ID: 947353346

View in Genome Browser
Species Human (GRCh38)
Location 2:229269542-229269564
Sequence GCTACCCTCTGCACTTGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947353342_947353346 22 Left 947353342 2:229269497-229269519 CCACCTCAAGGAATTTTGGTCAC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 947353346 2:229269542-229269564 GCTACCCTCTGCACTTGAACAGG 0: 1
1: 0
2: 0
3: 6
4: 80
947353343_947353346 19 Left 947353343 2:229269500-229269522 CCTCAAGGAATTTTGGTCACATC 0: 1
1: 0
2: 0
3: 13
4: 147
Right 947353346 2:229269542-229269564 GCTACCCTCTGCACTTGAACAGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947353346 Original CRISPR GCTACCCTCTGCACTTGAAC AGG Intronic