAAAAATAGCTGGAGGGGGAAGG - Intronic
1003651446 6:7964510-7964532 CAGAACTCTCTGTAGGGTGAAGG + Intronic
1006430448 6:33992731-33992753 CTCAATGAGCAGGAGGGTGAGGG - Intergenic
1009239494 6:61166611-61166633 CAGAAGTAACTGCAGGCTGACGG - Intergenic
1011344788 6:86357422-86357444 CAGAATTTGATGCAGGCTGAGGG - Intergenic
1026686323 7:72513260-72513282 GAGAAATAGATGAAGGGTGATGG + Intergenic
1028730502 7:94142565-94142587 CAGAATTAGCAGGCGGGAAAAGG + Intergenic
1029018632 7:97340590-97340612 GAGAATTATCTGCAGGATGATGG + Intergenic
1029371610 7:100154339-100154361 CAGAAAAAGCTGGAGGGGAAGGG + Intronic
1029952410 7:104601195-104601217 CAGAATCTGCTGGAAGATGAAGG + Intronic
1030196268 7:106856600-106856622 CAGAATTTCCTGGCGAGTGAAGG + Intergenic
1030873407 7:114785016-114785038 CTGAAATAGCTGGATGGAGATGG + Intergenic
1032147234 7:129395199-129395221 CAGAAGTAGCTGAAGGCTGAGGG - Intronic
1033656794 7:143380729-143380751 CAGAGTCAGCTGGGGGGTGCTGG + Intergenic
1034265905 7:149780555-149780577 CAGAATGGGCTGGAGGCTTAGGG - Intergenic
1035706828 8:1682133-1682155 CAGAATGAGGTGAAGGGTCAGGG - Intronic
1036822166 8:11949997-11950019 CAGAATCACCGGGAGTGTGATGG + Intergenic
1038345722 8:26730877-26730899 CAGAATCAGCAGGTGGCTGAGGG - Intergenic
1041346804 8:56907445-56907467 CAGAGTTGGCAGGAGGGAGAGGG - Intergenic
1042317139 8:67436120-67436142 GGGAAATAGCTGGTGGGTGAGGG - Intronic
1042490330 8:69390592-69390614 AAGAATTAGCTGGATGAAGAGGG - Intergenic
1044389863 8:91637367-91637389 AAGAATAAGCTGTAAGGTGAGGG - Intergenic
1045072494 8:98523525-98523547 CAAAATTAGCTGGGGTGTGGTGG - Intronic
1045605090 8:103763977-103763999 CAGAATTACCTGGAGGGTTTGGG + Intronic
1046332463 8:112737462-112737484 CAGATTTTCCTGGAAGGTGAAGG + Intronic
1046601590 8:116323439-116323461 CAGAATTTCCTGGGGGGTGTAGG + Intergenic
1053129672 9:35607835-35607857 CAGAATTTGGTTGAGGGTGGGGG - Intronic
1054165666 9:61724980-61725002 GAATATTGGCTGGAGGGTGACGG + Intergenic
1057483169 9:95461680-95461702 CACAATTAGCTGGTGGGAGGAGG + Intronic
1057762583 9:97888728-97888750 TAGAAGGAGCTGGAGGGTTAAGG + Intergenic
1057848419 9:98544211-98544233 CAACTTTAGCTGGAGGCTGAGGG - Intronic
1059134872 9:111795278-111795300 CAGGGTTAGCCGGAGGGCGAGGG + Intergenic
1060035520 9:120252212-120252234 CACAATTATGTGGGGGGTGAAGG + Intergenic
1186605028 X:11080314-11080336 CAGAAATGACTTGAGGGTGAAGG - Intergenic
1186825990 X:13340497-13340519 CAGAATTGGCTAGCTGGTGAGGG - Intergenic
1186907174 X:14123703-14123725 CAGAGATAGTGGGAGGGTGAGGG - Intergenic
1186953947 X:14659571-14659593 CTGAGTTAGCTGGAGGGTTTGGG + Intronic
1187278697 X:17839363-17839385 CAGCATTATCTGGAAGGTCAGGG - Intronic
1187998476 X:24955324-24955346 AAGAATTAGCTGGTGGGGGTGGG - Intronic
1188816566 X:34722245-34722267 CAGAATGAGCTTGATGGGGAAGG + Intergenic
1189122309 X:38407856-38407878 CAGAATAGGTTGGAGAGTGAGGG + Intronic
1195651491 X:107289585-107289607 CAGAATGAGCTGCAGGCTGGGGG - Intergenic
1195933544 X:110103610-110103632 AAGAATTGGCTGGAGGATGGGGG + Intronic
1195970757 X:110470598-110470620 CAGCATTAGCTGGGGAGAGAAGG + Intergenic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196940341 X:120769584-120769606 CAGAATTAGGGGGAGGGGTAAGG + Intergenic
1196991640 X:121335717-121335739 CAGAATTAACTGGAGACTGTAGG - Intergenic
1197282564 X:124553951-124553973 AAAAATTAGCTGGGGGGTGAGGG + Intronic
1200088929 X:153625486-153625508 GAGAAAGAGCTGGAGTGTGAAGG + Intergenic
1201533371 Y:15017193-15017215 CAAAATTAGCTGGATGGTGGTGG + Intergenic
1201790803 Y:17838955-17838977 CAGGATTAGATTGAGGGTTAGGG + Intergenic
1201810751 Y:18067034-18067056 CAGGATTAGATTGAGGGTTAGGG - Intergenic
1202352419 Y:24008609-24008631 CAGGATTAGATTGAGGGTTAGGG + Intergenic
1202518360 Y:25661506-25661528 CAGGATTAGATTGAGGGTTAGGG - Intergenic