ID: 947359032

View in Genome Browser
Species Human (GRCh38)
Location 2:229328454-229328476
Sequence GAACCAATCAGATCATCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947359031_947359032 -2 Left 947359031 2:229328433-229328455 CCAAAACAGAGTCAAGAAAGAGA No data
Right 947359032 2:229328454-229328476 GAACCAATCAGATCATCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947359032 Original CRISPR GAACCAATCAGATCATCAGC TGG Intergenic
No off target data available for this crispr