ID: 947374682

View in Genome Browser
Species Human (GRCh38)
Location 2:229483694-229483716
Sequence CAGTGTGACCACAGGGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947374682 Original CRISPR CAGTGTGACCACAGGGTCCA GGG (reversed) Intronic
900379859 1:2378390-2378412 GACTGTGACCCCTGGGTCCAAGG + Intronic
900411850 1:2516115-2516137 CAGTGTGACTGCAGGGGTCACGG - Intronic
901650794 1:10742054-10742076 CTTTGCAACCACAGGGTCCACGG + Intronic
902280644 1:15371781-15371803 CAGGCTGAAGACAGGGTCCAAGG + Intronic
903341229 1:22655774-22655796 CAGAGTGGCCACAGGGACCCAGG - Intronic
903535151 1:24061878-24061900 CAGTGTGCCCAGACTGTCCATGG + Intronic
904285275 1:29449878-29449900 CATTGTGGCCTCAGGGTCCCTGG + Intergenic
904330957 1:29757549-29757571 CTGCGTGACCAGAGGCTCCAGGG + Intergenic
904452049 1:30619624-30619646 CACTGTGTTCCCAGGGTCCAAGG + Intergenic
905271096 1:36787937-36787959 CAGTGTGACCATAGCCTCCCAGG + Intergenic
905282241 1:36856603-36856625 CTGTGGGACCACAGGTACCACGG + Intronic
910490242 1:87761325-87761347 CACTGTGAACACACTGTCCAGGG - Intergenic
912528729 1:110304693-110304715 CAGTGTGGCCACAGGGGCCATGG - Intergenic
913594959 1:120366455-120366477 CAGTGTGACTACAGGGACAGAGG - Intergenic
914092309 1:144512531-144512553 CAGTGTGACTACAGGGACAGAGG + Intergenic
914306222 1:146421339-146421361 CAGTGTGACTACAGGGACAGAGG - Intergenic
914595828 1:149151469-149151491 CAGTGTGACTACAGGGACAGAGG + Intergenic
915044696 1:153002337-153002359 CAGTGTGAACAGAGGCTCCCAGG + Intronic
915510708 1:156385550-156385572 GAGGGTGCCCACAGGGCCCAAGG + Intergenic
918455466 1:184707735-184707757 CAGTGGAACCTCAGGGTCCCAGG + Intronic
921803172 1:219425147-219425169 CACTGTGTTCACAGGGTGCAAGG + Intergenic
923942711 1:238845114-238845136 CAGCGTGATCAGAGGCTCCATGG - Intergenic
1063754668 10:8994210-8994232 ATGTGTGACCACAGGCTCGAAGG + Intergenic
1066056713 10:31688273-31688295 CACTGACTCCACAGGGTCCAGGG - Intergenic
1066362502 10:34744972-34744994 CTGGGAGACCACAGGGTCCAAGG - Intronic
1068923819 10:62513939-62513961 CAGTCTGACTCCAGGTTCCATGG - Intronic
1069911325 10:71761624-71761646 CACTCGGAGCACAGGGTCCATGG - Exonic
1069955187 10:72045966-72045988 GAGTGTGAGGACAGGGTGCAGGG + Intergenic
1070962157 10:80506897-80506919 CAGTTTGACCACAGGCCACAGGG + Intronic
1073024790 10:100480037-100480059 ACCTGTGACCAGAGGGTCCAGGG - Intronic
1075479490 10:122767850-122767872 CAGTCTGACTCCAGAGTCCAGGG + Intergenic
1076702304 10:132280207-132280229 CAGCGTGATCACAGAGTGCAGGG - Intronic
1076702422 10:132280832-132280854 CAGTGTGATCACGGAGTGCAGGG - Intronic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1078365974 11:10706732-10706754 GTGTGTGAGCACAGGGTGCAGGG - Intergenic
1079279372 11:19073656-19073678 CAGGGTGGCGACAGGGACCAGGG + Intergenic
1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG + Intergenic
1081595047 11:44453262-44453284 CAGACTGTCCACAGGCTCCAGGG + Intergenic
1083202879 11:61131049-61131071 CAATGTGACCACAATCTCCAGGG + Exonic
1083647294 11:64179615-64179637 CAGTGGCAGCACAGGCTCCAAGG + Intergenic
1083672642 11:64307536-64307558 CAGTGTACCCAGAGGGTGCAGGG - Intronic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1084578213 11:70004522-70004544 CAGTGGGAACACAGGGTTCCAGG + Intergenic
1084630616 11:70346185-70346207 CAGTGTGACCAGGGGGTGCCTGG + Intronic
1084844256 11:71887105-71887127 CATTGTGACCAGAGGCTCAATGG - Intronic
1085333066 11:75668772-75668794 CGGTGTGGCCGCAGGGTCCGCGG + Exonic
1087365283 11:97211028-97211050 TAGTGTGATCACAGGATACAAGG - Intergenic
1087439336 11:98162375-98162397 CAGTGTGACCAAATGTTACAAGG - Intergenic
1091534387 12:1391706-1391728 CAGTGGGACCACATGGTCTTTGG + Intronic
1094607500 12:31961333-31961355 CAGTGTGGTTACAGGGACCATGG - Intronic
1095981889 12:47978731-47978753 CAGGGGGACCAGGGGGTCCAGGG + Exonic
1098470903 12:70842600-70842622 CAATGTGACCACAGAGGCAAAGG - Intronic
1100038985 12:90289079-90289101 GAGTGTGAACACTGGGTACAAGG + Intergenic
1102180955 12:110911767-110911789 TGAAGTGACCACAGGGTCCAGGG + Intronic
1102474725 12:113181098-113181120 CAGTGGGACCACAGGGGGCAGGG + Intronic
1104064706 12:125297185-125297207 CAGTGAGACAACAGGGTGGATGG + Intronic
1104796958 12:131526725-131526747 CAGTGTGACCAGGGGGTTCTGGG + Intergenic
1105750663 13:23419930-23419952 CAGAGTGACATCAGGTTCCATGG - Intronic
1105947522 13:25202468-25202490 CACTGTCACCACAGGCACCAAGG + Intergenic
1108884519 13:55164100-55164122 GAGTTTGACCACAGCGTGCAAGG - Intergenic
1109424198 13:62150450-62150472 TATTCTGAACACAGGGTCCAGGG + Intergenic
1109603052 13:64657989-64658011 CTGTGTGACCTCAGGATTCATGG + Intergenic
1110090260 13:71436030-71436052 CAGTCAGACCCCAGGGACCAGGG - Intergenic
1110825498 13:79967141-79967163 TTATGTGACCAGAGGGTCCATGG - Intergenic
1112175430 13:97018771-97018793 CAGGGTGAGCACAGGGCCCAGGG - Intergenic
1112569827 13:100583951-100583973 CAGGGTGACCAGAAAGTCCATGG + Exonic
1114049960 14:18914359-18914381 CAGTGGGCACACATGGTCCAGGG + Intergenic
1114112597 14:19487571-19487593 CAGTGGGCACACATGGTCCAGGG - Intergenic
1115480241 14:33853423-33853445 CTGTGTGCCCACAGGGGCTACGG + Intergenic
1116377976 14:44228055-44228077 CAGTGTGTCCAAAGGAGCCATGG - Intergenic
1117908398 14:60613490-60613512 CTGTGGGCCCAGAGGGTCCAGGG + Intergenic
1119853016 14:77879470-77879492 CAGTGTGTGCAAAGGGCCCATGG + Intronic
1120835541 14:89035617-89035639 GTGTGTGACCCCAGAGTCCAAGG + Intergenic
1121690392 14:95874163-95874185 CTGTGTGGCCACAGGGATCATGG + Intergenic
1122027102 14:98886047-98886069 CAGGGTGACCACAGGCTGCAGGG + Intergenic
1124122078 15:26896003-26896025 ATGTGCGACCACAGGGTGCAGGG - Intronic
1125483704 15:40097982-40098004 CAGTGGGCCCACTGGGTCCAAGG - Intronic
1126557125 15:50001422-50001444 CAGTCTGACACCAGAGTCCATGG - Intronic
1129169115 15:73797154-73797176 CTGTGCGACCACAGGGTCTGTGG + Intergenic
1129301776 15:74629661-74629683 CAGTGTGACGGCAGGGTCGTGGG - Intronic
1131828518 15:96339482-96339504 GAGCATGACCACAGGGTCAAGGG + Exonic
1131956327 15:97740127-97740149 CAGTGTGACCAGAGCAGCCATGG + Intergenic
1132023671 15:98386224-98386246 AAGTGAGACCTCAGGGTCGAGGG + Intergenic
1132515019 16:362208-362230 CAGTGGGAACCCAAGGTCCAGGG - Intergenic
1136533458 16:30885184-30885206 CAGTGTCATCACAGGGTCCTTGG + Intronic
1137608704 16:49804561-49804583 CAGCCTGACCACAGGCTACAAGG + Intronic
1138205571 16:55121913-55121935 CAGTGAGACAACACGGTCTAGGG + Intergenic
1139358545 16:66382128-66382150 CGGTGTGGCCCCAGGGTTCAGGG + Intronic
1139509926 16:67421637-67421659 CAGTGTGATCCCAGGGTTCCGGG + Intergenic
1141590821 16:85067429-85067451 TGGTGTGGCCACAGGGCCCAAGG + Intronic
1143544507 17:7588478-7588500 CAGAGTGACCCTAGGCTCCAGGG - Exonic
1144786557 17:17835525-17835547 CAGGGTGGCCACGGGTTCCATGG + Intronic
1146458886 17:33028206-33028228 CAGGGTGGCCACAGGGCCCTGGG - Intronic
1148224001 17:45885525-45885547 CAGTGAGTCCACTGGGTCCACGG - Intergenic
1149031609 17:52089305-52089327 AAGTGTCACCACAGGGACCAAGG + Intronic
1150474573 17:65465185-65465207 CAGTGTCACCTCATGGTCTAAGG - Intergenic
1152430069 17:80243965-80243987 CAAGGTGACCACAGGCTGCAGGG - Intronic
1152897846 17:82923530-82923552 CAGGGTGACCACGGTGTCCCTGG + Intronic
1155166294 18:23235103-23235125 CACTGTGACCACAGAGCCCCAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157584694 18:48793599-48793621 CTGGGTGGCCACAGGCTCCAGGG + Intronic
1158009659 18:52714193-52714215 CTATCTGACCACAGGGTCCATGG + Intronic
1160430118 18:78805149-78805171 CAGTGTGATGACAATGTCCAAGG + Intergenic
1160523673 18:79523051-79523073 CAGTCTGTTCACAGGGACCACGG - Intronic
1161248319 19:3267310-3267332 AAGTGTGACAGCAGTGTCCATGG + Intronic
1161395267 19:4042168-4042190 CAGTGTGCCCTGAGGGTCCACGG + Intergenic
1162395852 19:10417772-10417794 CAGAGGGACCCCAGGGTCCGAGG - Intronic
1163308209 19:16495951-16495973 CAGAGTCGCCACGGGGTCCACGG - Intronic
1163399980 19:17086263-17086285 CAGTGTGGCCGGTGGGTCCAAGG - Intronic
1164442736 19:28291635-28291657 GAATGTGACCTCAGGGTCCTTGG - Intergenic
1164478272 19:28591882-28591904 AAGTGTGACCACAGGGCTCTTGG - Intergenic
1165061378 19:33206833-33206855 CAGGGTGACCTGAGGGCCCATGG + Intronic
1166044973 19:40224656-40224678 AAGGGTGACCACGGGGTCCTGGG + Intronic
1166512219 19:43416542-43416564 CAGTGAGACCACAGGTACCCTGG + Exonic
925384608 2:3453387-3453409 CAGAGTGACCACAGGGGCCGAGG - Intronic
926962090 2:18368555-18368577 AAGTAGGACCATAGGGTCCAAGG + Intergenic
928127147 2:28624869-28624891 CAATGTGGCTCCAGGGTCCAGGG + Intronic
933787486 2:85855063-85855085 CAGTGTGAGGTCAGGGTCCAAGG - Intronic
934577036 2:95409258-95409280 CAGGATGACCACAGGATCCCTGG - Intronic
935017567 2:99198575-99198597 AAGTGTGACCACAGGAGGCAGGG + Intronic
935292532 2:101622308-101622330 CAGTGTGGCTCCAGAGTCCATGG + Intergenic
935861342 2:107333488-107333510 CACTGTGACTCCAGGGTCCAAGG - Intergenic
937103992 2:119293663-119293685 CACTGCTACCACTGGGTCCAAGG - Intergenic
937545559 2:123014333-123014355 CAGTGAAACCATTGGGTCCAAGG - Intergenic
937915886 2:127098519-127098541 CACTGTGGCCCCAGGCTCCAAGG + Intronic
941133426 2:161683099-161683121 GAGTGTGAATACAGGGTGCATGG + Intronic
941749290 2:169118494-169118516 CTTTGTGACCACAGCCTCCATGG - Intergenic
945192669 2:207206244-207206266 TAGTGCCACCACAGGGCCCAGGG + Intergenic
947374682 2:229483694-229483716 CAGTGTGACCACAGGGTCCAGGG - Intronic
947655033 2:231819687-231819709 CAGTGTGACTCCAGCATCCAGGG - Intergenic
947881850 2:233522640-233522662 AAATGTGACCACAGGATTCATGG + Intronic
948501272 2:238396804-238396826 CAGGGAGGCCACAGAGTCCAGGG - Intronic
948813942 2:240500138-240500160 CAGGGTCACCACAGGGTCCCGGG + Intronic
1168827834 20:825865-825887 CAGAGAGACCACAGGAACCATGG + Intergenic
1169476133 20:5932803-5932825 CATTGTGATGGCAGGGTCCAAGG + Intergenic
1170600185 20:17835892-17835914 CAGTGTGACCAAACGTCCCACGG - Intergenic
1170852509 20:20017601-20017623 CCCTGGGGCCACAGGGTCCAGGG + Intronic
1171208506 20:23299461-23299483 CTGCTTGACCACAGGGCCCATGG + Intergenic
1172094760 20:32455196-32455218 CACTGTGGCCACAGGGTACATGG - Intronic
1172944787 20:38678789-38678811 CTGTGTGACCACAGGATACAGGG + Intergenic
1173588665 20:44206388-44206410 TAGTTTGGCCAAAGGGTCCAAGG + Intronic
1173705989 20:45110634-45110656 CAGTGTGTCCCCAGGGTCTCTGG - Exonic
1174191337 20:48742802-48742824 CGCTGTGTCCTCAGGGTCCAGGG + Intronic
1174545413 20:51321545-51321567 CAGTCTGACCACAGACACCACGG - Intergenic
1175089400 20:56489474-56489496 CAGTGTGACTACTGAGTCCCAGG - Intronic
1175746314 20:61459665-61459687 CAGGGTGAAGACAGGGTCCCTGG - Intronic
1175905625 20:62378055-62378077 CACTGTGGCCCCAGGGCCCAGGG + Intergenic
1176124119 20:63467594-63467616 GAGTGTGCACACAGGGGCCATGG + Intronic
1176690170 21:9897520-9897542 CAGTGTAAAGACAGGGCCCAAGG - Intergenic
1178764781 21:35440029-35440051 CAGTGTAACCAAAGCCTCCAAGG - Intronic
1179413764 21:41181677-41181699 CAGGGGGACAGCAGGGTCCAGGG + Intronic
1180137266 21:45869726-45869748 GAGTGTGACCCCAGGGCCCCAGG + Intronic
1180468442 22:15636735-15636757 CAGTGGGCACACATGGTCCAGGG + Intergenic
1184859704 22:47166195-47166217 CAGTGTGCACAGAGGGTCCAGGG + Intronic
950147678 3:10663560-10663582 CAGAGTGACCACACGCTCCCAGG + Intronic
950334061 3:12179897-12179919 CAGAGTGACGACAGGCTCAAAGG - Intronic
950646379 3:14379498-14379520 CAGTGTGTACACTGTGTCCAAGG - Intergenic
951670136 3:25172111-25172133 CAGTGAGACCATATGGTCCCAGG - Intergenic
952268590 3:31810782-31810804 CAGTGAGTCCACAGGGTGTAAGG + Intronic
954135012 3:48578461-48578483 CAGGGGGACCAGAGGGGCCAGGG + Exonic
955774116 3:62415378-62415400 GAGTGTGAACTCAGGGTTCATGG - Intronic
957169916 3:76724901-76724923 CAGTGTGACCACAGAGGCAGAGG + Intronic
957938276 3:86971382-86971404 CTGTGTGACCACAGGATGAATGG - Intronic
960807614 3:121599171-121599193 AAATGTGAACACAGGGGCCAGGG + Intronic
962092999 3:132264887-132264909 AAGTGTGGTCACAGGCTCCAAGG - Intronic
962638523 3:137357758-137357780 CAGTGAAACCATAGGGTCCTGGG + Intergenic
962938204 3:140101035-140101057 CAGTGTGACCCCAGTGTACCAGG - Intronic
966087012 3:176080286-176080308 CAGTGTGACCATTAGGACCAGGG + Intergenic
968565801 4:1312097-1312119 CAGGCTGACCACGGAGTCCACGG - Exonic
968748172 4:2371925-2371947 CCGTGTGTCCCCAGGATCCAGGG + Intronic
968931428 4:3581555-3581577 CAACATGACCACAGGGGCCATGG - Intronic
969297696 4:6279476-6279498 CATAGTGAGCACAGGCTCCACGG - Intronic
970705166 4:18792735-18792757 CAGAGTCACCAAATGGTCCAAGG - Intergenic
971118880 4:23681537-23681559 CAGTGTGTCCAGTGGGTCCAAGG - Intergenic
971487908 4:27179758-27179780 CTGTGTGACCCCAAAGTCCAGGG - Intergenic
973162241 4:47032581-47032603 GAGTGGGACCTCAGGGGCCAGGG - Intronic
977772972 4:100881389-100881411 CAGTGTGTCCACAGGATCCATGG + Intergenic
978400277 4:108323678-108323700 CAGTGGCTCCACTGGGTCCACGG + Intergenic
980957569 4:139444716-139444738 CAGTGTGTCCAGTGGGTCCCTGG + Intergenic
985268331 4:188171044-188171066 CTGTGTAACCACAAGCTCCATGG - Intergenic
986261749 5:6153442-6153464 CAGTGGGTCCAGAGGGTCCCTGG - Intergenic
986566382 5:9119103-9119125 CAGGGAGACCACGAGGTCCAGGG + Exonic
989326151 5:40197788-40197810 CAGAGTGCCCAGAGGGCCCAGGG - Intergenic
990454833 5:55975058-55975080 CACTGTGACCTCGAGGTCCAGGG + Intronic
990973016 5:61530109-61530131 GAGAGTGCCCACAGGGTCCAGGG - Exonic
991300135 5:65121789-65121811 CAGTGGGTCCACTGGGGCCATGG + Intergenic
992048844 5:72925549-72925571 CTGGGTGGGCACAGGGTCCACGG + Intergenic
992097069 5:73372852-73372874 CATTATGTCCACAGGGTCCTGGG + Intergenic
994984575 5:106916935-106916957 CAGTGTGTCTACTGGGTCCCTGG - Intergenic
995611439 5:113914223-113914245 CTGTGTGACCACAGTCTCAATGG - Intergenic
995661138 5:114484579-114484601 CAGTGAGAAGACAGGGTCAAAGG - Intronic
996092317 5:119363177-119363199 CAGGCTGACCACAGCCTCCACGG - Intronic
997353822 5:133249517-133249539 CAGTGTGACCACAGTGACCGTGG - Exonic
997368426 5:133340395-133340417 CAGGGAGTCCACAGGATCCAGGG + Intronic
997670706 5:135669528-135669550 CAGTGTGACAACATAGACCACGG + Intergenic
998134442 5:139667378-139667400 CTCTCTGACCACGGGGTCCATGG + Intronic
998547613 5:143044396-143044418 CTCAGTGACCACAGGCTCCAAGG - Intronic
999719783 5:154391106-154391128 CAGTCTTTCCACAGGGTCCTGGG - Intronic
1002936073 6:1673706-1673728 CAGTGTTTGCCCAGGGTCCAGGG - Intronic
1003289715 6:4769664-4769686 CAGTGTGCCCACGGGGTGCTGGG + Intronic
1003435165 6:6081482-6081504 CACAGTGGCCACAGTGTCCAGGG - Intergenic
1007655856 6:43450655-43450677 CAGGGTAGCAACAGGGTCCAGGG + Exonic
1009345601 6:62610150-62610172 CAGTGTGAACAATGGCTCCAGGG - Intergenic
1010033157 6:71290004-71290026 CAATGTGACCACAGGGTTTTGGG + Intronic
1011208675 6:84930350-84930372 CAGTGTGTCAAAAGGGTGCACGG + Intergenic
1012214951 6:96571794-96571816 CAGTGTCAACTCAGGTTCCAAGG + Intronic
1012344429 6:98169111-98169133 CAGTGGGTCCACTGGGTCCCCGG + Intergenic
1015588382 6:134799499-134799521 AAGGGTGAACACAGGGTCCAGGG + Intergenic
1016182304 6:141162223-141162245 CAGTGAGCCCCCAGGGGCCAAGG - Intergenic
1017914795 6:158823274-158823296 CAGTGTGGAGACAGGCTCCAAGG - Intergenic
1019073897 6:169371383-169371405 CAGAGTGGCCACAGGGTTCCAGG - Intergenic
1019354857 7:573134-573156 CAGTGTGACCCCGGGGTGCAGGG - Intronic
1020668533 7:11076173-11076195 CAGTCTGGCTACAGAGTCCATGG + Intronic
1021495885 7:21274263-21274285 CTTTGTGAGCACAGGGACCACGG - Intergenic
1023766261 7:43513910-43513932 TTGAGTGACCACAGTGTCCATGG - Intronic
1024981142 7:55158722-55158744 CAGGGTGGCCACACGTTCCAGGG + Intronic
1025159032 7:56636910-56636932 CAGTGTTACCACAAAGGCCAGGG - Intergenic
1026742477 7:72987766-72987788 CAGCAAGACCCCAGGGTCCAGGG + Intergenic
1027101258 7:75377312-75377334 CAGCAAGACCCCAGGGTCCAGGG - Intergenic
1027143520 7:75677791-75677813 CAGTGTGTGCAAAGGCTCCAAGG - Intronic
1027237010 7:76304022-76304044 CAGTGTGCCCTCAGGGGACAGGG - Exonic
1028216565 7:88140365-88140387 CTATGTGACCTAAGGGTCCACGG + Intronic
1031676397 7:124617116-124617138 CAGTGGGTCCAGAGGGTCCCTGG + Intergenic
1033311282 7:140263922-140263944 CAGTGTGTTCAGAGGGTCCCTGG - Intergenic
1034272141 7:149808501-149808523 CAGAGACTCCACAGGGTCCAGGG - Intergenic
1036093202 8:5692073-5692095 CAGTGTGAGCACAGCCTGCACGG + Intergenic
1036643434 8:10598060-10598082 CACTGTGACCCCTGGGTGCATGG + Intergenic
1037679657 8:21086233-21086255 CAGTGTTACCACTGCTTCCACGG - Intergenic
1037898452 8:22673763-22673785 CAGTAGGACCACTGAGTCCAAGG + Intergenic
1039766527 8:40634019-40634041 TCATGTGACCTCAGGGTCCAGGG - Intronic
1039956917 8:42214878-42214900 CAGGGTGACCCCAGAGTCCCAGG + Intergenic
1042032721 8:64494196-64494218 CAGTGAGGCCATAGGGTCCCAGG - Intergenic
1045970372 8:108073209-108073231 CAAGATGACCACAGTGTCCATGG + Intronic
1049497254 8:142942036-142942058 CAGTGTGCACACAGGCTTCAAGG + Intergenic
1051047547 9:12893075-12893097 CAGTGAAACCACTGGGTCCCAGG - Intergenic
1051707514 9:19895997-19896019 CAGTGTGACGGCAGGGTCGTGGG + Intergenic
1053379363 9:37636227-37636249 GAGTGTGACCAGGGGATCCAGGG - Intronic
1053626897 9:39882065-39882087 CAGTGTAAAGACAGGGCCCAAGG - Intergenic
1053779093 9:41583955-41583977 CAGTGTAAAGACAGGGCCCAAGG + Intergenic
1054167052 9:61794196-61794218 CAGTGTAAAGACAGGGCCCAAGG + Intergenic
1054216989 9:62368638-62368660 CAGTGTAAAGACAGGGCCCAAGG + Intergenic
1054458701 9:65450374-65450396 CAACATGACCACAGGGGCCATGG + Intergenic
1054670494 9:67786702-67786724 CAGTGTAAAGACAGGGCCCAAGG - Intergenic
1055054117 9:72008010-72008032 CAGTGTGCCCTCAGGGGACAGGG + Intergenic
1056658665 9:88529062-88529084 CAGGCTGAGCACGGGGTCCAAGG + Intergenic
1057197789 9:93124687-93124709 CACTGTGACCACAGGACCCCAGG + Intronic
1057237363 9:93372672-93372694 TTGTGTGGCCACAGGGTGCATGG - Intergenic
1058566558 9:106291664-106291686 CAATGTGGCCACAGGGTTGATGG + Intergenic
1059391429 9:114001937-114001959 CTCTGTGACCACAAGGTCCCAGG - Intronic
1060937436 9:127523838-127523860 CACTGTCTCCACAGGGACCACGG - Exonic
1061157888 9:128876003-128876025 CAGTGTCACCACAGGCTTCTGGG - Intronic
1061944488 9:133901218-133901240 CATTGTGACCACTGGGCCCCCGG - Intronic
1062164620 9:135101299-135101321 AAGTGTGACTGCAGGTTCCATGG + Intronic
1062309608 9:135928843-135928865 GAGTGTGGCCACACGGCCCAGGG + Intergenic
1186373366 X:8969618-8969640 CAGTCTGACTACAGAGTCCATGG - Intergenic
1187670157 X:21658612-21658634 CAGTGTCACCAGAGGGTCCCAGG + Intergenic
1187921099 X:24202668-24202690 CAGTGTGAGGACAGAGTCCTGGG - Intronic
1189613886 X:42765068-42765090 CAGTGAGTCCACAGAGCCCAGGG + Intergenic
1190330779 X:49234034-49234056 CAGTGTGCCCTCAGGGGACAGGG + Intergenic
1191576080 X:62707692-62707714 GAGTGAGAACACTGGGTCCAGGG + Intergenic
1191987875 X:67001550-67001572 CAGGCTGGCCACAGGCTCCAAGG + Intergenic
1192105730 X:68314569-68314591 CAGTGAAACCACCTGGTCCAGGG - Intronic
1196456264 X:115893501-115893523 CAGCTTGACCACAAGGTCAAAGG + Intergenic
1197890177 X:131262411-131262433 CATTGGTACCACATGGTCCAGGG + Intergenic
1200080992 X:153576271-153576293 CAATGTGACCCCAGGGCCCCAGG + Intronic
1200779115 Y:7198381-7198403 CATTGTGACCATAGGCTCCCAGG - Intergenic