ID: 947361008

View in Genome Browser
Species Human (GRCh38)
Location 2:229345415-229345437
Sequence GAGAATAGGGAAAATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947361008_947361016 17 Left 947361008 2:229345415-229345437 CCTGCCTCATTTTCCCTATTCTC No data
Right 947361016 2:229345455-229345477 TTAAGCAGAAAAAGGACCCTTGG No data
947361008_947361015 9 Left 947361008 2:229345415-229345437 CCTGCCTCATTTTCCCTATTCTC No data
Right 947361015 2:229345447-229345469 CACTGTTGTTAAGCAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947361008 Original CRISPR GAGAATAGGGAAAATGAGGC AGG (reversed) Intergenic
No off target data available for this crispr