ID: 947353343 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:229269500-229269522 |
| Sequence | GATGTGACCAAAATTCCTTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 161 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 147} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 947353343_947353346 | 19 | Left | 947353343 | 2:229269500-229269522 | CCTCAAGGAATTTTGGTCACATC | 0: 1 1: 0 2: 0 3: 13 4: 147 |
||
| Right | 947353346 | 2:229269542-229269564 | GCTACCCTCTGCACTTGAACAGG | 0: 1 1: 0 2: 0 3: 6 4: 80 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 947353343 | Original CRISPR | GATGTGACCAAAATTCCTTG AGG (reversed) | Intronic | ||