ID: 947346322

View in Genome Browser
Species Human (GRCh38)
Location 2:229193098-229193120
Sequence ATGGATCAGGAATATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 1, 2: 10, 3: 105, 4: 407}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947346316_947346322 4 Left 947346316 2:229193071-229193093 CCTTATTTTACTCTATCTTGTGA 0: 1
1: 0
2: 4
3: 29
4: 333
Right 947346322 2:229193098-229193120 ATGGATCAGGAATATGGGCAGGG 0: 1
1: 1
2: 10
3: 105
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947346322 Original CRISPR ATGGATCAGGAATATGGGCA GGG Intronic
901112554 1:6810127-6810149 ATGGGTCAGGCATTTGGGCAGGG + Intronic
901304804 1:8225128-8225150 CAGGATCAGGAATAAGGGCTTGG - Intergenic
902491223 1:16782165-16782187 ATTGATCAGGAATAAGGGCTGGG - Intronic
904107110 1:28094557-28094579 TTGAGTCAGGAATTTGGGCAGGG + Intergenic
904108737 1:28108076-28108098 ATGGATCAGGCATCCAGGCATGG + Intergenic
904975639 1:34454158-34454180 GTGGGTCAGGAATATGGGCTTGG + Intergenic
905736030 1:40326491-40326513 GTGGATCAGGAATTCAGGCAAGG - Intergenic
906402472 1:45515063-45515085 TTAGATTAGGAATATGGGAAAGG - Intronic
906553903 1:46691431-46691453 GTGCATCAGGAATTTGAGCAAGG - Intronic
906693103 1:47805884-47805906 ATGGATCAGGCATTTGGGCCAGG + Intronic
906898084 1:49801413-49801435 GTGGACCAGGAGTCTGGGCATGG - Intronic
907454508 1:54566605-54566627 ATGGGTCAGGAATTCTGGCAGGG + Intronic
908360357 1:63363242-63363264 ATGGATCAAGAATCTAGGCAGGG - Intergenic
908463484 1:64368860-64368882 CTGGGTCAGGAATTTGGGCCTGG + Intergenic
908594163 1:65668113-65668135 ATGGGTCAGGAGTCTGGCCATGG + Intergenic
910695159 1:90005135-90005157 ATGGATCGTGACTATGGCCATGG + Exonic
910738234 1:90486182-90486204 GTGGTTCAGAAAGATGGGCAGGG + Intergenic
911544400 1:99199534-99199556 ATGGGTTAGGAATTTGGGTACGG + Intergenic
911844324 1:102730708-102730730 GTGGATCATGAATATAGCCAGGG - Intergenic
912998028 1:114551451-114551473 ATGGATCAGGAATCTGGATGTGG + Intergenic
913047466 1:115086816-115086838 ATGGATCAGAATTATGTGAATGG + Intronic
913164416 1:116171785-116171807 CTAGATCAGGAATTAGGGCAGGG + Intergenic
913531676 1:119738183-119738205 AAGGGTCAGGAAAATGGGCTGGG + Intronic
914724230 1:150313983-150314005 AAGGATCAGGTATCTGGGCTGGG - Intergenic
915578090 1:156794623-156794645 AGGAGTCAGGAATCTGGGCAAGG - Intronic
916021338 1:160795366-160795388 CTTGATAAGGAATCTGGGCATGG + Intergenic
916179953 1:162074679-162074701 ATGGCTCAGGAATTCAGGCAGGG + Intronic
916696632 1:167244215-167244237 GTGGGTCAGGCATCTGGGCATGG + Intronic
917642647 1:176997845-176997867 ATGGAGCAGGTATTTGGGCTGGG + Intronic
918060765 1:181059447-181059469 ATGGGTCAGGAATTTGGATATGG + Exonic
918344579 1:183595475-183595497 ATGGGTCAGGAGTCTGGGCACGG + Intronic
918572968 1:186020758-186020780 GTGGTTCAAGAATATGTGCATGG + Intronic
918947152 1:191081729-191081751 GTGGATCAGAAATTTTGGCAAGG - Intergenic
919572905 1:199270695-199270717 ATGGATCAGGAATCTAGGAAGGG + Intergenic
920212019 1:204335279-204335301 ATGGCTCAGGCAGCTGGGCAGGG + Intronic
921287224 1:213620218-213620240 ATGGGTCAGAAATTTGGGCAGGG + Intergenic
921774244 1:219078819-219078841 ATGGGGCAGGGATAGGGGCAGGG - Intergenic
921861222 1:220044432-220044454 ATGTATCAGGAGGCTGGGCATGG + Intronic
921976213 1:221206335-221206357 ATGAGTCAAGAATCTGGGCATGG - Intergenic
922040563 1:221892172-221892194 ATGGAACAAGATTGTGGGCAAGG + Intergenic
922254557 1:223882309-223882331 ATGAATAAGGAAGCTGGGCATGG + Intergenic
922276561 1:224084256-224084278 ATGAATCAGGAAACTGGGAAGGG - Intergenic
923349045 1:233085904-233085926 ATGGGTCAGGAATTTGGGAAGGG - Intronic
923529218 1:234800369-234800391 ATTGATCAGGAATAAGGGCTGGG + Intergenic
923558167 1:235018186-235018208 GTGGGTCAGGAATTTGGACAAGG + Intergenic
923831882 1:237567293-237567315 TTTGATCAGTAATATGGGCGAGG + Intronic
924461814 1:244266325-244266347 GTGGCTCAGGAATCTGGGCCTGG - Intergenic
924539676 1:244970071-244970093 ATGGATGAGAAATAAGGGAAAGG + Exonic
1064154286 10:12890717-12890739 ATGGTTCAGGAATCTAGGCATGG - Intergenic
1064229795 10:13520095-13520117 CTGGATCTGGAATTTGGACATGG - Intronic
1065294982 10:24265731-24265753 AGGGGTCAGCAAGATGGGCAAGG + Intronic
1065295163 10:24267338-24267360 TTCTATCAGGAATATGGGTAAGG + Intronic
1066055372 10:31675885-31675907 ATAGATCAGAAATTTTGGCAGGG + Intergenic
1066368126 10:34796341-34796363 GTGGGCCAGGAATTTGGGCAGGG - Intronic
1066675081 10:37879525-37879547 ATGGATCAGGAGTCTGGGAATGG + Intergenic
1066752551 10:38673304-38673326 GTGGGTCAGGAATCTGGGCATGG + Intergenic
1066964481 10:42249733-42249755 GTGGGTCAGGAATCTGGGCATGG - Intergenic
1067719325 10:48715253-48715275 ATGGATCTGCAATGTGGGCAGGG - Intronic
1067787514 10:49261274-49261296 ATGGAGAAGGAAAATTGGCAGGG - Intergenic
1067799689 10:49350487-49350509 GTGGGTCAGGAATTTGGGAATGG - Intergenic
1067823794 10:49554607-49554629 ATGGGGGAGGGATATGGGCAGGG + Intergenic
1069150591 10:64954318-64954340 ATCGATCAGGAGGATGGCCAGGG - Intergenic
1069939735 10:71946761-71946783 ATGGGTCAGGAATCTAGACATGG + Intergenic
1071100674 10:82033717-82033739 ATGCATCAGGGATTTGAGCATGG + Intronic
1071175550 10:82922836-82922858 ATTCATCAGGAATAGGGGGATGG - Intronic
1071924470 10:90389969-90389991 ATGGGTCAGGAATATAAGCATGG + Intergenic
1072209859 10:93236533-93236555 TTGGATCAGGAATGTGGTCTGGG + Intergenic
1072708239 10:97697731-97697753 GTGGGTCAGGAAAGTGGGCAGGG + Intergenic
1074643201 10:115412444-115412466 GTGGATCAGGAGTCTGAGCATGG - Intronic
1075081741 10:119388704-119388726 GTGGGTCAGGAATTTGGGCATGG + Intronic
1075576059 10:123578325-123578347 GTGGATCAGGAATTTGGGGCAGG - Intergenic
1078057996 11:8022982-8023004 GTGGATCAGCAATTTGGGCTGGG + Intronic
1078825605 11:14927333-14927355 GTGGGTCAGGAATTTGGGTAGGG + Intronic
1078866693 11:15304271-15304293 GTGGATCAGTAATTTGGGCTGGG - Intergenic
1079398469 11:20086237-20086259 GTGTATAAGGAATATGGGGAAGG + Intronic
1079417290 11:20251111-20251133 ATGACTCAGGAAAATGGGCCTGG + Intergenic
1080173993 11:29339975-29339997 ATTGATCAGGCACATGCGCAGGG + Intergenic
1080236586 11:30075765-30075787 ATGGGTCAGAAATCTGGGCCTGG - Intergenic
1081229589 11:40568428-40568450 GTGAATCAGGAATCTAGGCATGG - Intronic
1081505963 11:43717509-43717531 GTGGATCCGGAGTTTGGGCAGGG + Intronic
1081560383 11:44209013-44209035 ATAGAGCAGGAATTTGGGCACGG - Intronic
1081586737 11:44390212-44390234 GTGGATCAGGAATCTGGACATGG + Intergenic
1081588417 11:44403555-44403577 GTGGATCAGGAATCTGGTCATGG - Intergenic
1082778904 11:57270994-57271016 ATGGACAAGGAACATGGGGAGGG - Intergenic
1082779254 11:57273670-57273692 TTGGGTCAGGAATTTGGGCAGGG - Intergenic
1082780772 11:57285927-57285949 GTGGGTCAGGAACTTGGGCAGGG + Intergenic
1083567900 11:63736027-63736049 ATGGATCAGCATTCTAGGCATGG + Intronic
1086595336 11:88564060-88564082 ATGGATAAGAAAAAGGGGCAGGG - Intronic
1086804273 11:91220598-91220620 CTGAGTCAGGAATCTGGGCATGG + Intergenic
1087217277 11:95507559-95507581 GTGCATCAGGAGTTTGGGCATGG + Intergenic
1087223963 11:95577291-95577313 ATGGGTCAAGAATTTTGGCAGGG + Intergenic
1087269304 11:96095245-96095267 AATGATGAGGAATATGGGAATGG + Intronic
1088835446 11:113574731-113574753 ATGGATCAAGAATTTGGACAGGG + Intergenic
1088980165 11:114855618-114855640 GTGAGTCAGGAATTTGGGCAGGG + Intergenic
1089675745 11:120087909-120087931 ATGGATCAGGCAGATAGGCCAGG + Intergenic
1090019589 11:123115869-123115891 GTGGGTCAGGAATCTGAGCATGG + Intronic
1090119587 11:124011402-124011424 ATGGATCAGGAAAATGATCAAGG + Intergenic
1090150539 11:124379145-124379167 ATGGATGAGTAACAGGGGCAGGG - Intergenic
1090215317 11:124957133-124957155 ATGTAACAGGAATTTGAGCAGGG + Intronic
1090853018 11:130587159-130587181 GTGGGTCAGGAATTTGGACAGGG + Intergenic
1091567974 12:1662170-1662192 GGGAATCAGGAATCTGGGCAGGG - Intergenic
1092040665 12:5381159-5381181 AGGGCTCAGGAATGAGGGCAGGG - Intergenic
1092338195 12:7652491-7652513 ATGGATCAACAAAATCGGCAAGG - Exonic
1095899252 12:47310990-47311012 GTGGGTCAGGAATCAGGGCATGG + Intergenic
1097286227 12:57879564-57879586 ATGGATGTGGAATATGGATATGG + Intergenic
1098281949 12:68870816-68870838 ATAGGTCAGGAATTTGGGCAGGG - Intronic
1098407840 12:70144859-70144881 ATGGAACAGAAATATGGCCAAGG - Intergenic
1099055347 12:77833493-77833515 AGGGATCATGCAGATGGGCAGGG + Intronic
1100177189 12:92044334-92044356 ATGGGTCAGAAAACTGGGCATGG + Intronic
1101908452 12:108845342-108845364 ATGGGTCAGGAATCTGGACACGG - Intronic
1102778048 12:115538036-115538058 GTTGGTCAGGAATTTGGGCAGGG - Intergenic
1103173478 12:118842696-118842718 GTTGGTCAGGAATCTGGGCATGG + Intergenic
1103416607 12:120745916-120745938 ATGGTTCAGGAGTCTGGGCGTGG + Intergenic
1103550562 12:121734125-121734147 GTGGGTCAGGAATATAGACAGGG + Intronic
1104542608 12:129681312-129681334 GTGTAGCAGGTATATGGGCAGGG + Intronic
1104578070 12:129986540-129986562 ATGGGTCAGAAATTTGGACAGGG - Intergenic
1104693940 12:130849121-130849143 GAGGGTCACGAATATGGGCAGGG - Intergenic
1106266850 13:28118331-28118353 ATGGGTCAGGAATCTGGGTGTGG - Intergenic
1107093139 13:36504784-36504806 ATGACTCAGGATTATAGGCATGG - Intergenic
1107887292 13:44884435-44884457 ATGGGTCAGGAATTTGGACAGGG + Intergenic
1108907012 13:55488523-55488545 ATGCATCAGGAATATTGGCCTGG + Intergenic
1110406544 13:75156815-75156837 ATGGGTCAGGAATCTAGGCATGG - Intergenic
1110670771 13:78174498-78174520 CTGGATTAGGTATTTGGGCAGGG - Intergenic
1111930319 13:94506012-94506034 GTGGATCAGGAATCCAGGCAGGG - Intergenic
1111997220 13:95176567-95176589 ATGGATCAAGACTAAGTGCATGG - Intronic
1112159650 13:96854197-96854219 ATGGGTTAGGAATCTGGCCATGG + Intergenic
1112835843 13:103513129-103513151 TTGGACCAGGAATTGGGGCAAGG + Intergenic
1112930645 13:104732123-104732145 TTGAATGAGGAATATGGGCAGGG - Intergenic
1113855666 13:113444226-113444248 CTGTTTAAGGAATATGGGCAGGG - Intronic
1114715644 14:24821084-24821106 GTGGAACAGGAAGATGGGGAAGG + Intronic
1115302766 14:31902990-31903012 GTGAGTCAGGAATGTGGGCATGG + Intergenic
1115806159 14:37054357-37054379 ATAGGTCAGGAGTTTGGGCAGGG - Intronic
1117440488 14:55754659-55754681 GTGGCTCAGGAATCTGGGCATGG + Intergenic
1117493161 14:56273062-56273084 GTGGGTCAGGAATCTGGGAAGGG + Intronic
1117873595 14:60226268-60226290 ATGGGTCAGGAATCTGGGTGTGG + Intergenic
1117923671 14:60753150-60753172 GTGCATCAGGAATTTGGGCATGG + Intronic
1118099639 14:62582384-62582406 TTGGATCAGTAATTTGGGAAAGG - Intergenic
1118706570 14:68485658-68485680 AAGGATCAGGGATAGGGACAAGG - Intronic
1119041701 14:71280330-71280352 ATGAATCAGGAAAAGTGGCAAGG - Intergenic
1119747685 14:77056028-77056050 GTGAGTCAGGAATTTGGGCAGGG + Intergenic
1120273093 14:82339216-82339238 ATGGTTCAGGAATATGTGAAGGG + Intergenic
1120910088 14:89658507-89658529 ATAGGTCAGGAATCTGGGTACGG + Intergenic
1121170243 14:91847714-91847736 ATGAATCTGCAATGTGGGCAGGG - Intronic
1121261188 14:92567341-92567363 ATGGCTCAGCAATTTGGGCTGGG + Intronic
1121363642 14:93286651-93286673 TAGGCTCAGGAATTTGGGCATGG - Intronic
1124844946 15:33281172-33281194 CTGGAGCAGGAATATGGGGAAGG - Intergenic
1125034433 15:35107387-35107409 TTGGATGAGAAATTTGGGCAAGG - Intergenic
1127257160 15:57302067-57302089 ATGGTTCAGGAATTCAGGCAGGG + Intergenic
1127352052 15:58162884-58162906 ATGAATCAGCAATTTGGGCAGGG - Intronic
1127686875 15:61354618-61354640 ATGGAACTGGAAGATGGGGACGG - Intergenic
1127908728 15:63397452-63397474 ATACAACAGGAAAATGGGCAAGG - Intergenic
1129353575 15:74972198-74972220 GTGGGTCAGGAATTTAGGCAGGG + Intronic
1129774373 15:78225806-78225828 ATGGGTTAGGAATCTAGGCATGG + Intronic
1130222936 15:82036468-82036490 ATGGATCAGGAATCAGGGTGTGG + Intergenic
1130633531 15:85594517-85594539 ATGTATCAGAAATATAGGCTTGG + Intronic
1130848037 15:87765778-87765800 GTGGGTCAGGAATCTGGGCATGG - Intergenic
1130938148 15:88487479-88487501 ATAGAAGAGGAAAATGGGCAAGG + Intergenic
1131114273 15:89784466-89784488 GTGGAGCAGGAAGAGGGGCACGG + Intergenic
1131315324 15:91330742-91330764 ATATAACAGTAATATGGGCAAGG - Intergenic
1132178166 15:99732243-99732265 ATGGATGAGGAACAGGGGCGGGG - Intronic
1132322427 15:100935780-100935802 GTGGGTCAGGAATCTAGGCAGGG + Intronic
1133455482 16:5938826-5938848 ATGAATCAGCAATTTGGGCTAGG - Intergenic
1135466679 16:22692660-22692682 GTGGGTTAGGAATTTGGGCATGG + Intergenic
1135652882 16:24222292-24222314 GTGGATCAGGAATCTGGGTATGG + Intergenic
1136730172 16:32403727-32403749 GTGGGTCAGGAATCTGGGCATGG - Intergenic
1137232912 16:46584962-46584984 ATGGTTCAGGCATATGTACAGGG - Intronic
1137604184 16:49776331-49776353 ATGGGGCAGGAAGCTGGGCAGGG - Intronic
1139155915 16:64442125-64442147 GTGGAGCAGGAATTTTGGCATGG - Intergenic
1139202388 16:64991308-64991330 ATGTGTCTGGAATTTGGGCAAGG - Intronic
1139479177 16:67219317-67219339 ATGCATCAGGAGACTGGGCACGG - Intronic
1139656855 16:68393112-68393134 ATGGACCAGGAGGCTGGGCATGG + Intronic
1140027350 16:71302890-71302912 GTGGGTCAGGAATCTGTGCATGG + Intergenic
1140656983 16:77151230-77151252 ATGGAGCAGGCATATTGGTATGG - Intergenic
1140819165 16:78647227-78647249 ATGGATCAGGACAGAGGGCAGGG + Intronic
1141036221 16:80628587-80628609 GTGGGTCAGGAATCTGGGCATGG - Intronic
1141339400 16:83189013-83189035 CTGCATTAGTAATATGGGCATGG + Intronic
1141396078 16:83706025-83706047 ATGGCTCAGGAATGTGAGCAGGG + Intronic
1141473436 16:84255018-84255040 GTGGGTCAGGACTTTGGGCAAGG + Intergenic
1141477671 16:84284472-84284494 AGGGAGCAGGGATATGGGAAAGG - Intergenic
1141822040 16:86453115-86453137 GTGGGTCAAGAATTTGGGCAGGG - Intergenic
1202996229 16_KI270728v1_random:113581-113603 GTGGGTCAGGAATCTGGGCATGG + Intergenic
1203022916 16_KI270728v1_random:425923-425945 GTGGGTCAGGAATCTGGGCATGG + Intergenic
1142864715 17:2783691-2783713 ATGAATCTGCAACATGGGCAGGG + Intronic
1143309104 17:5973570-5973592 ATGGGTAAGGAATTAGGGCAGGG + Intronic
1143399919 17:6637407-6637429 ACGGCTCAGGCATATGGGGAAGG - Intronic
1143463295 17:7117796-7117818 CTGGGTCAGAAATTTGGGCAGGG - Intergenic
1143504510 17:7356306-7356328 AGGGCTCAGGGATCTGGGCAAGG - Intronic
1143588521 17:7865408-7865430 ATGAATCTGCAATATGGGTAGGG + Intronic
1143624338 17:8100473-8100495 CTGGATCAGAAATTTGGGCAGGG - Intronic
1143700580 17:8656903-8656925 GTGGATCAGGAATTTGGGTAGGG - Intergenic
1143899613 17:10164139-10164161 CAGGATTAGGAATATGGCCATGG + Intronic
1144116356 17:12096166-12096188 ATACTTCAGGATTATGGGCAGGG - Intronic
1144334750 17:14258655-14258677 ATGGGTCAGGAGTCTGGGCCTGG + Intergenic
1145192546 17:20856731-20856753 GTGGTGCAGGAATCTGGGCATGG + Intronic
1145403068 17:22559799-22559821 GTGGTGCAGGAATCTGGGCATGG + Intergenic
1146164294 17:30575919-30575941 ATGGAAGGGGAACATGGGCAGGG - Intergenic
1148030866 17:44619957-44619979 ATGTGTCAGGAATTTGGGCAGGG + Intergenic
1148201501 17:45752897-45752919 GTGGATCAGGAACCTGGACAGGG - Intergenic
1149207148 17:54261551-54261573 ATGTGTCAGGAATCTGGGCATGG + Intergenic
1149425733 17:56552512-56552534 GTGGGTCAGGAATTTGGGCAGGG + Intergenic
1149469475 17:56904021-56904043 CTGGCTCAGGAATCTGGACATGG - Intronic
1149621338 17:58047515-58047537 AGGGCTCAGGAATCTGGGAAGGG + Intergenic
1150033652 17:61769226-61769248 GTGGGTCAGGAGTCTGGGCATGG - Intronic
1150376928 17:64689178-64689200 ATGGCTCAGCAATTTGGGCTGGG + Intergenic
1150509854 17:65739244-65739266 TTGGATCAGAAATTTGGGCAGGG - Intronic
1150934975 17:69625511-69625533 GTAGATCAGGAATCTGGGAATGG + Intergenic
1150953327 17:69826241-69826263 TTTGATCAGGAGTCTGGGCATGG - Intergenic
1151060577 17:71088684-71088706 ATTGATCAAGAATAAGGGAATGG - Intergenic
1152967809 18:132699-132721 ATGGGGCAGGAAGAGGGGCAGGG + Intergenic
1153291373 18:3505308-3505330 ACAGATGAGGAAAATGGGCACGG - Intronic
1153309509 18:3664319-3664341 TTGAATCAGGAATTTAGGCAGGG - Intronic
1155125103 18:22866509-22866531 GTGTATCAGGAATCTGGGAATGG - Intronic
1156799405 18:41090516-41090538 ATGGATAGGGTATATGGGTAGGG + Intergenic
1157184282 18:45524831-45524853 ATGGGGCAGGAAAAAGGGCAGGG - Intronic
1158475831 18:57778546-57778568 ATGGATCAAGAATCTGGGTATGG + Intronic
1159269318 18:66128495-66128517 ATGTAGCAGGAGTATGGGCCAGG - Intergenic
1159563628 18:70023245-70023267 GTGGCTCAGGAATCTGGGCGTGG - Intronic
1159875159 18:73802902-73802924 AAGTATCAGAAATATCGGCATGG + Intergenic
1160255705 18:77247012-77247034 TTGGTTCAGGAAAATGGGGATGG - Intergenic
1161228520 19:3160098-3160120 GTGGGTCAGGAATTTGGGAAAGG + Intronic
1161360539 19:3846918-3846940 GTGGATCAGGAATTTGGGACGGG + Intronic
1161650593 19:5482011-5482033 ATGGATTGGGAATCTGAGCATGG + Intergenic
1162503409 19:11067664-11067686 AAGGGTCAGGAATGTGGGAAGGG - Intergenic
1165083532 19:33326325-33326347 ATGGATAGGTAATTTGGGCAGGG - Intergenic
1165961306 19:39536926-39536948 ATGGATAAAGAATATGAACAAGG + Intergenic
1166877868 19:45908868-45908890 AGGGATCAGGAATATGTGGGTGG + Intergenic
1167722447 19:51187683-51187705 GGGCATCAGGGATATGGGCATGG + Intergenic
1167735117 19:51289660-51289682 CTAGATTAGGAATTTGGGCAGGG + Intergenic
1167830866 19:52021331-52021353 GTGGCTCAGGAATAAGGGCATGG - Intronic
925285300 2:2711869-2711891 AGGAATCAGGAATTTGGGAACGG + Intergenic
926438553 2:12862282-12862304 ATAGATCAAGAATCTGGGCCTGG - Intergenic
926624580 2:15080568-15080590 ATGGATCAAGAACTTGAGCAAGG + Intergenic
926671981 2:15585283-15585305 GGGGGTCAGGAATTTGGGCAGGG - Intergenic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
926893003 2:17654535-17654557 ATGGATTAGGAATAGGTTCAGGG - Intronic
927248212 2:20975042-20975064 GTGGATCAGCAATTTGGGCTGGG + Intergenic
929030714 2:37647972-37647994 GTGGGTCAGGAATCTGGGCAGGG - Intronic
929431967 2:41894761-41894783 ATGAATCAGCAATTTAGGCAGGG + Intergenic
929472924 2:42214614-42214636 GTGGGTCAGGAATTTGGGCAGGG + Intronic
929586558 2:43119461-43119483 GCGGATCAGGAATTTGGGTAGGG + Intergenic
930562233 2:52974153-52974175 ATGGGTCAGGAATTTGGGAGAGG + Intergenic
930875448 2:56210493-56210515 GTGGCTCAGGAATTTGGACAAGG + Intronic
931125798 2:59274830-59274852 GGGGATCAGGAATGTGGGGATGG - Intergenic
931450182 2:62362078-62362100 GTGAGTTAGGAATATGGGCAGGG - Intergenic
932112149 2:69011624-69011646 GTGGATCAGGAATCAGGGAATGG + Intergenic
932338161 2:70942844-70942866 ACTGGTCAGGACTATGGGCAAGG + Intronic
932504218 2:72213294-72213316 GTGGGTCAGGAATTTGGCCAGGG - Intronic
932545614 2:72705951-72705973 GTGGATCAGAAATATAGGCTGGG - Intronic
932888927 2:75573593-75573615 ATGGATCAGGAATTTAGGAGTGG + Intergenic
933024986 2:77245007-77245029 GTGGGTCAGGAATGTGGGCTTGG - Intronic
933849105 2:86351174-86351196 GTGGGTCAGGAATAGAGGCAAGG - Intergenic
933996010 2:87670523-87670545 GTGAGTCAGGAATATGGACACGG + Intergenic
934186478 2:89681780-89681802 GTGGGTCAGGAATCTGGGCATGG - Intergenic
934315539 2:91915450-91915472 GTGGGTCAGGAATCTGGGCATGG + Intergenic
935188164 2:100753152-100753174 ATGGTACAGAAACATGGGCATGG + Intergenic
936297847 2:111280389-111280411 GTGAGTCAGGAATATGGACACGG - Intergenic
938699620 2:133864297-133864319 GTTGATGAGGAATATGGACAAGG - Intergenic
939279811 2:140048578-140048600 GTGGGTCAGGAATTTAGGCAAGG - Intergenic
939876861 2:147587384-147587406 AGGGATGGGGAATATTGGCAGGG + Intergenic
940092379 2:149934855-149934877 GTGGATCAGGAGCCTGGGCATGG - Intergenic
940121658 2:150274683-150274705 ATGGGTAAGGAATCTGAGCATGG + Intergenic
940148198 2:150570144-150570166 GTGAATGAGGAATATGGCCAGGG + Intergenic
942626993 2:177912073-177912095 ATGGATCAGAGATGTGGGGAGGG + Intronic
944239215 2:197469500-197469522 ATGGATCAGGGCTAAGGGCCAGG + Intronic
945470370 2:210222310-210222332 AGGGATCAGGAGTATGTGCCTGG + Intronic
945933248 2:215877617-215877639 TTGGGTCAAGAATCTGGGCATGG - Intergenic
946076509 2:217077988-217078010 ATGGATCAGGAATTTGGGCAAGG + Intergenic
946296511 2:218788002-218788024 GTGTGTCAGGAATGTGGGCAGGG + Intronic
946452370 2:219791775-219791797 GTGGGTCAGGAATTTGGGAAAGG - Intergenic
946815257 2:223570626-223570648 ATGGGTGAGAAATACGGGCATGG - Intergenic
947237803 2:227962287-227962309 GTGGATGAGGAATTTGAGCAAGG + Intergenic
947346322 2:229193098-229193120 ATGGATCAGGAATATGGGCAGGG + Intronic
947437774 2:230087661-230087683 GTGGATCAGGAACTTGGGAAGGG + Intergenic
948166855 2:235869646-235869668 GTGGGTCAGGAGTTTGGGCAGGG + Intronic
948747549 2:240107399-240107421 GAGGAGCAGGAATGTGGGCACGG - Intergenic
1168759777 20:342107-342129 GTGGGTCAGGAATTTGGGAAGGG - Intergenic
1169473018 20:5904508-5904530 ATGGATGAGGGAAATGGGCAAGG + Intergenic
1169551743 20:6708204-6708226 CTGGGTCAGGAATTTGGGCAGGG - Intergenic
1170210840 20:13844992-13845014 GTGGGTCAGGAATTTGGGCAGGG - Intergenic
1170322394 20:15114616-15114638 ATGGATCAGAAGTCTGGGCATGG - Intronic
1170533848 20:17320829-17320851 ATGCAGAAGGAATATGGGAAAGG + Intronic
1170535299 20:17335116-17335138 GTGGTTCAGGAATTTGGGAAGGG + Intronic
1170598000 20:17819953-17819975 ATGGATTGGGAATCTGGGCAGGG + Intergenic
1172070790 20:32255354-32255376 GTGGATCAGGAATTTGCACAAGG + Intergenic
1172685100 20:36747585-36747607 ATAGATGAGGAATTCGGGCATGG - Intergenic
1173649721 20:44655452-44655474 ATAGGTCAGGAATTTGGGCTGGG - Intergenic
1173982385 20:47234577-47234599 GTGGGTCAGGAATCTGGGCATGG - Intronic
1174147956 20:48465365-48465387 AGGGGTCAGGAGTCTGGGCATGG + Intergenic
1174274717 20:49395490-49395512 CTGGATCAGGAATATGCGGATGG + Intronic
1174678569 20:52381761-52381783 AAGGGTCAGGAATCCGGGCAAGG - Intergenic
1175190295 20:57207422-57207444 ATTGCTCAGGAATTTAGGCAGGG - Intronic
1175850270 20:62086866-62086888 GTGGATCAGGGATCCGGGCAGGG - Intergenic
1177081529 21:16644476-16644498 GTGGGTCAGAAATCTGGGCATGG + Intergenic
1177662939 21:24111070-24111092 ATGGATCAGGAATTCAGGAAGGG - Intergenic
1177816370 21:25981516-25981538 ATGAATGAGGAATCTGAGCAAGG + Intronic
1177861927 21:26464360-26464382 ATGGATCAGGAATCTGAGGGTGG - Intergenic
1177959830 21:27649647-27649669 ATGGAGGAAGAATTTGGGCAGGG + Intergenic
1178049254 21:28730434-28730456 ATGGATCAGGGATCTGGGTACGG + Intergenic
1178639393 21:34333968-34333990 ATGCTTGAGGAATTTGGGCAGGG + Intergenic
1180542309 22:16461335-16461357 GTGGGTCAGGAATCTGGGCATGG + Intergenic
1181899039 22:26137283-26137305 AAGGATAAGGAAAAAGGGCAAGG + Intergenic
1182081344 22:27531133-27531155 GTGGATCAGGAGTCTGAGCATGG - Intergenic
1182555752 22:31127522-31127544 CTGGATCATGAGTATGGGCTGGG + Exonic
1182647501 22:31822301-31822323 ATAGATAAGGGATATGGGGAGGG + Intronic
1182786989 22:32916271-32916293 GTGGGCCAGGAATTTGGGCAGGG - Intronic
1183312205 22:37116448-37116470 AAGGATAAGGAGTCTGGGCAAGG + Intergenic
1183669139 22:39262088-39262110 GTGGGTCAGGAATTTGGGAAGGG - Intergenic
1184485862 22:44779017-44779039 ATAGATCAGGAATCTTGGAATGG + Intronic
949249107 3:1961312-1961334 GTGGATCAGGAGTTTGGACAGGG - Intergenic
949811477 3:8011494-8011516 CTGGATCAGGAGTCTGGGCATGG + Intergenic
949877610 3:8636491-8636513 ATGGGTCAGGAATTAGGGTAGGG - Intronic
949930706 3:9076179-9076201 GTGGGTCAGCAATTTGGGCAGGG - Intronic
950584464 3:13882440-13882462 AGGGCTCAGGAAGTTGGGCAGGG - Intergenic
950921896 3:16703413-16703435 ATGGGCCACGAATGTGGGCAGGG - Intergenic
950970968 3:17187538-17187560 GTGGATCAGGAATTTGGGCAGGG - Intronic
951366305 3:21787451-21787473 CTGGATAAGGAGTAGGGGCACGG - Intronic
951431098 3:22607871-22607893 ATAAATCAAGAATTTGGGCAGGG - Intergenic
951656482 3:25014614-25014636 GTCAATCAGGAACATGGGCAGGG - Intergenic
951787429 3:26437710-26437732 ATGGATCAGGAATTTAGACAAGG + Intergenic
951952460 3:28215528-28215550 GTGGGTCAGGAATTTTGGCAGGG + Intergenic
952161648 3:30699754-30699776 ATGGGTCAGAAATTTGGGAAAGG + Intergenic
952357958 3:32602125-32602147 ATGGGTCAGGAATTTGAACAGGG + Intergenic
952615254 3:35263407-35263429 ATGGGTCAGGACTTTGGGCAGGG + Intergenic
953181800 3:40602581-40602603 GTGAGTCAGGAATTTGGGCAGGG + Intergenic
953232401 3:41076585-41076607 ATGGATCAGAGATACTGGCAAGG + Intergenic
953687509 3:45089634-45089656 ATGGATCAGGAATTCAGACAGGG - Intronic
953808270 3:46090421-46090443 ATGGTTCTGTAAGATGGGCAGGG - Intergenic
954312544 3:49781502-49781524 ATGGAGCTGGACTATGGACAAGG + Intronic
954500049 3:51004396-51004418 ATGGATCAGGAATCTGGAAGTGG - Intronic
954644473 3:52122558-52122580 ATGGCTCAGAACTTTGGGCATGG - Intronic
954648157 3:52143933-52143955 ATGGATCAGGAGCCTGGGCCTGG - Intronic
955544683 3:60015590-60015612 AGGGAGGAGGAATATGGGGAAGG - Intronic
955633726 3:61002843-61002865 ATGGAGCAGGAAATTGGGCCGGG - Intronic
955806668 3:62743329-62743351 ATACATAAGGTATATGGGCATGG - Intronic
955978819 3:64503913-64503935 ATGGATCAGGAATCCAGGTATGG - Intergenic
956816461 3:72912808-72912830 ATGGATCAGGAATTCAGACAAGG - Intronic
957829549 3:85498382-85498404 ATGAATCAATAATGTGGGCAAGG + Intronic
958454638 3:94315421-94315443 CTGGATCAGGAATTTGGAAAGGG + Intergenic
960028898 3:113038479-113038501 GTGGGTCAGGAATGTGGGCAGGG + Intergenic
960130949 3:114055939-114055961 AAGGGGCAGGAATATAGGCAGGG + Intronic
960226269 3:115172825-115172847 GTGGATCAGGAATGTGGACATGG - Intergenic
960909665 3:122636717-122636739 ATGGGTCAGGAATTCAGGCATGG + Intronic
961425835 3:126847151-126847173 ATGGGTCAGGGATCTGGGCCTGG + Intronic
962918445 3:139929922-139929944 ATGGGTCAGGAATTTGGGCAGGG + Intergenic
964468899 3:157030655-157030677 GTGGGTCAGGAATCTGAGCATGG + Intronic
966625121 3:182007469-182007491 ATGAATCAGGCATATGTGTAGGG + Intergenic
970271906 4:14357129-14357151 ACGGGTCAGGAATATGGGCAGGG - Intergenic
970660136 4:18276107-18276129 GTGGGTCAGGAATCTGGGAATGG + Intergenic
971538939 4:27791052-27791074 ATGAAGCAGGAATTTAGGCAAGG + Intergenic
971755620 4:30704332-30704354 GTGGGTCAAGAATTTGGGCAGGG + Intergenic
972388546 4:38591136-38591158 ATGGATCAAGAATTTAGGCAAGG + Intergenic
972704922 4:41532893-41532915 ATGGGTCAGGAATATGAGCAAGG + Intronic
972978480 4:44666310-44666332 TTGGGTCAGGAAACTGGGCATGG - Intronic
973080699 4:45989250-45989272 AAGGATCAGTAACTTGGGCAAGG - Intergenic
974566693 4:63586699-63586721 GTGGTTCAGGAATTTGGGCAGGG - Intergenic
975181031 4:71345316-71345338 ATGAATAAAGAATTTGGGCAGGG - Intronic
977442616 4:97088534-97088556 GTGGATCAGGGATTTGGGTATGG + Intergenic
977830376 4:101584016-101584038 ATAGATCAGGAAGCTGGACATGG - Intronic
977947784 4:102933544-102933566 GTGGGTCAGGAATCTGGGCATGG + Intronic
978429357 4:108617527-108617549 ATGGATCAGGAATTTCTACATGG - Intergenic
978738085 4:112107036-112107058 GTGGATCAGGAATTTGGACAAGG - Intergenic
979163401 4:117493087-117493109 ATGGGCCAGGTATCTGGGCATGG - Intergenic
980606824 4:135103113-135103135 ATGAGCCAGGAATATGGGCAGGG + Intergenic
981073868 4:140571826-140571848 ATGGATCAGGAATTTAGACTGGG - Intergenic
981640687 4:146940506-146940528 ATGGTTCAGGAATAAGGACAGGG + Intronic
982155473 4:152516142-152516164 ATTGGTCAGGAATTTGGGTATGG - Intronic
982888006 4:160808031-160808053 ATATTTCAGGAATATGGGAATGG - Intergenic
983271522 4:165567785-165567807 ATGGGTCAGGAGTTTGGACAGGG - Intergenic
983303068 4:165952259-165952281 ATAGATCAACAATATGGACAAGG - Intronic
984041546 4:174740539-174740561 GTGGATCAGGAATATAGGCAGGG - Intronic
984051317 4:174868597-174868619 ATAGGTCAGGAATCTGTGCATGG - Intronic
984810285 4:183790208-183790230 GTGGATCAGGAATTCAGGCAGGG + Intergenic
985476197 5:80626-80648 ATGGATGAGGAATGGGGACAAGG - Intergenic
985548904 5:523536-523558 ATGAACCAGTAATGTGGGCACGG - Intronic
985727886 5:1525204-1525226 ATGGGGCAGGAATATGGGCTGGG - Intergenic
986517671 5:8581024-8581046 ATGGATCAGGAAGAAGGAGAGGG - Intergenic
986592109 5:9381740-9381762 TGGGGTCAGGAATCTGGGCAGGG - Intronic
988545148 5:32149075-32149097 CTGAATCAGTTATATGGGCATGG + Intronic
988699959 5:33663393-33663415 ATGAATCAGGAATAAAGGGAAGG + Intronic
988986803 5:36628101-36628123 ATGTAACAGTAATATGGTCAAGG - Intronic
989015433 5:36926299-36926321 GTGGGTCAGGAATTTAGGCAGGG + Intronic
991260929 5:64666914-64666936 ATGGGTCAGGAATCTGGGCAAGG - Intergenic
991553819 5:67872960-67872982 CTGGATAAGGAATCTGAGCAGGG + Intergenic
992623750 5:78618351-78618373 GTGGGTCAAGAATTTGGGCAAGG + Intronic
994807272 5:104465593-104465615 ATGAATCTGCAATGTGGGCAGGG + Intergenic
995126370 5:108580471-108580493 ATGGGTCAGGAATCCAGGCATGG - Intergenic
995491563 5:112697895-112697917 ATTGGTCAGGAATTTGAGCATGG + Intergenic
995969925 5:117955937-117955959 ATGGCTCAAGAATTTGGGAAGGG + Intergenic
996447476 5:123572485-123572507 ATGGGTCAGGAATACGGGCATGG + Intronic
996718144 5:126604035-126604057 AAGGAAGAGGAAAATGGGCAAGG + Exonic
997036505 5:130198980-130199002 TTGGGTCAGGAATATGGGAAGGG + Intergenic
999985876 5:157004929-157004951 AGGGGTCAAGAATCTGGGCAGGG + Intergenic
1001770399 5:174291859-174291881 AGGGGTCAGGAACCTGGGCATGG + Intergenic
1002655450 5:180743098-180743120 ATGGATGAGGAAATGGGGCAGGG - Intergenic
1003440603 6:6138000-6138022 GTGGAACAGGAATTTGGGCAAGG + Intergenic
1003593506 6:7455342-7455364 GTGGATCAGGAAGTTGGGAATGG - Intergenic
1003682425 6:8269258-8269280 ATGGGTCAGGGATTTGGGCAGGG + Intergenic
1003689971 6:8344264-8344286 ATGGATCAGGACTGTTGGAATGG + Intergenic
1005308758 6:24538957-24538979 ATGCATCAGAAATATGTCCATGG + Intergenic
1005601758 6:27433132-27433154 GTGGGTCAGGAATTTGGACAGGG - Intergenic
1006588488 6:35135453-35135475 GTGGATGAGAGATATGGGCATGG - Intronic
1006595444 6:35189853-35189875 ATGGACCAGGAATAGGGTGAGGG + Intergenic
1007132707 6:39491436-39491458 CTGGATCAGGAGTTTGGGAAGGG - Intronic
1007655601 6:43449405-43449427 CAGGATCTGGAATATGGGAATGG - Exonic
1008711273 6:54230175-54230197 ATGGATAAGGAATCAGGGAAGGG - Intronic
1008823637 6:55664661-55664683 GTGGGTCAGGAATCTGGACAAGG + Intergenic
1008826815 6:55704922-55704944 ATGGAAGAGGCATATAGGCAAGG - Intergenic
1009288554 6:61854447-61854469 ATGGTTCAAGAATATTGGCAAGG - Intronic
1010994762 6:82520445-82520467 ATGGAACAGGATTTGGGGCATGG + Intergenic
1012016820 6:93863085-93863107 GTGGGTCAGGAATTTGGGTAGGG + Intergenic
1013368142 6:109449901-109449923 AAGGTTCAGGAAGAGGGGCAGGG - Intronic
1014453387 6:121608747-121608769 ATGCAGCAGTAATAAGGGCAAGG - Intergenic
1014608479 6:123509689-123509711 GTGGATCAAGAATCTGGGCATGG - Intronic
1015980725 6:138835777-138835799 AGCAATCAGGAATATGGGAATGG - Intronic
1018928618 6:168224345-168224367 ATGGAGCAGAAATAAGGGTACGG + Intergenic
1019884643 7:3893261-3893283 AGTGATTAGGAATATGGGCACGG + Intronic
1019963912 7:4483694-4483716 ATGGGTAAGGAATTTGGGAAGGG - Intergenic
1020827971 7:13055677-13055699 ATGGATCAGGAAGGTGGAAAAGG - Intergenic
1022394486 7:29973793-29973815 AACAATCAGGAATATGGGCAAGG + Intronic
1022570431 7:31447614-31447636 ATGGGTCAAGAATTTCGGCAGGG - Intergenic
1022864172 7:34400050-34400072 AGGGATCCAGAATTTGGGCAGGG + Intergenic
1023153527 7:37224824-37224846 ATGCTTCAGGAAGATGGCCACGG - Intronic
1024725833 7:52193041-52193063 ATGGGTCAGGCATTTGGGCAGGG - Intergenic
1026273584 7:68857585-68857607 GTGGATCAGAAATTTGGGAAAGG + Intergenic
1027813120 7:82931428-82931450 GTGGGTCAGCAATCTGGGCATGG + Intronic
1027919415 7:84373337-84373359 ATGAAGTAGGAATTTGGGCAAGG - Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1028830965 7:95326151-95326173 GTGCATAAGGAATTTGGGCAGGG + Intergenic
1029970303 7:104782035-104782057 ATGGACCAGGAATTCAGGCAGGG + Intronic
1029989586 7:104950883-104950905 ATGGGTCAGGAATTTGGGAAGGG - Intergenic
1030436754 7:109531223-109531245 ATGGGTCAGGAATTTGATCAGGG - Intergenic
1032141525 7:129335529-129335551 GTGGGTCAGGATTATGGGAATGG + Intronic
1032227926 7:130048452-130048474 GTGGATCAGGAATCCAGGCATGG - Intronic
1032512452 7:132482535-132482557 GTGGTTCTGGAATCTGGGCATGG - Intronic
1033044226 7:137946567-137946589 ATGGGTCAGGAGTCTGGGCATGG - Intronic
1033302262 7:140196944-140196966 TTGGGTCAGGAGTCTGGGCATGG - Intergenic
1034196680 7:149253819-149253841 CTGGACCAGGAATGTGGGCAGGG + Exonic
1034197659 7:149260849-149260871 AAGGGTCAGGAAAATGGGCCAGG - Intergenic
1035184883 7:157118734-157118756 ATGAATCTGTAATCTGGGCAGGG + Intergenic
1035964280 8:4172970-4172992 GTGGGTCAGGAATCTGAGCATGG - Intronic
1036069470 8:5424782-5424804 ATGGATAAGAAGTTTGGGCAGGG + Intergenic
1036680678 8:10870749-10870771 ATTCATCATGACTATGGGCATGG + Intergenic
1037071102 8:14650223-14650245 ATGGATCAGGAGTAGGAGAAAGG + Intronic
1038275430 8:26117115-26117137 GAGGATCAGGAATTTGGGCAAGG - Intergenic
1038523425 8:28252926-28252948 ATGGGTCAGGCATTTGGGCAGGG - Intergenic
1038580728 8:28747198-28747220 AGGGGTCAGGAATCTGGGGAAGG - Intronic
1038677133 8:29633415-29633437 GTGACTCAGGAATTTGGGCAAGG + Intergenic
1039754070 8:40504208-40504230 ATGGATCAGGAAATCAGGCAGGG + Intergenic
1039773832 8:40716278-40716300 CTGCATCAGAAATATGGGGAGGG + Intronic
1040653989 8:49482932-49482954 ATGGGTCAGGAATTTGGACAGGG - Intergenic
1041110936 8:54481707-54481729 ATTGATCAGCAATTTAGGCAGGG + Intergenic
1041499036 8:58519474-58519496 GTGGGTCAAGAATATGGGTAGGG - Intergenic
1042869399 8:73383936-73383958 ATAGATCAGGAGTATGGACATGG + Intergenic
1042967938 8:74375712-74375734 ATAGATCAGGAATAAGGCAAAGG + Intronic
1042972617 8:74427325-74427347 ATGGGTCAGGAAATTGGGCCGGG - Intronic
1043470315 8:80555576-80555598 ATGCATCTGCAATTTGGGCAGGG - Intergenic
1043495241 8:80792915-80792937 GTGGGTCAGGAATCTGGGCATGG - Intronic
1044446064 8:92277453-92277475 ATGGATCCAGAATTTGTGCAGGG - Intergenic
1046360685 8:113150564-113150586 GTAGGTCAGGAATATGCGCATGG - Intronic
1047701963 8:127457638-127457660 ATGGGTCAGGAATCTGGGCCTGG - Intergenic
1047878116 8:129162944-129162966 ATGAATCTGCAATTTGGGCAAGG + Intergenic
1047891292 8:129314003-129314025 ATGGATCAGAAATCTGGGTGTGG - Intergenic
1048488943 8:134874057-134874079 GTGGGTCAGGAATCTGAGCAGGG + Intergenic
1048592292 8:135832032-135832054 ATGGGTCAGGAGTCAGGGCATGG - Intergenic
1049252107 8:141594771-141594793 ATGAATCTGCAAGATGGGCAGGG - Intergenic
1050125942 9:2356396-2356418 ACGGGTCAGGAATCTGGGTATGG + Intergenic
1050850846 9:10284592-10284614 GTGGGTCAGAAATATAGGCATGG + Intronic
1051315555 9:15826792-15826814 ATGGATCAGGAAATAGAGCATGG - Intronic
1051908552 9:22126251-22126273 ATTCATCATGAATATGGACATGG - Intergenic
1052841236 9:33292590-33292612 ATTGATCAGGAAACTGGCCATGG - Intronic
1053422498 9:37988281-37988303 ATGGATCAGGCAGCTGGCCAAGG - Intronic
1055160828 9:73125852-73125874 ATGGATGAGGAATAAGGGTGAGG + Intergenic
1055313729 9:75012003-75012025 ATGGGTCAGGAGTCTGGGCTTGG - Intronic
1055502071 9:76911091-76911113 ATGGGCCAGGAATTTGGGCAGGG - Intergenic
1055744982 9:79433720-79433742 ATGGATCAGGAATTTGAGGGAGG + Intergenic
1055978095 9:81973946-81973968 GTGGATCAGGAATCCAGGCAAGG + Intergenic
1056194270 9:84214259-84214281 ATGGTTCTGCAATCTGGGCACGG + Intergenic
1056683082 9:88737068-88737090 GTGGATCAGGAATCTGAGCAAGG + Intergenic
1056817092 9:89809893-89809915 ATGGGTCAGGAATTGGGACAGGG - Intergenic
1057706416 9:97398235-97398257 GTGGATCAGTAACCTGGGCATGG - Intergenic
1057749964 9:97784483-97784505 GTGGGTCAGGAATTTGGGCCAGG - Intergenic
1059410409 9:114128425-114128447 ATGGGTCAGGAATTTGGGCAGGG - Intergenic
1059796710 9:117705452-117705474 AAGGAGGAGGACTATGGGCAGGG - Intronic
1060294534 9:122334263-122334285 ATGGATGTAAAATATGGGCATGG + Intergenic
1061346195 9:130027597-130027619 ATGGGTCAGGAATTTGGACAGGG + Intronic
1185701489 X:2234170-2234192 ATGGATCAGGGCTGTGTGCATGG - Intronic
1185701511 X:2234322-2234344 ATGGATCAGGGCTGTGTGCATGG - Intronic
1185701520 X:2234380-2234402 ATGGATCAGGGCTGTGTGCATGG - Intronic
1186230330 X:7446735-7446757 GTGGATCAGGAATCTGGGTATGG - Intergenic
1186497138 X:10020514-10020536 ATGGGTCAGGAACATGTTCATGG + Intronic
1186530119 X:10286874-10286896 ATGGGTCAGGAATTTGGGCAGGG + Intergenic
1186742065 X:12529038-12529060 ATGGGTCAGAAATTTGGGCCTGG + Intronic
1186776849 X:12873271-12873293 AAGGATCAGGAATGTGGGGTAGG - Intronic
1186962178 X:14748419-14748441 GTGGGTCAGGAATCTGTGCATGG - Intergenic
1187744884 X:22398499-22398521 ATGGGTCAGGAATTGGGGCAGGG + Intergenic
1188323784 X:28774348-28774370 GTGGGTCAGGAATCTGGGCATGG + Intronic
1189160178 X:38803117-38803139 GTGGATGAGGAATATGGCAAGGG + Exonic
1189261191 X:39679905-39679927 CAGGATCAGCAATTTGGGCAGGG + Intergenic
1189351043 X:40275985-40276007 CTGGGTCAGGAATTTGTGCAGGG + Intergenic
1189506989 X:41621617-41621639 GTGGGTCAGGAATCTGGGCGTGG - Intronic
1189965339 X:46366638-46366660 AATGATCAGGATGATGGGCATGG - Intergenic
1190097111 X:47490563-47490585 ATTGCTCACGAATCTGGGCATGG - Intergenic
1190776463 X:53555971-53555993 ATAGAACAGGAATGTGTGCAAGG - Intronic
1192054291 X:67757757-67757779 ACAGATGAGGAATATTGGCAGGG + Intergenic
1192547663 X:72027273-72027295 CTGGATCAGGAGTTGGGGCATGG + Intergenic
1193653697 X:84171265-84171287 ATGGATCAGGAATCTGGGCTTGG - Intronic
1194440374 X:93925586-93925608 GTGGGTCAGGAATTTGGACAGGG + Intergenic
1194449555 X:94027793-94027815 ATGTAGCAGGAATGTGGGGAGGG - Intergenic
1195516826 X:105786484-105786506 GTGCATCAGGAATCTGAGCATGG + Intergenic
1195543917 X:106093681-106093703 ATGAAACAAGAATATGGGCAAGG + Intergenic
1196078801 X:111608686-111608708 ATGGGTCAGGAGTTTGGGCATGG + Intergenic
1196089073 X:111719542-111719564 GTGGATTAGGAATCTGGACACGG + Intronic
1196210365 X:112989142-112989164 ATGAATAAATAATATGGGCACGG + Intergenic
1196769622 X:119280951-119280973 ATGTGGCAGGAATCTGGGCATGG - Intergenic
1198493108 X:137163551-137163573 ATGTTTCTGGAATTTGGGCAAGG - Intergenic
1198593871 X:138214960-138214982 AAGGCTCAGGGATATGGGGAAGG + Intergenic
1198706696 X:139456905-139456927 GTGGGTCAGGAATCTGGGCATGG + Intergenic
1199235909 X:145492205-145492227 ATGCATCAGGAGTCTGGACATGG - Intergenic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1199376635 X:147119800-147119822 ATGGGTCAGCAATCTGGACATGG + Intergenic
1199966548 X:152825099-152825121 AGGGATCAGGAAGATGGGGAAGG - Intergenic
1199966562 X:152825164-152825186 AGGGATCAGGAAGATGGGGACGG - Intergenic
1201183204 Y:11370272-11370294 GTGGGTCAGGAATCTGGGCATGG + Intergenic
1201602782 Y:15749117-15749139 ATGGAAATGGAATATGGGAAGGG + Intergenic