ID: 947360339

View in Genome Browser
Species Human (GRCh38)
Location 2:229339892-229339914
Sequence CATTAGCACTTTGACAAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947360339_947360343 15 Left 947360339 2:229339892-229339914 CCGTGTTTGTCAAAGTGCTAATG No data
Right 947360343 2:229339930-229339952 CAGACAGTTCCGTAAACAGAGGG No data
947360339_947360342 14 Left 947360339 2:229339892-229339914 CCGTGTTTGTCAAAGTGCTAATG No data
Right 947360342 2:229339929-229339951 CCAGACAGTTCCGTAAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947360339 Original CRISPR CATTAGCACTTTGACAAACA CGG (reversed) Intergenic
No off target data available for this crispr