ID: 947374994

View in Genome Browser
Species Human (GRCh38)
Location 2:229486807-229486829
Sequence AGGGCTGATGCTGCTGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 622
Summary {0: 1, 1: 1, 2: 10, 3: 84, 4: 526}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947374994 Original CRISPR AGGGCTGATGCTGCTGATCT GGG (reversed) Intronic
900770011 1:4533362-4533384 AGGGCAGATGCTTCTAATGTTGG + Intergenic
900884211 1:5403936-5403958 AGGGCTGCTGCTGCTGGTGCTGG - Intergenic
901039686 1:6356425-6356447 GGGGCTGAGGGTGCTGAGCTGGG - Intronic
901192277 1:7419799-7419821 ATGGATGATGCTGATGATTTTGG - Intronic
901245299 1:7725685-7725707 AGTTCTGATGCTTCTGGTCTAGG - Intronic
902211365 1:14907029-14907051 GTTGCTGATGCTGCTGGTCTTGG - Intronic
902876843 1:19345521-19345543 AGGGCTGCTGCTGTGGCTCTGGG - Intronic
902896464 1:19483884-19483906 AGGGATGTTGCTGCTGAACGAGG - Intronic
902931811 1:19736674-19736696 AGGGCTGCTGCTCCTGGCCTTGG - Intronic
903457080 1:23495029-23495051 AATTCTGATGCTGCTGGTCTGGG + Intergenic
904053578 1:27655843-27655865 AGGGCTGAAGCTGGGGAGCTGGG + Intergenic
904974069 1:34442579-34442601 GATGCTGATGCTGCTGGTCTGGG + Intergenic
905556408 1:38888687-38888709 GAAGCTGATGCTGCTGGTCTTGG - Intronic
905588479 1:39141377-39141399 GATGCTGATGCTGCTGGTCTGGG + Intronic
905832969 1:41089080-41089102 AGTGCTGATGCTGCTGGTCTGGG + Intronic
907002854 1:50879693-50879715 GATGCTGATGCTGCTGGTCTAGG - Intronic
907296850 1:53460946-53460968 AGGCCTGAAACTGCAGATCTAGG + Intronic
907634898 1:56124596-56124618 AAGGCTGATGCTGCTGGTCCAGG - Intergenic
907952582 1:59197843-59197865 AAAGCTGATGCTGCTGGTCCAGG + Intergenic
908900350 1:68949479-68949501 AATGTTGATGCTGCTGATCTGGG + Intergenic
909068138 1:70961057-70961079 AATGCTGATGCTGCTGATCTGGG + Intronic
909344373 1:74568966-74568988 TGTGCTGATGCTTCTGATCAAGG + Exonic
910189861 1:84584346-84584368 AATGCTGATGCAGCTAATCTAGG + Intergenic
911213752 1:95169254-95169276 CATGCTGATGCTGCTTATCTGGG + Intronic
911341957 1:96650318-96650340 AGGCCTGCTGCTGCTGTACTGGG - Intergenic
912528796 1:110305121-110305143 AGAGCTGATTCAGCTGATGTGGG + Intergenic
913312283 1:117512473-117512495 GATGCTGATGCTGCTGGTCTGGG + Intronic
913360942 1:117979264-117979286 GGTGCTGATGTTGCTGATATAGG - Intronic
914046508 1:144097894-144097916 GGTGATAATGCTGCTGATCTGGG + Intergenic
914131602 1:144862792-144862814 GGTGATAATGCTGCTGATCTGGG - Intergenic
915487494 1:156232000-156232022 TAGGCTGATGGTGCTGGTCTGGG - Intronic
916888373 1:169092499-169092521 CATGCTGATGCTGCTGGTCTGGG + Intergenic
919639816 1:200036741-200036763 AGGGCTTAGGCTTCTGAGCTAGG + Intronic
919801023 1:201354757-201354779 GGGGAAAATGCTGCTGATCTGGG - Intergenic
919821999 1:201479309-201479331 GGTGCTGATGTTGCTGATCCTGG - Intergenic
919851922 1:201678813-201678835 AGAGCTGATGCTGTTGAGTTTGG - Intronic
920187042 1:204166242-204166264 GGGACTGCTGCTGCTGCTCTGGG - Exonic
920695331 1:208177738-208177760 GGGGCAGATGCTGCTGCTCTGGG - Intronic
920854384 1:209651395-209651417 TGGGTTGAGGCTGCTGGTCTAGG - Intronic
920942993 1:210501514-210501536 GAAGCTGCTGCTGCTGATCTTGG + Intronic
921118099 1:212113524-212113546 GGTGCTGATGCTGCTGGTCTAGG + Intergenic
921132690 1:212233178-212233200 GATGCTGCTGCTGCTGATCTGGG + Intergenic
921505589 1:215965121-215965143 GTGGCTGTTGCTGCTGCTCTGGG + Intronic
921978255 1:221226729-221226751 AAAGCTGAGGCTGCTGCTCTTGG + Intergenic
922205772 1:223444645-223444667 ATGGCTGGTTCTGCTGACCTGGG - Intergenic
922391976 1:225153335-225153357 GTTACTGATGCTGCTGATCTGGG + Intronic
923763534 1:236870546-236870568 AGGGCTGGTGCTGCTGGTACAGG + Intronic
923898449 1:238299504-238299526 AATGTTGATGCTGCTAATCTGGG - Intergenic
1063352964 10:5373570-5373592 CGGGCTGATGCTGCTGGTCTGGG + Intronic
1063547326 10:6993892-6993914 TGGGATGATGGTGCTTATCTGGG - Intergenic
1063683431 10:8212387-8212409 ATAGCTGATGTTGCTGCTCTGGG - Intergenic
1065445763 10:25796687-25796709 AGCCCTGAAGTTGCTGATCTTGG + Intergenic
1068095605 10:52487440-52487462 GAAGCTGATGCTGCTGGTCTAGG + Intergenic
1068393829 10:56435244-56435266 AGGGCTGAGGGTGATGATGTAGG - Intergenic
1069191651 10:65498555-65498577 GATGCTGATGCTGCTAATCTAGG + Intergenic
1069287887 10:66739347-66739369 GATGCTGATGCTGCTGCTCTGGG + Intronic
1069742490 10:70693894-70693916 AGCGCTGATGGTGCTGGTATGGG + Intronic
1069879678 10:71583954-71583976 GATGCTGATGCTGCTGCTCTGGG - Intronic
1069879695 10:71584057-71584079 AACACTGATGCTGCTGGTCTGGG + Intronic
1070512137 10:77171125-77171147 GATGCTGCTGCTGCTGATCTGGG - Intronic
1070512595 10:77175160-77175182 AACGCTGATGCTGCTGATCCAGG + Intronic
1070804366 10:79262222-79262244 GCTGCTGATGCTGCTGACCTGGG - Intronic
1071328023 10:84535738-84535760 AAGGCTGATGCTGCTGAAGCTGG + Intergenic
1071603015 10:86968198-86968220 AGGGCTGGGGCTGATGAGCTGGG + Exonic
1072096025 10:92180792-92180814 AATGCTGATGCTGCTGGTCCAGG + Intronic
1072219882 10:93318076-93318098 AGGGCTGATGGTGGGGATCAGGG - Intronic
1072479320 10:95795297-95795319 CAGGATGATGCTGCTGTTCTTGG + Intronic
1073112786 10:101072455-101072477 AGGGCTGAGGCAGCGGTTCTGGG + Intergenic
1073739948 10:106394879-106394901 AGGGCTGGTGCTGCTGGTCTGGG + Intergenic
1074278631 10:112029087-112029109 AAGGGTGATGATGCTGCTCTGGG + Intergenic
1074703451 10:116111720-116111742 AGTGCTGCTGCTGCTGGTCTGGG - Intronic
1075226788 10:120636806-120636828 GATGCTGATGCTGCTGATCTAGG + Intergenic
1075463205 10:122632302-122632324 AGGCCTGAAGCTGCTGCTATGGG - Intronic
1075779021 10:125005129-125005151 AGGGCTGGTGCAGGTGCTCTGGG - Intronic
1075930703 10:126293012-126293034 GATGCTGATGCTGCTGGTCTGGG + Intronic
1075985087 10:126778292-126778314 AGGTTTCAGGCTGCTGATCTGGG + Intergenic
1076046333 10:127297044-127297066 GTGGCTGATGCTGATGAACTGGG - Intronic
1076558386 10:131345085-131345107 TGGCCTGATGCAGCTGAGCTGGG + Intergenic
1077886437 11:6390975-6390997 GGGGCTGATGCTGGTGCGCTGGG + Intronic
1079152869 11:17916884-17916906 AATGCTGATGCTACTGATTTAGG - Intronic
1079437593 11:20473757-20473779 TGGGCTGAGGCTGCAGAACTGGG - Intronic
1079743969 11:24101560-24101582 ACAGCTCAGGCTGCTGATCTGGG - Intergenic
1080300806 11:30783216-30783238 GGAGGTGATACTGCTGATCTGGG - Intergenic
1080743693 11:35088586-35088608 CTGGGTGATTCTGCTGATCTTGG - Intergenic
1080923260 11:36730336-36730358 AAGGCTGATGCTGCTAGTCTGGG - Intergenic
1081007894 11:37771188-37771210 ACTGCTGCTGCTGCTGATGTTGG - Intergenic
1083934355 11:65862607-65862629 AGAGCTGATGCTGTTGAGATTGG + Intronic
1083968766 11:66059493-66059515 AGGGCTGATTGTTCTGTTCTAGG + Exonic
1084456998 11:69273682-69273704 AGGGCTGAAGCCACTGCTCTGGG + Intergenic
1084688783 11:70712741-70712763 AGGGCTGTTGGTGCAGAGCTGGG - Intronic
1085176142 11:74489939-74489961 AGGGCTACTGCTGCTGTTGTAGG - Intergenic
1085192398 11:74639121-74639143 AATGCTGATGCTGCTGGTCTGGG - Intronic
1085911308 11:80829913-80829935 AGGACTGATGCTGTTGGTCTGGG + Intergenic
1086279092 11:85164917-85164939 GGTGCTGATGCTGCTGGTCTGGG - Intronic
1086279183 11:85166010-85166032 GGCGCTGATGCTGCTGGTCTGGG - Intronic
1086343051 11:85866936-85866958 AGAGCAGATGCTGGTGATTTAGG + Intronic
1086808190 11:91269882-91269904 AGGACTGAAGCTGCAGACCTTGG - Intergenic
1087828925 11:102798053-102798075 ACTGCTGCTGCTGCTGTTCTGGG - Exonic
1087837759 11:102891867-102891889 AAGGCTGATGCTGCTGGTCTGGG - Intergenic
1087866241 11:103229947-103229969 GATGCTGATGCTGCTGGTCTAGG - Intronic
1088182287 11:107126558-107126580 AGTGATGCTGATGCTGATCTGGG - Intergenic
1088574039 11:111252412-111252434 AATGCTGATGCTGCTGGTCCAGG + Intergenic
1088753112 11:112862501-112862523 GGAGCTGATGCTACTGCTCTAGG - Intergenic
1089082325 11:115787303-115787325 AGGACTGACACTGCTGTTCTTGG + Intergenic
1090095599 11:123739801-123739823 GGTACTGATGCTGCAGATCTGGG - Intronic
1090256758 11:125289906-125289928 AGGGCTGGTGCTGCTGCTGCGGG - Intronic
1090331156 11:125933201-125933223 GCTGCTGCTGCTGCTGATCTGGG - Intergenic
1090561760 11:127940069-127940091 ATTGCTGATACTGCTGGTCTGGG + Intergenic
1091031368 11:132191187-132191209 AGTGCTGTTGCTGGTGGTCTGGG + Intronic
1091044289 11:132312116-132312138 AGGGATGCTGCAGCTGAGCTGGG - Intronic
1091337157 11:134780817-134780839 ATTGCTGAGGCTGCTGATCCAGG - Intergenic
1091610029 12:1999069-1999091 GACGCTGATGCCGCTGATCTGGG - Intronic
1091920064 12:4296929-4296951 GGGGTTGAAGCTGCTGTTCTGGG + Intronic
1091972264 12:4797297-4797319 AGGGGTGATGCTGCTGCGATGGG - Intronic
1092771084 12:11897357-11897379 AGTGCTGATGGTGCTGGTCCAGG + Intergenic
1094487634 12:30937697-30937719 GAGGCTGATGCTGTTGGTCTGGG - Intronic
1098440384 12:70511513-70511535 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1100207395 12:92365401-92365423 AAGGCTGATTCTGCTGGTCCTGG + Intergenic
1102962378 12:117100903-117100925 GGGGCTGATTCTGATGCTCTAGG - Intergenic
1102977625 12:117217930-117217952 GGTGCTGATGCTGCTGTTTTGGG + Intronic
1103359809 12:120346850-120346872 ATGGCTGATGCTGCTGCACTAGG - Intronic
1106976991 13:35230810-35230832 GGTGTTGATGCTGCTGATCCAGG - Intronic
1107095495 13:36530824-36530846 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1107487051 13:40838348-40838370 AGGTCTGCTGCTGCAGAGCTGGG - Intergenic
1107991452 13:45822119-45822141 AGGGATGATGCTGGGGAGCTTGG - Intronic
1108379665 13:49843963-49843985 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1109269714 13:60241337-60241359 ATGGGTGATTCTGCTGATCTGGG + Intergenic
1110278975 13:73670667-73670689 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1110416266 13:75256542-75256564 AATGCTGATGCTGCTGGTCCAGG - Intergenic
1111934942 13:94548960-94548982 GGTGCTGATGCTGCGGATCTGGG + Intergenic
1112172529 13:96989314-96989336 AGGACTGATTCTGCTAATTTAGG - Intronic
1112372177 13:98803555-98803577 GGTGCTGATGCTGCTGGTCCTGG + Intronic
1113544445 13:111137279-111137301 AGTGCTGGTGCTGCTGGTCCTGG + Intronic
1114172488 14:20287295-20287317 GATGCTGATGCTGCTGGTCTGGG + Exonic
1114452579 14:22836900-22836922 GGGGCTGAAGCTGCTGCTTTGGG - Exonic
1114666613 14:24381115-24381137 AGGGCAGATGCTCCTGTACTGGG - Intergenic
1114832739 14:26164461-26164483 GTAGCTGAAGCTGCTGATCTGGG + Intergenic
1115550717 14:34502765-34502787 GGTGCTGATTCTGCTGGTCTGGG + Intergenic
1116051366 14:39807461-39807483 ATTGCTGATGCTGCTGATTTGGG + Intergenic
1117021030 14:51570596-51570618 GGTGTTGATGCTGCTGGTCTGGG - Intronic
1117285774 14:54284610-54284632 ACAGATGATTCTGCTGATCTCGG - Intergenic
1118621520 14:67618708-67618730 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1119943655 14:78668540-78668562 AGGGAAGATGCTGCTGGTGTGGG + Intronic
1121080061 14:91100662-91100684 GAGGCTGGTGCTGCTGGTCTGGG - Intronic
1121274038 14:92655935-92655957 AGGGCTGAGTCTGCAGTTCTGGG + Intronic
1122127919 14:99589148-99589170 AGGGCTCACTCTGTTGATCTGGG - Intronic
1123050361 14:105538436-105538458 AGAGCTGATGCAGGTGATGTGGG - Intergenic
1124146748 15:27134715-27134737 AGGGCTTCTGCTGCTCATGTTGG + Intronic
1124430457 15:29603286-29603308 GCTGCTGATGCTGCTGTTCTGGG - Intergenic
1124531181 15:30508476-30508498 AGTGATGATGATGATGATCTGGG + Intergenic
1124767474 15:32499220-32499242 AGTGATGATGATGATGATCTGGG - Intergenic
1125289849 15:38133957-38133979 GATGCTGATGCTGCTGATCCAGG + Intergenic
1125511109 15:40292878-40292900 CAGGCTCCTGCTGCTGATCTTGG + Intronic
1125960377 15:43825125-43825147 AGGGCAGGTGGTGCTGATTTAGG + Intergenic
1126857184 15:52849991-52850013 AGGGTTGATACTTCTAATCTGGG - Intergenic
1127377554 15:58398871-58398893 AACGCTGATGCTGCTGGTCTAGG - Intronic
1127638675 15:60894731-60894753 GGAGCTGATGCTGCTGGCCTGGG + Intronic
1127833107 15:62768126-62768148 GCTGCTGAAGCTGCTGATCTGGG - Intronic
1128522941 15:68387392-68387414 GGTGCTGGTGCTGCTGGTCTGGG - Intronic
1129274034 15:74433804-74433826 GCGGCTGCTGCTGCTGCTCTGGG - Exonic
1129760352 15:78125589-78125611 GAGGCTGATGCTGCTGGTCCAGG - Intronic
1129869171 15:78929768-78929790 TGGGCTGATGCTGTTGACCATGG - Intronic
1130358177 15:83154452-83154474 GAGGCTTATCCTGCTGATCTGGG - Intronic
1130795106 15:87199510-87199532 AATGCTGATGCTGCTGGTCCTGG + Intergenic
1131439949 15:92452199-92452221 GATGCTGATGCTGCTGGTCTGGG - Intronic
1131514747 15:93069756-93069778 AAGGCTAATGCTGCTGGTCCAGG + Intronic
1131643726 15:94319543-94319565 AAGGCTGATGCTGCTGGCCCAGG + Intronic
1132319293 15:100913766-100913788 GAGGCTGATGCTGCTGGTCTGGG + Intronic
1133011170 16:2912438-2912460 GGGGCTGATGCTGCGGGTCCAGG - Intronic
1133401658 16:5492021-5492043 AACGCTGATACTGCTGGTCTGGG - Intergenic
1133726834 16:8545671-8545693 GAGGCTGATGCTGCTGATCTGGG + Intergenic
1134084445 16:11346721-11346743 GATGCTGATGCTGCTGGTCTGGG + Intronic
1134460400 16:14424992-14425014 AAGGCTGATGCTGCTCCACTGGG + Intergenic
1134502725 16:14781730-14781752 ATGGCAGATGCTGCTGGCCTGGG - Intronic
1134567706 16:15265615-15265637 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1134577838 16:15347165-15347187 ATGGCAGATGCTGCTGGCCTGGG + Intergenic
1134724750 16:16410381-16410403 ATGGCAGATGCTGCTGGCCTGGG - Intergenic
1134734731 16:16490738-16490760 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1134932742 16:18221168-18221190 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1134942682 16:18301478-18301500 ATGGCAGATGCTGCTGGCCTGGG + Intergenic
1135183603 16:20295879-20295901 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1135983698 16:27168306-27168328 AGGGTTGATGATGCTGATAGCGG + Intergenic
1137036782 16:35575042-35575064 CGTGCTGATGCTGCTGATAGTGG + Intergenic
1138292552 16:55860358-55860380 GATGCTGATGCTGCTGGTCTAGG - Intronic
1138556921 16:57776188-57776210 CAGGCTGAAGCTGCTGAGCTGGG + Intronic
1139477141 16:67208428-67208450 AGGCCTGATGCTCCAGCTCTGGG + Exonic
1140725744 16:77810253-77810275 AATGCTGATGCTGCTGATCTGGG - Intronic
1140951298 16:79820403-79820425 GGTGTTGATGCTGCTGGTCTAGG + Intergenic
1141978955 16:87537688-87537710 AGGGCTGATCCAGTTAATCTGGG - Intergenic
1141987503 16:87589401-87589423 GGTGCTGATGCTGCTGGTCTGGG - Intergenic
1141991273 16:87611789-87611811 GATGCTGAGGCTGCTGATCTGGG + Intronic
1143323310 17:6081842-6081864 GGAGCTGATGCTGCTGGTCAGGG - Intronic
1143877111 17:10000273-10000295 AACGCTGATGCTGCTGGTCTGGG + Intronic
1144273633 17:13643893-13643915 GAGGCTGATGCTGCTGGTCCAGG - Intergenic
1144366203 17:14547267-14547289 GGTACTGATGCTGCTGGTCTAGG + Intergenic
1144386601 17:14753955-14753977 ACTGCCAATGCTGCTGATCTGGG - Intergenic
1144394103 17:14826843-14826865 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1144479603 17:15617993-15618015 AGTGCTGATGTTGCTGGACTGGG - Intronic
1144677744 17:17172764-17172786 CGAGTTGACGCTGCTGATCTGGG - Exonic
1144918700 17:18745746-18745768 AGTGCTGATGTTGCTGGTCTGGG + Intronic
1145391889 17:22461592-22461614 TGGGCTGTGGCTGCAGATCTCGG - Intergenic
1146072151 17:29692793-29692815 ACTGCTGATGCTGCTGATCCAGG - Intronic
1146456830 17:33015217-33015239 AGGGCTGGAGGTGCTGATTTGGG + Intronic
1147624605 17:41892022-41892044 TGGGCAGAGGCTGCTTATCTGGG - Intronic
1147879378 17:43644045-43644067 AATGCTGATGCTGCTGATCTGGG - Intronic
1148188245 17:45660184-45660206 GGTGCTGATGCTGCTGGTCTGGG + Intergenic
1148452033 17:47785026-47785048 AAGGCTGATGCTGATGAAATGGG - Intergenic
1148477236 17:47936848-47936870 AGGGCTGATGATACTGGTTTAGG - Intergenic
1148536755 17:48445467-48445489 GGAGCAGATGCTGCTGATGTGGG - Intergenic
1149462089 17:56837061-56837083 GATGCTGATGCTGCTGGTCTAGG - Intronic
1150621227 17:66809097-66809119 TGGGCTGATGCAGCAGATCCAGG + Exonic
1151807045 17:76412245-76412267 AGGACTGAAGCTGTTGACCTAGG + Intronic
1152191456 17:78890715-78890737 AGATCTGCTGCTGCTGGTCTCGG + Exonic
1152251715 17:79215994-79216016 AGGGCTGGAGCTGATGGTCTTGG + Intronic
1152933783 17:83124352-83124374 AGAGCTTATGCTGCTGGGCTGGG + Intergenic
1154006310 18:10530510-10530532 AGTGCTGATGGTGCTGGTCCAGG + Intronic
1156455343 18:37290115-37290137 AGTGATGATGGTGCTGAGCTGGG + Intronic
1156734381 18:40235539-40235561 AGGGCTGATGCTGCTTGTTCAGG + Intergenic
1156942162 18:42781331-42781353 AGGGATTATGCTGCTGATTTAGG - Intronic
1157059544 18:44271763-44271785 GAGGCTGATGCTGCTGACCCAGG + Intergenic
1157120021 18:44900639-44900661 GATGCTGATGCTGCTGGTCTGGG - Intronic
1157617578 18:48996308-48996330 AAGGCTGAGGCTGCTGGTCTAGG + Intergenic
1157940332 18:51921646-51921668 GTGGCTCAGGCTGCTGATCTAGG - Intergenic
1158613093 18:58961230-58961252 GATGCTGATGCTGCTCATCTTGG + Intronic
1158688509 18:59638420-59638442 GGTGCTGATGCTGCTGGTCCAGG - Intronic
1160625840 18:80204397-80204419 AGAGCTGATGCTATTGATCTGGG + Intronic
1161488382 19:4548124-4548146 AGGGCAGCGGCTGCTGAGCTTGG - Exonic
1162030004 19:7913249-7913271 TGGGCTGGGGCTGCTGCTCTGGG + Exonic
1162193454 19:8965263-8965285 AGAGTTGTTGCTGCTGATCTGGG + Exonic
1162316477 19:9941780-9941802 TTTGCTGATGCTGCTGAGCTTGG - Intergenic
1162584328 19:11549826-11549848 AGGGAGGCTGCTGCTGCTCTTGG + Exonic
1162786023 19:13035405-13035427 TGTGCTGGGGCTGCTGATCTGGG + Intronic
1164247430 19:23444559-23444581 GGGGCTGATGGTGATGACCTGGG - Intergenic
1164389668 19:27806623-27806645 ACGGCTGATGCTCCTGCTCCAGG - Intergenic
1164721473 19:30434882-30434904 AGTGATGATGCTGCTGATGATGG + Intronic
1165989728 19:39803335-39803357 CAAGCTGATGCTGCTGGTCTGGG - Intergenic
1166267857 19:41696097-41696119 AGGGCTGATGGCGCTGTCCTGGG - Intronic
1166283364 19:41809517-41809539 AGGGCTGGTGATGCTGAAATGGG - Intronic
1166352682 19:42207500-42207522 AGGGCTGAGGCTGCTGAGGGAGG - Intronic
1167332342 19:48864030-48864052 GACGCTGATGCTGCTGGTCTGGG + Intronic
1167499425 19:49836845-49836867 AGGTCAGATGCTGCTGAGCGGGG + Exonic
1167793961 19:51697115-51697137 AATGCTGATGCTGCTGCTCCGGG + Intergenic
1168163960 19:54533888-54533910 AGGGCTGATGGTGATGTTGTTGG - Exonic
1168422172 19:56211594-56211616 GGTGCTGATGCTGCTGGTCTTGG + Intergenic
1168423385 19:56219789-56219811 GGTGCTCATGCTGCTGGTCTTGG - Exonic
1168427412 19:56249888-56249910 GATGCTGATGCTGCTGGTCTTGG + Intronic
926289660 2:11518497-11518519 AGGGCTGCTGCTGCTGCAGTGGG + Intergenic
926709802 2:15869901-15869923 GGGGCTGGTGCTGCTGAACACGG - Intergenic
926953546 2:18270292-18270314 AAGGCTGATGTTGCTGATCCTGG + Intronic
927193942 2:20535030-20535052 AGGGCTGAGTCTGCTGATTGTGG + Intergenic
928198213 2:29229839-29229861 AGGGCTTCTGCTCCTGACCTTGG - Intronic
928230060 2:29490443-29490465 GATGCTGATGCCGCTGATCTAGG - Intronic
928904941 2:36357681-36357703 TGGGCTGATGATGCTGTTCCGGG + Intronic
928961468 2:36930597-36930619 GGTGATAATGCTGCTGATCTGGG + Intronic
929125413 2:38519052-38519074 CATGCTGATGCTGCTGGTCTAGG - Intergenic
929235415 2:39600351-39600373 AGGGCTGACACTGCCCATCTGGG + Intergenic
929337281 2:40764294-40764316 ATGGCTGAAGTTGCTGATTTTGG + Intergenic
930102538 2:47614491-47614513 AGGGCTGATGGTCCTCAACTTGG - Intergenic
930802881 2:55460933-55460955 AATGCTGAGGCTGCTGATCTGGG - Intergenic
931313414 2:61104069-61104091 AGGACTGACGTTGCTGATTTGGG - Intronic
932132341 2:69199281-69199303 GATGCTGATGCTGCTGGTCTGGG + Intronic
932338762 2:70946402-70946424 AGTGCTAATGCTGTTGATCTAGG - Intronic
932817861 2:74876175-74876197 AGCCCTGATGCTGCTGTACTCGG + Intronic
933565836 2:83949544-83949566 AATGCTGATGCTGCTGATTTGGG - Intergenic
934245659 2:90303507-90303529 GGTGATAATGCTGCTGATCTGGG - Intergenic
934263087 2:91493529-91493551 GGTGATAATGCTGCTGATCTGGG + Intergenic
934578924 2:95422721-95422743 AATGCTGATGCTGCTAGTCTGGG + Intergenic
934600523 2:95653982-95654004 AATGCTGATGCTGCTAGTCTGGG - Intergenic
934609125 2:95721722-95721744 GGGGCTCATGCTGCTGACCCAGG - Intergenic
934628273 2:95884004-95884026 GACGCTGATGCTGCTGGTCTTGG - Intronic
934628520 2:95887755-95887777 GACGCTGATGCTGCTGGTCTTGG - Intronic
934631092 2:95923325-95923347 GACGCTGATGCTGCTGGTCTTGG - Intronic
934802953 2:97185658-97185680 GATGCTGATGCTGCTGGTCTTGG + Intronic
934805007 2:97213762-97213784 GACGCTGATGCTGCTGGTCTTGG + Intronic
934832229 2:97539863-97539885 GACGCTGATGCTGCTGGTCTTGG - Intronic
934832476 2:97543620-97543642 GACGCTGATGCTGCTGGTCTTGG - Intronic
934833246 2:97554889-97554911 GATGCTGATGCTGCTGGTCTTGG - Intronic
935155756 2:100482321-100482343 AAGGGTGATGAAGCTGATCTTGG - Intronic
935232171 2:101108609-101108631 TGGCCTGATGTTGCTGGTCTTGG - Intronic
935611676 2:105032174-105032196 AATGCTGATGCTCCTGCTCTGGG + Intergenic
935623442 2:105148289-105148311 GGTGCTGCTGCTGCTGGTCTGGG - Intergenic
936174411 2:110206884-110206906 GGTGGTGATGATGCTGATCTAGG - Intergenic
936576986 2:113665486-113665508 AGAGCTGGTGCTGCTGAAGTTGG - Intergenic
937915581 2:127097276-127097298 AGGGCTGACGCTGCTGGGCCTGG - Intronic
937915606 2:127097368-127097390 AGGGCTGACGCTGCTGGGCCTGG - Intronic
937915619 2:127097414-127097436 AGGGCTGACGCTGCTGGGCCTGG - Intronic
937968582 2:127533348-127533370 AGGGCTGACGCTGCTGCTCCTGG - Intergenic
938254975 2:129850574-129850596 ATGGCTGATGCTGCTGTGCTAGG - Intergenic
938580170 2:132638515-132638537 GGCGCTGATGCTGCTGTTCCAGG + Intronic
938904065 2:135822437-135822459 AATGTTGATGCTGCTGGTCTGGG + Intronic
940514470 2:154663791-154663813 TATGCTGATGCTGCTGGTCTGGG - Intergenic
940635412 2:156292780-156292802 AGGGCTGATGCAGCTTGTATAGG + Intergenic
940970538 2:159892060-159892082 AGTGCTGATAATGCTGGTCTGGG - Intronic
942231169 2:173862012-173862034 GGTGCTGATGCTGCTGAACTGGG - Intergenic
942577056 2:177374804-177374826 AATGCTGATGTTGCTGGTCTGGG + Intronic
942831687 2:180244027-180244049 AATGTTCATGCTGCTGATCTGGG + Intergenic
942959160 2:181809169-181809191 GAGGCTGATGCTTCTGGTCTAGG + Intergenic
945041386 2:205746199-205746221 AGGGCTGTGGCTGTTGATTTAGG + Intronic
945145552 2:206734452-206734474 GATGCTGATGCTACTGATCTGGG - Intergenic
945802537 2:214451074-214451096 AATACTGATGCTGCTGGTCTGGG - Intronic
946398904 2:219458345-219458367 GATGCTGATGCTGCTGGTCTGGG - Intronic
946456465 2:219830631-219830653 GGTGCTGATGCTGCTGCTCAGGG - Intergenic
946736006 2:222755231-222755253 GATGCTGATGCTGCTGCTCTAGG - Intergenic
946792013 2:223310372-223310394 CTGGCTGATGGTGCTGAACTGGG + Intergenic
947328825 2:229006790-229006812 GGTGATGCTGCTGCTGATCTAGG + Intronic
947369717 2:229432642-229432664 GGTGTTGATGCTGCTGGTCTGGG - Intronic
947374994 2:229486807-229486829 AGGGCTGATGCTGCTGATCTGGG - Intronic
947740313 2:232481855-232481877 GGGCCTGATGCTGCTGCTGTGGG - Intronic
947940065 2:234045888-234045910 GGTGCTGAAGCTGCTGGTCTGGG + Intergenic
948029886 2:234808723-234808745 GGTGCTGCTGCTGCTGATCTGGG + Intergenic
948137787 2:235649705-235649727 TGTGCTGATGCTGCTTGTCTGGG + Intronic
948873177 2:240813706-240813728 AGGGCTGCTGCTGCTCACCCCGG - Intronic
1169604937 20:7306704-7306726 GAGGCTGAGGCTGCTGGTCTGGG + Intergenic
1169619607 20:7490988-7491010 GATGCTGATGCTACTGATCTGGG - Intergenic
1169950935 20:11042435-11042457 GATGCTGATGCTGCTGATCTTGG + Intergenic
1169962378 20:11175837-11175859 AGGGCTTATACTGCTGATTTGGG - Intergenic
1170091676 20:12596082-12596104 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1171047225 20:21821554-21821576 AATGCTGATGCTGCTGGTTTTGG - Intergenic
1171047383 20:21823074-21823096 AATGCTGATGCTGCTGATTTAGG + Intergenic
1171178262 20:23071416-23071438 AGGGCTGCTGCAGCTGCTTTCGG - Intergenic
1172013299 20:31858842-31858864 AAGTCTGATTCTGCAGATCTGGG - Intronic
1172445166 20:34989619-34989641 ATGGCTGAAGCTGGGGATCTGGG + Intronic
1172850367 20:37958094-37958116 AATGCTGATGCTGCTGGTGTTGG + Intergenic
1173158616 20:40636060-40636082 AATGCTGATGCTGCTGGTCTGGG + Intergenic
1173458720 20:43224690-43224712 TGGGCTGCTGCTGTGGATCTAGG - Intergenic
1175308160 20:57992204-57992226 GGTGCTGATACTGCTGACCTGGG - Intergenic
1175750258 20:61491737-61491759 AGTGTTGATGTTGCTGATGTTGG + Intronic
1176155730 20:63619417-63619439 AGGACTGACGCTGCTGGCCTGGG - Exonic
1177703727 21:24673691-24673713 AGGTCTGGTTCTGATGATCTTGG + Intergenic
1178342088 21:31794249-31794271 AGGGGTGAGGCTGCTGCTCATGG + Intergenic
1178523893 21:33308731-33308753 GGTGCTGATGCTGCTGGTCTAGG - Intergenic
1179089949 21:38255754-38255776 AGTGCAGCTGCTGCTGTTCTGGG - Intronic
1179336700 21:40463494-40463516 AGAGCCTATGCTGCTGATATTGG - Intronic
1179571291 21:42280361-42280383 AGGGCTGAGGCTGCTTTGCTGGG - Intronic
1179613040 21:42564763-42564785 CGGCCTGATGCTGCTGCTCGCGG + Exonic
1179713298 21:43275146-43275168 AGGGGTGATGCTGGAGCTCTGGG + Intergenic
1179904197 21:44413762-44413784 AGGCCTGATGCTGCTCATTTGGG - Intronic
1180199314 21:46215180-46215202 CGGGCCGATGCTGATGCTCTTGG + Exonic
1181386767 22:22551397-22551419 AGGGCTGACCCTGCTCATTTTGG + Intronic
1181507147 22:23367072-23367094 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1181856786 22:25787407-25787429 AATGCTGATGCTGCTGGTCCAGG + Intronic
1181868136 22:25875557-25875579 GATGCTGATGCTGCTGGTCTGGG - Intronic
1182050116 22:27306213-27306235 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1182678099 22:32055901-32055923 CTTGCTGATGCTGCTGGTCTGGG - Intronic
1182774394 22:32820112-32820134 AGGGCTGACTCTGCTGAGCCAGG - Intronic
1182946689 22:34330872-34330894 CTGGCTGATGCTGCTGGTCTAGG - Intergenic
1183381437 22:37492369-37492391 AGAGCGGGTGCTGCTGTTCTGGG - Intronic
1183667610 22:39254513-39254535 ACAGCTGGTGCTGCTGACCTGGG + Intergenic
1184012311 22:41758404-41758426 AGGGCTCCTGCTGCTTATCTGGG - Exonic
1184895526 22:47404404-47404426 AGGGCTGAGGCAGCAGAGCTGGG - Intergenic
1184923649 22:47623065-47623087 GGGACTGATGCTGCTGGCCTGGG + Intergenic
1185423256 22:50747188-50747210 AGAGCTGGTGCTGCTGAAGTTGG + Intergenic
949328338 3:2892311-2892333 AATGCTGATGCTGCTTGTCTGGG + Intronic
949744273 3:7270116-7270138 GATGCTGATGCTGCTGATCTGGG + Intronic
949830001 3:8204116-8204138 AATGCTGATGCTGCTGGTCCAGG + Intergenic
950831838 3:15882432-15882454 AATGGTGATGCTGCTGATCCAGG - Intergenic
950837391 3:15933849-15933871 GATGCTGATGCTGCTGATCAGGG - Intergenic
950899420 3:16483814-16483836 AATGCTGATGCTGCTGGTCTGGG - Intronic
951040279 3:17982020-17982042 GATGCTGATGCTGCTGGTCTAGG + Intronic
951049868 3:18082296-18082318 GATGCTGATGCTGCTGGTCTAGG - Intronic
951066920 3:18277339-18277361 GAGGCTGATGCTGCTGGTCCAGG + Intronic
951133730 3:19078506-19078528 GATGCTGTTGCTGCTGATCTGGG + Intergenic
951148083 3:19253353-19253375 AGGGATGATGCTTTTGATCATGG - Intronic
951626997 3:24676479-24676501 TGGGCTGATGCTGATGCTCATGG + Intergenic
951844618 3:27072270-27072292 GGTGCTGATGCTGCTTGTCTGGG - Intergenic
952079708 3:29743445-29743467 AGCACTGAAGCTGCTGATCTGGG - Intronic
952123096 3:30267772-30267794 GATGCTGATGCTGCTGGTCTAGG + Intergenic
952470473 3:33644840-33644862 AAGGCTGATGCAGCTGATGATGG + Exonic
952576554 3:34781134-34781156 GATGCTGATGCTGCTGGTCTTGG + Intergenic
953137129 3:40190698-40190720 GGTGCTGATGCTGCTGGTCTGGG - Intronic
953308485 3:41853243-41853265 AATGCTCATGCTGCTGGTCTAGG + Intronic
953467172 3:43132411-43132433 GATACTGATGCTGCTGATCTGGG + Intergenic
953626787 3:44578635-44578657 CGAGTTGACGCTGCTGATCTGGG + Intronic
953781243 3:45872645-45872667 AATACTGATGCTGCTGGTCTGGG + Intronic
953847858 3:46443178-46443200 AGGCCTACTGCTGTTGATCTTGG + Intronic
954279905 3:49569951-49569973 AGGTCTGGGGCTGCTGCTCTGGG + Intronic
954642944 3:52112908-52112930 GATGCTGATGCTGCTGATCCAGG - Intronic
955661825 3:61307659-61307681 AATGCTGATGCTGCTGGTCTGGG - Intergenic
956525029 3:70149428-70149450 GAAGCTGATGCTGCTGGTCTAGG - Intergenic
956542303 3:70354615-70354637 AGGGCTTCAGCTGCTGAGCTGGG + Intergenic
957000895 3:74883418-74883440 AGGGCTGTTGCTGTTATTCTTGG + Intergenic
957031702 3:75249835-75249857 AATGCTGATGCTGTTGGTCTGGG - Intergenic
957337984 3:78857562-78857584 GATGCTGATGCTGCTGGTCTGGG - Intronic
957516413 3:81258609-81258631 AAGGCTGATTCTGATGATTTAGG + Intergenic
957564585 3:81867264-81867286 AAGACTGATGCTGTTGATCTTGG - Intergenic
957914576 3:86671680-86671702 AATGCCGATGCTGCTGATCCAGG + Intergenic
959622068 3:108409383-108409405 GAGGCCGGTGCTGCTGATCTGGG - Intronic
961093570 3:124136378-124136400 GATGCTGATGCTGCTGGTCTGGG + Intronic
961468597 3:127097145-127097167 AGGGCTGGTCCTGCTGCTCCAGG - Intergenic
962469773 3:135695915-135695937 AATGCTGATGCTGCTGGTCTGGG - Intergenic
962741415 3:138364943-138364965 AGGGCAGAGGCAGCTGATCCAGG - Intronic
963103529 3:141626277-141626299 AATGCTGATGCTGCTAGTCTTGG - Intergenic
965145268 3:164893388-164893410 AAGGATGAGGCTGCTGATGTCGG + Intergenic
965403431 3:168241208-168241230 AATGCTGATGCTGCTGGTTTGGG + Intergenic
965641007 3:170829019-170829041 AATGCTGATGCTGCTGGTCCAGG - Intronic
965733525 3:171797395-171797417 AATGCTGATGCTGCTGGTTTGGG - Intronic
965908613 3:173742305-173742327 AGGGCTGATGTCGCTGTACTAGG + Intronic
966755561 3:183368136-183368158 GATGCTGATGCTGCTGGTCTGGG - Intronic
966825873 3:183964559-183964581 GATGCTGATGCTGCTGATCTGGG + Intronic
967035161 3:185643524-185643546 ATAGCTGATGCTGCTGGTCTGGG + Intergenic
967738550 3:192980313-192980335 GATGCTGATGCTGCTGATCCAGG + Intergenic
968019017 3:195367270-195367292 GGTGCTGATGCTGCTGGTCCAGG + Intronic
968522408 4:1039929-1039951 AGGGTTGGTGCTGCAGTTCTGGG + Intergenic
968547944 4:1208115-1208137 AGGGCTCATGCAGCTGCTCTTGG + Intronic
969110250 4:4839916-4839938 AAGGCTGATGATGCTGGTTTGGG + Intergenic
969156567 4:5216232-5216254 AATGCTGATGCTGCTGGTCTGGG + Intronic
969268219 4:6080067-6080089 CAGGGTGATGCTGCTGAGCTGGG - Intronic
970453060 4:16191122-16191144 GGGGCTCATGCTGCTGGTCTGGG - Intronic
970730085 4:19092215-19092237 AGTGCTGATGCTTCTGGCCTAGG + Intergenic
971464475 4:26940944-26940966 AGTGCTGATACTGCTGGTCCAGG + Intronic
972578296 4:40372320-40372342 TGTGCTGATGCTGCTGGTCCGGG - Intergenic
973201279 4:47505337-47505359 AGTACTGATGCTGCTGGTCCTGG - Intronic
973575866 4:52288728-52288750 AATGCTGATGTTGCTGGTCTGGG + Intergenic
974180659 4:58380126-58380148 GTGGCTTATGCTGCTAATCTAGG + Intergenic
975670368 4:76774032-76774054 AGGGTTTATGCTGTTGATGTAGG + Intronic
976088018 4:81425956-81425978 AATGCTGATGCTGCTGGTCCTGG - Intergenic
976625761 4:87179982-87180004 AAGGCTGATGCTGCTGGTCGAGG + Intronic
977761750 4:100746163-100746185 GCAGCTCATGCTGCTGATCTTGG - Intronic
977905025 4:102467526-102467548 AGGGCAGCTGCTGAAGATCTCGG - Intergenic
979559034 4:122081556-122081578 GATGCTGATGCTGCTGATCTGGG - Intergenic
980791730 4:137629690-137629712 AGTGCTGATGTTGCTGCCCTGGG + Intergenic
981031152 4:140127100-140127122 AGGGCTTATGCTTCTGAGCGTGG + Intronic
981440541 4:144777252-144777274 AAGGCTAATGCTGCTGGCCTGGG - Intergenic
981573789 4:146181904-146181926 ATGTCTGATGCTGTTGATTTGGG + Intronic
981749141 4:148076710-148076732 AGGTCTGATCCTGCTGCTCCTGG - Intergenic
983935729 4:173501433-173501455 AAGGCTGAGGCTGCTGCTCCTGG - Intergenic
984432307 4:179664772-179664794 TGAGCTGCTGCTGCTGCTCTGGG + Intergenic
984802305 4:183726371-183726393 AGTGCTGGTGCTGGTGCTCTGGG - Intergenic
985808773 5:2068209-2068231 AGGGCTGAGGCTCCTGAGATGGG + Intergenic
986771347 5:10976922-10976944 GATGCTGATGCTGCTGGTCTTGG - Intronic
987610310 5:20194748-20194770 AGAGTTGATTCAGCTGATCTGGG + Intronic
990356763 5:54975419-54975441 GGTGCAGATGCTGCTGGTCTAGG - Intergenic
990451532 5:55935539-55935561 AGTCCTGTTGCTGCTGATCGGGG - Exonic
990986571 5:61645858-61645880 AGGGCTGAGGATGCTGCTCCAGG - Intronic
991443032 5:66671234-66671256 AGGGCTGGTGCAGTTGCTCTAGG + Intronic
991480766 5:67076829-67076851 ATGGATGCTGCTGCTCATCTGGG - Intronic
993817755 5:92573428-92573450 GGAGCTGATGCTGTTGATCAGGG + Intergenic
994746288 5:103682436-103682458 AGAGCTGATGCTGCAGTTCAAGG - Intergenic
995053197 5:107730065-107730087 AATGCTGATGCTGCTCATCAGGG + Intergenic
995385996 5:111589621-111589643 GATGCTGATGCTGCTGGTCTGGG - Intergenic
996172020 5:120305164-120305186 GATGCTGATGCTGCTGGTCTGGG + Intergenic
996588546 5:125119319-125119341 GATGCTGATGCTGCTGGTCTCGG - Intergenic
997236402 5:132274631-132274653 AGGGGTGGAGCTGTTGATCTCGG - Intronic
997257790 5:132442596-132442618 GATGCTGATGCTGCTGGTCTGGG + Intronic
998505525 5:142669057-142669079 ATGGCTGATGCCGCTGAGCGGGG + Intronic
998946786 5:147348499-147348521 GATGCTGATGCTGCTGATCTGGG + Intronic
999041765 5:148421295-148421317 GGAGCTGATACTGCTGGTCTGGG + Intronic
999177256 5:149640133-149640155 AGGGCAGAAGCTGCTGGTCTTGG + Intergenic
999395663 5:151225643-151225665 AGTGCTGACACTGCTGATTTGGG - Intronic
999893188 5:156000898-156000920 GTTGCTGATGCTGCTGATCCAGG + Intronic
1001498481 5:172208465-172208487 TGTGCTGCTTCTGCTGATCTGGG - Intergenic
1003180079 6:3783651-3783673 GAGGCTGGTGCTGCTGATCCAGG + Intergenic
1003500255 6:6697240-6697262 GGTGCTGATGCTGCTGGTCTGGG - Intergenic
1003706750 6:8540271-8540293 AGGCCTGCTGCTGCTGATTTAGG + Intergenic
1004685923 6:17943613-17943635 GACTCTGATGCTGCTGATCTGGG + Intronic
1006709066 6:36049581-36049603 GAAACTGATGCTGCTGATCTGGG + Intronic
1007221463 6:40282247-40282269 AGTGCTGCTGCTGCTGCTCCTGG + Intergenic
1007240141 6:40418953-40418975 GATGCTGATGCTGCTGGTCTTGG - Intronic
1008191914 6:48469197-48469219 TGTGATAATGCTGCTGATCTGGG - Intergenic
1008496407 6:52138457-52138479 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1008617887 6:53243698-53243720 GGTGCTGAGGCTGCTGGTCTGGG + Intergenic
1008670296 6:53761427-53761449 GATGCTGATGCTGCTGGTCTTGG + Intergenic
1009923863 6:70096787-70096809 AATGCTGATGCTGCTGGTCTGGG - Intronic
1011264370 6:85499564-85499586 AGGGCTGCTGCAGCTGATTATGG - Intergenic
1011311209 6:85981552-85981574 ATGGCTCAGGCTGCTGAACTAGG + Intergenic
1011825683 6:91302867-91302889 CGGGTTGATGCTGCTGGTTTGGG + Intergenic
1012568095 6:100685441-100685463 GCTGCTGATGCTGCTGATCAGGG - Intronic
1012771812 6:103447334-103447356 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1012988297 6:105898463-105898485 GATGCTGATGCTGCTGATCTGGG + Intergenic
1013115732 6:107102485-107102507 AGGGCTCATGCAGCTGAGGTGGG + Intronic
1013226097 6:108120079-108120101 GAGGCTGCTGCTGCTGATTTCGG - Intronic
1013742697 6:113306555-113306577 GGTGCTGATGCTGCTAATCTGGG + Intergenic
1015214701 6:130736053-130736075 AGGGATGATGCTTCTGCTCCAGG - Intergenic
1015226677 6:130865023-130865045 GAAGCTGATGCTGCTGATCCAGG + Intronic
1015344784 6:132143485-132143507 AGTGCTGCTGCTGCTGTTCTAGG - Intergenic
1016322174 6:142858000-142858022 AGGGATGCTGCAGCTGACCTAGG + Intronic
1016386209 6:143533197-143533219 AGGGCTGATGCTGGACATCTGGG + Intergenic
1016746505 6:147586186-147586208 AGTGCTGCTGCTGCTTCTCTTGG + Intronic
1016804727 6:148201546-148201568 AATGCCGATACTGCTGATCTCGG + Intergenic
1017028759 6:150202659-150202681 AGGGCTGAAGCTGAGGACCTGGG + Intronic
1017275984 6:152569094-152569116 GGTGCTGATGCTGCTGCTCTGGG - Intronic
1017446210 6:154509772-154509794 AGGGCTGGGGATGCCGATCTCGG - Intronic
1017795126 6:157836921-157836943 GATGCTGATGCTGCTGGTCTAGG + Intronic
1018845641 6:167553450-167553472 AGGGTTGATTCTGCTGCTTTGGG - Intergenic
1019280753 7:198828-198850 TGGGCTGATCCTTCTCATCTGGG + Intronic
1019789506 7:3001860-3001882 AGGAGTGAGGCTGCTGTTCTTGG - Intronic
1020086439 7:5313199-5313221 ACTGCTGCTGCTGCTGCTCTCGG + Exonic
1021570152 7:22056925-22056947 GCTGCTGCTGCTGCTGATCTGGG + Intergenic
1022216313 7:28265661-28265683 GATGTTGATGCTGCTGATCTAGG + Intergenic
1022242597 7:28527472-28527494 GATGCTGATGCTGCTGGTCTGGG + Intronic
1022429619 7:30303716-30303738 GATGCTGATGCTGCTGGTCTGGG - Intronic
1022642998 7:32205824-32205846 AGGGGTGAAGCTGCAGACCTTGG - Intronic
1022702229 7:32772199-32772221 AGGGCTGATGCTGGGACTCTGGG - Intergenic
1023325662 7:39052959-39052981 GATGCTGATGCTGCTAATCTGGG - Intronic
1023388584 7:39685327-39685349 GGGTCTGATGCAGCTGAGCTAGG + Intronic
1023576048 7:41628080-41628102 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1025233169 7:57216534-57216556 GGAGCTGGTGCTGCTGTTCTAGG + Intergenic
1026282845 7:68937032-68937054 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1026566230 7:71491782-71491804 GGTGCTGATGCTGCTGGCCTGGG + Intronic
1027168455 7:75852901-75852923 AGGGCTGATGCTCCTTTTATAGG + Intronic
1028144081 7:87302744-87302766 AATGCTGATGCTGCAGGTCTGGG - Intergenic
1028896592 7:96048430-96048452 AATGCTGTTGCTTCTGATCTGGG - Intronic
1029174821 7:98657350-98657372 AGGGCTCATGCTGCAGCTCCAGG - Intergenic
1029332683 7:99872558-99872580 AGTGCTGATGCTGTTGATGTAGG - Intergenic
1030111746 7:106032581-106032603 TGGGCTGAGGATGCTGGTCTGGG + Exonic
1030261678 7:107571615-107571637 AATACTGATGCTGCTGGTCTGGG - Intronic
1030298965 7:107956413-107956435 AATATTGATGCTGCTGATCTAGG + Intronic
1030655047 7:112158181-112158203 TGTGCTGATGCTTCTGGTCTTGG + Intronic
1031977810 7:128104851-128104873 GATGCTGATGCTGCTGTTCTGGG - Intergenic
1032570457 7:132990462-132990484 AGGGCTCAAGCTGCCCATCTTGG - Intronic
1032609438 7:133396060-133396082 GATGCTGATGCTGCTGGTCTGGG - Intronic
1032677134 7:134141389-134141411 GAGGCTGATGCTGCTGGTCCGGG + Intronic
1033157634 7:138970669-138970691 GATGCTGATGCTGCTGATCCGGG + Intronic
1033171079 7:139085070-139085092 AGTGCTGATGGTGCTGGTCCGGG - Intronic
1033257713 7:139816581-139816603 GATGCTGATGCTGCTGGTCTGGG - Intronic
1034330395 7:150277665-150277687 AGGGTTCTTGCTGCTTATCTAGG - Intronic
1034667648 7:152832183-152832205 AGGGTTCTTGCTGCTTATCTAGG + Intronic
1034909479 7:154982682-154982704 GGGGCAGATGCTGCTGATCCAGG + Intronic
1035332319 7:158104444-158104466 AGGGGCCCTGCTGCTGATCTTGG - Intronic
1035933392 8:3809662-3809684 GATGCTGATGCTGCTAATCTGGG + Intronic
1036405316 8:8449798-8449820 AGGGATGAAGCTGTAGATCTGGG + Intergenic
1036568912 8:9962425-9962447 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1036719443 8:11159546-11159568 GAAGCTGATGCTGCTGATGTAGG - Intronic
1037421430 8:18707428-18707450 AGGGCTTATCCTACTTATCTTGG + Intronic
1037662774 8:20941622-20941644 AGAGCTGAGGCTGTTCATCTCGG - Intergenic
1038815714 8:30902002-30902024 TGTGCTGATGCTGCTGATCTAGG - Intergenic
1039844856 8:41318789-41318811 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1040794318 8:51272303-51272325 AGGAGTGAAGCTGCAGATCTTGG - Intergenic
1041186431 8:55305696-55305718 AGGACTGATGCTGGTGATGTTGG + Intronic
1041698841 8:60765637-60765659 GCGGCTGCTGCTGCTGAGCTTGG + Intronic
1042670044 8:71251782-71251804 AGGGTTGATGCTGGTGATTTGGG - Intronic
1043349358 8:79341562-79341584 AGGGCGGAGGCTACTCATCTGGG - Intergenic
1043504460 8:80888566-80888588 AGGGTTGGTGTTGCTGGTCTGGG - Intergenic
1043933532 8:86117730-86117752 AGGGCTGATGTTACTGAGCCTGG + Intronic
1044423324 8:92023871-92023893 AGGACTGATACTGCCTATCTTGG - Intronic
1044603493 8:94028748-94028770 AGGGTTGTTCCTGTTGATCTCGG - Intergenic
1045377792 8:101592527-101592549 AGAGCTGATGTGGCTGGTCTGGG - Intronic
1045466830 8:102477858-102477880 AGGGCTCATGCTACTTAACTTGG - Intergenic
1045642579 8:104268314-104268336 GGTGCTAATGCTGCTGATCTGGG + Intergenic
1045834403 8:106503472-106503494 AGGGCTGTTGTTGATGTTCTGGG + Intronic
1046771397 8:118119980-118120002 AAGGCTGATGCTGCAGATCCAGG + Intergenic
1047343993 8:124009710-124009732 GGAGCTGGTGCTGCTGTTCTAGG + Intronic
1047568057 8:126067952-126067974 AGCTCTGAATCTGCTGATCTTGG + Intergenic
1047570039 8:126087803-126087825 AATGCTGATGCTGCTGGTCTGGG - Intergenic
1047575403 8:126148905-126148927 ATGGCTCAGGCTGCTGATCCTGG - Intergenic
1047890630 8:129304115-129304137 ATGGCTCAGGCTGCTGACCTGGG + Intergenic
1048481691 8:134801893-134801915 ACTGCTGATGCTGCTCCTCTAGG - Intergenic
1048524551 8:135190332-135190354 TGGGCTGAAGCTGCTGTGCTGGG - Intergenic
1049342306 8:142119657-142119679 AGGCCTGATGCAGCAGCTCTGGG - Intergenic
1049737977 8:144220150-144220172 TGAGCTAATGCTGCTGGTCTGGG - Intronic
1049952047 9:654904-654926 GATGGTGATGCTGCTGATCTCGG + Intronic
1049952548 9:659470-659492 AATGCTGATGCTGCTGTTCTGGG + Intronic
1050003006 9:1098572-1098594 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1050054633 9:1639093-1639115 AGAGCTGATGCTGCTGGTCCTGG - Intergenic
1050064358 9:1743304-1743326 AGGGCAGCTGCTGCTGGGCTGGG - Intergenic
1050170748 9:2813743-2813765 ATGGCTGATGATGCTGCTCCAGG + Intronic
1050247265 9:3703731-3703753 GGTGCTGATGCTGCTGGTCCAGG - Intergenic
1050249159 9:3725628-3725650 AATGCTGATTCTGCTTATCTGGG - Intergenic
1050280036 9:4040880-4040902 AGTGCTGATGCTGCTGGACCAGG - Intronic
1050516982 9:6454974-6454996 GATGTTGATGCTGCTGATCTTGG + Intronic
1053025422 9:34724989-34725011 AAGCCTGTTGCTGCTGATCAAGG + Exonic
1053036952 9:34834051-34834073 AGGCCTGTTGCTGCTGATCAAGG + Intergenic
1053043071 9:34891164-34891186 AGCCCTGTTGCTGCTGATCAAGG + Intergenic
1053598906 9:39590659-39590681 GGTGCTCATGCTGCTGGTCTGGG + Intergenic
1053856660 9:42345176-42345198 GGTGCTCATGCTGCTGGTCTGGG + Intergenic
1054798692 9:69325609-69325631 TGGGCTGCTTCAGCTGATCTTGG + Intronic
1054931817 9:70642905-70642927 GAGGCCGCTGCTGCTGATCTGGG + Intronic
1055219633 9:73913095-73913117 AATGCTGATGTTGCTGGTCTGGG - Intergenic
1055257110 9:74384600-74384622 AGTGCTAATGCTTCTGGTCTAGG - Intergenic
1055541165 9:77306848-77306870 AGGTCTTATGCTGTTGATTTGGG + Intronic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056385847 9:86096452-86096474 AATGCTGATGCTGCTAATATGGG - Intronic
1056464490 9:86840258-86840280 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1056493267 9:87129210-87129232 AGGGCTGGTGCTGCTGATCTGGG - Intergenic
1056717001 9:89039965-89039987 AGTGCTGATGGTGCTGATGGTGG - Intronic
1056928635 9:90855852-90855874 GATGCTGATGCTGCTGGTCTGGG + Intronic
1057201417 9:93142368-93142390 GGGGCTGATGCTGCTGGCCCAGG + Intergenic
1058000176 9:99856837-99856859 GATGCTGATGCTGCTGGTCTGGG + Intronic
1058350417 9:104014886-104014908 GATGCTGATGCTGCTGATCCAGG + Intergenic
1058424271 9:104862807-104862829 GATGCTGATGCTGCTGACCTGGG + Intronic
1058867759 9:109177246-109177268 AATGCTGATGCTGCTAGTCTGGG - Intronic
1059522928 9:114960903-114960925 AATGCTGATGCTGCTTATCTAGG + Intergenic
1060941152 9:127543606-127543628 GGGGCTGAGGTTGCGGATCTTGG - Intronic
1061039696 9:128132821-128132843 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1061502241 9:131010548-131010570 AGGGCAGGGGCTCCTGATCTTGG + Intronic
1061909775 9:133716491-133716513 GGGGCTGAGGCTGCTGGCCTGGG - Intronic
1061909797 9:133716548-133716570 GGGGCTGAGGCTGCTGGCCTGGG - Intronic
1185460875 X:332340-332362 AGAGCTCATGCTGCTGCTCCTGG + Intergenic
1186491589 X:9977799-9977821 AGTTCTGAAGCTTCTGATCTTGG - Intergenic
1186563006 X:10632677-10632699 AGGGCCGATGCTGTTGGTTTTGG + Intronic
1186710678 X:12192821-12192843 GATGCTGATGCTGCTGATCCAGG + Intronic
1186974501 X:14886699-14886721 ACTGCTGATGCTGCTGGTCAGGG - Intronic
1187067985 X:15859514-15859536 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1187105647 X:16238790-16238812 GATGCTGATGCTGCTGATCTGGG + Intergenic
1187246291 X:17555506-17555528 GGGGCTGATGCTGCTGGTCTGGG + Intronic
1187345776 X:18462352-18462374 GATGCTGATGCTGCTGGTCTGGG - Intronic
1187629460 X:21152848-21152870 GATGCTGATGCTGCTGCTCTTGG + Intergenic
1187719989 X:22140087-22140109 AATTCTGATGCTGCTGGTCTGGG + Intronic
1187969975 X:24649326-24649348 AGGGCTGCTGCTGCACTTCTTGG - Intronic
1188650106 X:32621823-32621845 TGGGCTGATGCTGTTGGTCCAGG - Intronic
1188984261 X:36755334-36755356 AGGAATGATGCAGCTGAACTAGG - Intergenic
1189171752 X:38916242-38916264 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1189456524 X:41195474-41195496 AATGCTGATGTTGCTGCTCTGGG + Intronic
1190057162 X:47187619-47187641 AGGTAGGATGGTGCTGATCTGGG + Intergenic
1190522993 X:51299027-51299049 GGTGCTGCTGCTGCTGATTTAGG - Intergenic
1190827648 X:54032291-54032313 AATGCTGATCCTGCTGGTCTGGG + Intronic
1191634133 X:63358107-63358129 TGGGCTGATGCTGCAGCTTTAGG - Intergenic
1191839754 X:65503062-65503084 AGGTCTGATACTGGTGTTCTGGG - Exonic
1193450455 X:81658567-81658589 TGGGCTGTAGCTGCTGATGTTGG - Intergenic
1193819387 X:86143806-86143828 AATGCTGATGCCGGTGATCTAGG + Intergenic
1194872076 X:99144811-99144833 GATGCTGATGCTGCTGATCTAGG + Intergenic
1195091114 X:101460028-101460050 AATGCTGATGCTACTGCTCTAGG + Intronic
1195692809 X:107642160-107642182 AGGGCTGGCTTTGCTGATCTTGG + Intronic
1196963944 X:121035093-121035115 AATGCTGATGCTGCTGGCCTAGG - Intergenic
1197812116 X:130454198-130454220 AGGGCTGATTTCCCTGATCTGGG + Intergenic
1198228018 X:134664266-134664288 AATGCTGATGCTGTTGGTCTGGG + Intronic
1198501736 X:137256365-137256387 GATGCTGCTGCTGCTGATCTGGG + Intergenic
1198651159 X:138865079-138865101 GGTGCTGATGCTGCTGGTCAAGG + Intronic
1198710187 X:139493064-139493086 GGCCCTGGTGCTGCTGATCTGGG + Intergenic
1199236797 X:145502357-145502379 GGAGGTGATGCTGCAGATCTGGG - Intergenic
1199819076 X:151426804-151426826 AATGCAGATACTGCTGATCTGGG + Intergenic
1199917710 X:152362096-152362118 GGGGCTGAGGCTGCAGAACTGGG - Intronic