ID: 947358078

View in Genome Browser
Species Human (GRCh38)
Location 2:229317820-229317842
Sequence AGCTTCACCTTTAAGATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947358078_947358079 -4 Left 947358078 2:229317820-229317842 CCATTGATCTTAAAGGTGAAGCT No data
Right 947358079 2:229317839-229317861 AGCTACATTTTGCTTTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947358078 Original CRISPR AGCTTCACCTTTAAGATCAA TGG (reversed) Intergenic
No off target data available for this crispr