ID: 947354781

View in Genome Browser
Species Human (GRCh38)
Location 2:229280696-229280718
Sequence CTCATCAATGCACCGTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947354781_947354786 22 Left 947354781 2:229280696-229280718 CCAGGTCACGGTGCATTGATGAG No data
Right 947354786 2:229280741-229280763 TTTCCTTATAAGCTTCCTCAGGG No data
947354781_947354785 21 Left 947354781 2:229280696-229280718 CCAGGTCACGGTGCATTGATGAG No data
Right 947354785 2:229280740-229280762 CTTTCCTTATAAGCTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947354781 Original CRISPR CTCATCAATGCACCGTGACC TGG (reversed) Intergenic
No off target data available for this crispr