ID: 947374200

View in Genome Browser
Species Human (GRCh38)
Location 2:229479275-229479297
Sequence CCTTTCACACAGTCCGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947374196_947374200 -10 Left 947374196 2:229479262-229479284 CCTGTGTCCAAGCCCTTTCACAC 0: 1
1: 0
2: 6
3: 17
4: 180
Right 947374200 2:229479275-229479297 CCTTTCACACAGTCCGCCTAAGG 0: 1
1: 0
2: 0
3: 0
4: 56
947374195_947374200 -9 Left 947374195 2:229479261-229479283 CCCTGTGTCCAAGCCCTTTCACA 0: 1
1: 1
2: 6
3: 18
4: 255
Right 947374200 2:229479275-229479297 CCTTTCACACAGTCCGCCTAAGG 0: 1
1: 0
2: 0
3: 0
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947374200 Original CRISPR CCTTTCACACAGTCCGCCTA AGG Intronic
910899218 1:92101520-92101542 CCTGCCACACAGTCCCCCAAGGG + Intronic
912243499 1:107937025-107937047 CCTTACACACAGTCAGGCAAAGG + Intronic
916097737 1:161365917-161365939 CCTTTGCCACACTCGGCCTAAGG - Exonic
923778834 1:237003759-237003781 CCTTTCACACATTCCCCGTGAGG - Intergenic
1065448624 10:25830163-25830185 TCTTTCACACAGGCTGCTTAAGG - Intergenic
1068940076 10:62671845-62671867 CCTTACACACACACTGCCTATGG - Exonic
1071374445 10:84988406-84988428 CCTTTCAGACAATCTCCCTAGGG - Intergenic
1071832290 10:89383728-89383750 CCTTCCTCACAGTCCACCTCTGG - Exonic
1071836007 10:89417611-89417633 CCTTTCTCACAGTCAGTCTCAGG - Exonic
1073577202 10:104636821-104636843 GCTCTCACACAGTCCCCATAGGG - Intergenic
1076625644 10:131819983-131820005 CCTTTCACCCAGTTCCCCCATGG - Intergenic
1080611312 11:33906444-33906466 CCTTACACACGGTCAGCCCAAGG - Intergenic
1084632683 11:70364654-70364676 CCTTTCCCACAGCCTGCCTCAGG + Intronic
1093160982 12:15746195-15746217 CCTTTCACACAGTGCTACTGAGG - Intronic
1093556438 12:20480733-20480755 CCTTTCACACTGCCCTACTATGG - Intronic
1110760110 13:79222135-79222157 CCTTTCCCACCGTCCACCCATGG + Intergenic
1128749734 15:70140408-70140430 CCTCTCACAGAGTCCACCTCTGG - Intergenic
1129896612 15:79113129-79113151 CTTTTCACCCAGTCAGCCAATGG - Intergenic
1134034490 16:11019187-11019209 ACTTTCAAACAGTCAGCCTTTGG - Intronic
1136299105 16:29321276-29321298 CCCTTCACACAGACAGCCTCGGG + Intergenic
1141426273 16:83946599-83946621 CCTTTCCCACCCTCCTCCTATGG + Intronic
1143879993 17:10022726-10022748 GGCTTCACACAGTCCGTCTACGG + Intronic
1144305366 17:13965371-13965393 CCTTTCACTCAGCCGGCCTCTGG + Intergenic
1144305707 17:13967503-13967525 CTTTTCAGTCAGTCCGCCTCTGG + Intergenic
1145961034 17:28886663-28886685 CCCTGCACACAGACTGCCTAGGG - Intronic
1153188223 18:2508976-2508998 TCTTTAACACAGTCCACTTAAGG + Intergenic
1155032472 18:21996657-21996679 CCTTTCACCCAGGCGGCCTTTGG + Intergenic
1155058377 18:22205562-22205584 CCTTGCATACAGTCTGCCCATGG - Intergenic
1160952600 19:1674799-1674821 CCTTTCTCACCGTCAGCCCAGGG - Intergenic
931623146 2:64231107-64231129 AATTTCACAGAGTCCCCCTAAGG + Intergenic
932272003 2:70419109-70419131 CTCTTCACACAGGCCCCCTAAGG - Intergenic
933612583 2:84452796-84452818 CCTTACACACAGTAGGTCTATGG + Intronic
937487508 2:122330808-122330830 CCATTCAGACAGTCCTCCCAGGG - Intergenic
947374200 2:229479275-229479297 CCTTTCACACAGTCCGCCTAAGG + Intronic
1171072287 20:22084463-22084485 TCTTTAACAAAGTGCGCCTATGG - Intergenic
1173449765 20:43152630-43152652 CCTTTCACACATTCTTCCTCTGG + Intronic
1175197395 20:57253818-57253840 CCCTTCACCCAGTCCTCCCAGGG + Intronic
1176065635 20:63193029-63193051 CCTTTCTCACGGGCCTCCTATGG + Intergenic
951689526 3:25381245-25381267 CCTTTCAGAGAGTCCTCCTTGGG - Intronic
961017106 3:123476843-123476865 CCTTTCACACAGCCAGGCCATGG + Intergenic
969665835 4:8557147-8557169 CCTTTCACACAGTTTTGCTATGG + Intergenic
981838186 4:149079927-149079949 CCTTTCACAAAGCCCGCTTCTGG + Intergenic
985529959 5:428349-428371 CCCTTCACACCGTCTGTCTATGG + Intronic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571155 5:646085-646107 CCATCCACACAGGCCGCCAATGG - Intronic
994090887 5:95808634-95808656 TCTTTAACACAGTCTGCCCAGGG - Intronic
1012863990 6:104595919-104595941 CCTTTCACTCTTTCCCCCTATGG + Intergenic
1013084855 6:106847501-106847523 CCTTTCACACAGTTCTCCACAGG + Intergenic
1030374169 7:108736234-108736256 CCTTTCACACATTCATTCTAAGG - Intergenic
1044107198 8:88224079-88224101 CCTTCCTCACAGTCCGCCAGAGG - Intronic
1049733124 8:144189345-144189367 CCTTTCACACAGCCCTGCTGAGG - Intronic
1059450849 9:114370642-114370664 CCTTTCACAGAATCCCCCAAGGG - Intronic
1061051996 9:128202352-128202374 CCTTTCACACAGACAGACCATGG - Intronic
1061851514 9:133418614-133418636 CCTCTCACACAGACCCCCTTAGG - Intronic
1062459067 9:136655310-136655332 ACCTTCACACAGTCACCCTAGGG + Intergenic
1203454257 Un_GL000219v1:150088-150110 CTTTTCTAACAGTCCGCCAAAGG - Intergenic
1189256336 X:39642555-39642577 CCTTTCACACCGTTCGCTTCTGG - Intergenic