ID: 947374200

View in Genome Browser
Species Human (GRCh38)
Location 2:229479275-229479297
Sequence CCTTTCACACAGTCCGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947374195_947374200 -9 Left 947374195 2:229479261-229479283 CCCTGTGTCCAAGCCCTTTCACA 0: 1
1: 1
2: 6
3: 18
4: 255
Right 947374200 2:229479275-229479297 CCTTTCACACAGTCCGCCTAAGG 0: 1
1: 0
2: 0
3: 0
4: 56
947374196_947374200 -10 Left 947374196 2:229479262-229479284 CCTGTGTCCAAGCCCTTTCACAC 0: 1
1: 0
2: 6
3: 17
4: 180
Right 947374200 2:229479275-229479297 CCTTTCACACAGTCCGCCTAAGG 0: 1
1: 0
2: 0
3: 0
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947374200 Original CRISPR CCTTTCACACAGTCCGCCTA AGG Intronic