ID: 947353346

View in Genome Browser
Species Human (GRCh38)
Location 2:229269542-229269564
Sequence GCTACCCTCTGCACTTGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947353342_947353346 22 Left 947353342 2:229269497-229269519 CCACCTCAAGGAATTTTGGTCAC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 947353346 2:229269542-229269564 GCTACCCTCTGCACTTGAACAGG 0: 1
1: 0
2: 0
3: 6
4: 80
947353343_947353346 19 Left 947353343 2:229269500-229269522 CCTCAAGGAATTTTGGTCACATC 0: 1
1: 0
2: 0
3: 13
4: 147
Right 947353346 2:229269542-229269564 GCTACCCTCTGCACTTGAACAGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947353346 Original CRISPR GCTACCCTCTGCACTTGAAC AGG Intronic
901175383 1:7294922-7294944 ACTCCCCTCTGCACTTGGTCTGG + Intronic
902743679 1:18458533-18458555 GCTCCCCTCTTCACTTCACCTGG - Intergenic
905022510 1:34827620-34827642 TCTACCATCTGCACGTGTACAGG + Intronic
918850964 1:189689641-189689663 CCTGCCCTCTTAACTTGAACAGG - Intergenic
919793215 1:201305669-201305691 GCCACCCCATGCACTGGAACAGG - Intronic
922015500 1:221641841-221641863 ACTACGCTCTGTACTTGCACAGG - Intergenic
1066510273 10:36087749-36087771 GCTAACCTCTGCAATTCAACAGG + Intergenic
1071910651 10:90229153-90229175 GATAATCTCTGCACTTTAACTGG + Intergenic
1074887981 10:117709785-117709807 TCTTCCCTCTTCACTTAAACTGG + Intergenic
1076782816 10:132733780-132733802 GCCGGCCTCTGCACCTGAACAGG + Intronic
1083333405 11:61909515-61909537 CCTGCCCTCTGCTCTGGAACCGG + Intronic
1089180562 11:116580432-116580454 GCTCCCCTCTACACCTGAGCGGG - Intergenic
1094008990 12:25786229-25786251 GCTAGCCTCTGCAATTAATCTGG + Intergenic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1098518167 12:71402893-71402915 GGTACCCTCTGCACGGGAAAAGG + Intronic
1105723629 13:23140217-23140239 GCCACCCTTTGCACTTGTAAAGG + Intergenic
1112127221 13:96481352-96481374 GCTTCCCTCTTCACTTACACAGG - Intronic
1114786975 14:25611618-25611640 GATACTCTCTGCCTTTGAACTGG + Intergenic
1115403658 14:32992116-32992138 GCTGCCATCTGCACATGGACTGG + Intronic
1121437786 14:93930313-93930335 GCTCCCCTCTGCACTGTCACAGG - Intergenic
1122706564 14:103625592-103625614 GCTCCCCTCTGCACTTCTTCAGG + Intronic
1127196957 15:56597576-56597598 GCCACCATCTGCAATTGAATAGG - Intergenic
1130813945 15:87410975-87410997 GCTCCCCTTTGCTCTTCAACAGG + Intergenic
1134254346 16:12599361-12599383 GCTGCCATGTGCAGTTGAACAGG - Intergenic
1136394471 16:29985636-29985658 GCTTCCCTCTGCACTCGCCCAGG + Exonic
1138224100 16:55277767-55277789 TTTTCCCTCTGCACTTGATCTGG - Intergenic
1138633773 16:58320285-58320307 TCTATCCTCTGCACTGGAACAGG + Intronic
1141873424 16:86805379-86805401 GCTTCCCTCTGCAGTGGAAGGGG - Intergenic
1143420619 17:6788831-6788853 GCTAACCTGTGCACCTGAAAGGG + Intronic
1147969275 17:44210947-44210969 CCGACCCTCTGCACCTGGACAGG - Exonic
1155199300 18:23503428-23503450 GCGGCCCTCTGCGCTTAAACGGG - Intergenic
1158973840 18:62692643-62692665 GCCACCATGTGCAGTTGAACAGG - Intergenic
1164267501 19:23633237-23633259 GCTGCCACCTGCACTAGAACAGG + Intronic
928842103 2:35621597-35621619 GCCACCATCTCCACTGGAACTGG - Intergenic
930444138 2:51449821-51449843 GCTACCCTCTGAACTCAGACTGG + Intergenic
937034831 2:118772213-118772235 CCTACCCTCTGCAGTAGAGCAGG - Intergenic
937390551 2:121482254-121482276 GCTTCCCTCTGCACCTGGACAGG + Intronic
945836129 2:214837974-214837996 GCTACCCCCTCCTCTTTAACTGG - Intergenic
947353346 2:229269542-229269564 GCTACCCTCTGCACTTGAACAGG + Intronic
947635537 2:231679129-231679151 CCTACCCTCTGGCCTTGACCTGG + Intergenic
1169605826 20:7317855-7317877 GCTATACTCTGCTCATGAACTGG - Intergenic
1170666324 20:18389725-18389747 GCTCCTCTCTGCACGAGAACTGG + Exonic
1171525583 20:25807666-25807688 ACTTACCTCTACACTTGAACAGG - Intronic
1171551244 20:26048218-26048240 ACTTACCTCTACACTTGAACAGG + Intergenic
1172093141 20:32447622-32447644 GCTGCGCTCTGCAGATGAACTGG - Exonic
1177926305 21:27220056-27220078 GCTACTCTCTACACCTGAACTGG + Intergenic
1178805623 21:35836846-35836868 GCTACCCTCTGCAAGTCATCTGG + Intronic
1180907911 22:19428559-19428581 GCTACCCTCTCCACTTTGAATGG + Intronic
1180988460 22:19919465-19919487 GCTGCCCTCTGTACAGGAACTGG + Intronic
1184852084 22:47126739-47126761 GCCACCCTCTGCCCTTGACATGG - Intronic
1185042618 22:48513105-48513127 GAAACCCTCTGCACATAAACAGG - Intronic
1185207830 22:49550250-49550272 CCTGCCCTCTGCCCTTGATCTGG - Intronic
952950394 3:38519729-38519751 GCTACCCTTTGGCCTGGAACAGG + Intronic
953253409 3:41266289-41266311 GCAACCCTGGGCACTTGAACAGG + Intronic
956602219 3:71034244-71034266 GCTACCATCTGGACTTGATCCGG + Intronic
963264378 3:143226225-143226247 GCTTCCTTCTGCACTTTTACTGG - Intergenic
969640578 4:8395924-8395946 GTTAGCCTGTGCACTTTAACTGG + Intronic
973719092 4:53705369-53705391 CCTTCCCTCTGCACAGGAACAGG - Intronic
980212245 4:129804531-129804553 GCTACCCTCTGCAGGCGATCTGG + Intergenic
980325484 4:131339406-131339428 ACTTCCCTCTTCACTTAAACTGG - Intergenic
981051317 4:140312339-140312361 AATACCCTTTGCATTTGAACTGG + Intronic
983875457 4:172869802-172869824 TCTACCCTCTGCTCTAGAAATGG + Intronic
984563204 4:181295577-181295599 GCTACCTTATGTACTTGAGCAGG - Intergenic
985427105 4:189841611-189841633 CCTAACCTGTGCACTTGAAGGGG - Intergenic
990619924 5:57548799-57548821 GCTTCCCTCTGCAGGTGACCTGG + Intergenic
990776163 5:59308640-59308662 CCTACCCCCTGCACCAGAACAGG - Intronic
997922435 5:137995174-137995196 GCTACACTCTGCAGTTTAAACGG + Intronic
1002513573 5:179740228-179740250 GCTTCCTACTGCACTTGATCTGG - Intronic
1005636321 6:27756918-27756940 GAGACCCTCTGCACTAGAAGGGG - Intergenic
1007902661 6:45424454-45424476 GCTAACCTCTGAACTTGAGTAGG + Intronic
1007952122 6:45881807-45881829 ACAACCTTCTGCACTTGAAGAGG - Intergenic
1008473211 6:51907791-51907813 TCTAGCCTCTGCATTTTAACAGG + Intronic
1011322811 6:86115843-86115865 GCTCCCCTCTGGACCAGAACAGG + Intergenic
1014033338 6:116735894-116735916 GATAACCTCTGCACTTTAATTGG - Intronic
1018513431 6:164551861-164551883 GCTACTCTCAGTACTTGCACAGG + Intergenic
1019029503 6:168998212-168998234 GCTAAGCTGTGCACTTCAACTGG - Intergenic
1019126480 6:169844015-169844037 GCTGCCCTGTGCACATGAAATGG - Intergenic
1022956602 7:35386704-35386726 GGTACCCTCTGCACTTTACAGGG - Intergenic
1023292880 7:38686370-38686392 ACAAGCCTCTGCATTTGAACTGG - Exonic
1033209543 7:139450752-139450774 GCTGCCCTGAGCACTGGAACTGG + Intergenic
1047432777 8:124807072-124807094 GCTTCCCTCTGCCCCTGGACAGG + Intergenic
1049865627 8:144933796-144933818 GCTACCCACTTCCCTTGCACAGG + Intronic
1052733584 9:32317662-32317684 GCTACCATCTCCAGTGGAACTGG - Intergenic
1187720839 X:22149302-22149324 GCTTCACTCTGCCCTGGAACAGG - Intronic
1198779936 X:140223431-140223453 GCTTCCCTCTGCAGCTGACCTGG - Intergenic