ID: 947375809

View in Genome Browser
Species Human (GRCh38)
Location 2:229493885-229493907
Sequence GGCAGCAGGATTTAAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947375799_947375809 29 Left 947375799 2:229493833-229493855 CCAGAGAGTTGCATAATCTTCCC 0: 1
1: 0
2: 1
3: 7
4: 149
Right 947375809 2:229493885-229493907 GGCAGCAGGATTTAAACTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 178
947375801_947375809 9 Left 947375801 2:229493853-229493875 CCCAAGGAGCCCAGCTAGAAAAG 0: 1
1: 0
2: 0
3: 48
4: 619
Right 947375809 2:229493885-229493907 GGCAGCAGGATTTAAACTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 178
947375806_947375809 -1 Left 947375806 2:229493863-229493885 CCAGCTAGAAAAGGGTAAGAGTG 0: 1
1: 0
2: 2
3: 3
4: 111
Right 947375809 2:229493885-229493907 GGCAGCAGGATTTAAACTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 178
947375802_947375809 8 Left 947375802 2:229493854-229493876 CCAAGGAGCCCAGCTAGAAAAGG 0: 1
1: 0
2: 2
3: 17
4: 297
Right 947375809 2:229493885-229493907 GGCAGCAGGATTTAAACTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 178
947375798_947375809 30 Left 947375798 2:229493832-229493854 CCCAGAGAGTTGCATAATCTTCC 0: 1
1: 0
2: 2
3: 9
4: 147
Right 947375809 2:229493885-229493907 GGCAGCAGGATTTAAACTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 178
947375805_947375809 0 Left 947375805 2:229493862-229493884 CCCAGCTAGAAAAGGGTAAGAGT 0: 1
1: 0
2: 0
3: 10
4: 135
Right 947375809 2:229493885-229493907 GGCAGCAGGATTTAAACTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947375809 Original CRISPR GGCAGCAGGATTTAAACTGC TGG Intronic
900892293 1:5458299-5458321 GCAAGCAGGATTGAATCTGCCGG + Intergenic
902244542 1:15111851-15111873 GCCAGCTGGATTTGACCTGCAGG + Intronic
902276274 1:15342096-15342118 GGCAGCATGATTGAAATTTCAGG + Intronic
903753030 1:25641324-25641346 GGCATCACAATTTAAACTGGTGG - Intronic
904935614 1:34127735-34127757 GGCAGCAGGATTCATAGTCCAGG + Intronic
909829330 1:80166235-80166257 GACAGTAGTATTTAAACTGGTGG + Intergenic
910554909 1:88520918-88520940 GGCAGCAGGTTTACAACTCCAGG - Intergenic
915741312 1:158120404-158120426 GGCAGCAGGTGCTGAACTGCGGG - Intergenic
916549245 1:165833479-165833501 GGCAGCAGGATAGGAACTACTGG - Intronic
916910945 1:169345835-169345857 GGGAGCAGGATTTCAACTTGGGG - Intronic
917388327 1:174503136-174503158 GGCAGCTGGATTTGGACTCCAGG - Intronic
920264351 1:204710775-204710797 GTCAACAGGCTTTAAACTACAGG + Intergenic
920424033 1:205859140-205859162 CCCACCAGGTTTTAAACTGCAGG - Intergenic
921257617 1:213356753-213356775 GCTGGCAGGATGTAAACTGCAGG - Intergenic
924589938 1:245394159-245394181 TGCAACAGGATTTTAACAGCTGG - Intronic
1066044315 10:31582774-31582796 GGCTGGTGGATTTAAATTGCTGG + Intergenic
1068528407 10:58157472-58157494 GTCAGCAGTATTTATACTACTGG - Intergenic
1069249618 10:66251942-66251964 GGAACCAGGATTTAAACTCCAGG + Intronic
1070356610 10:75646160-75646182 GTCAGCATGTTTTAGACTGCTGG + Intronic
1070375202 10:75823834-75823856 GGCAGCATGGTTTGAACTGGAGG + Intronic
1070688963 10:78510732-78510754 GGCAGGAGGATTTGAGCAGCTGG - Intergenic
1072483226 10:95829458-95829480 GGCAGCAGGAGAGAAGCTGCTGG + Intronic
1074249924 10:111734802-111734824 GGCAGCTGGGTTCCAACTGCAGG - Intergenic
1074298765 10:112214465-112214487 GCCAGCAGGATTTAACCATCTGG - Intronic
1074494925 10:113971788-113971810 GGCAGAAGCAAATAAACTGCAGG - Intergenic
1075767975 10:124909666-124909688 GACAGCAGGATTTCAACTCAGGG + Intergenic
1077400410 11:2353236-2353258 GGAAGCAGATTTCAAACTGCTGG - Intergenic
1078007034 11:7539889-7539911 GCCAGGAGAATTAAAACTGCTGG + Intronic
1078215009 11:9304578-9304600 GGCAGGAGGATTGAAGCTGAAGG - Intronic
1081138277 11:39467149-39467171 AGCAGAAGAAATTAAACTGCGGG - Intergenic
1083325594 11:61871460-61871482 GCCAACAGGATTTAAACAGGCGG + Intergenic
1084849651 11:71928636-71928658 GGGAGCGGAATTTAAACTTCCGG + Intronic
1085319026 11:75563109-75563131 AACTGCAGGGTTTAAACTGCAGG + Exonic
1088223843 11:107597584-107597606 GGGAGCTCAATTTAAACTGCAGG - Intronic
1089311555 11:117561418-117561440 TGCTGCAGGATTTTAAGTGCAGG - Intronic
1090589613 11:128251348-128251370 TACAGCAGGATTTAAATAGCAGG - Intergenic
1092504837 12:9087356-9087378 GGCAGCATGATTAAATCTGGAGG + Intronic
1094041283 12:26123405-26123427 GGAATCAGGATTTAAAGTGGCGG - Intronic
1097359473 12:58642590-58642612 GCCAGCGAGATTTAAACTCCAGG - Intronic
1098515692 12:71374120-71374142 GGCAGAAGGATTTCAAGGGCAGG - Intronic
1098924003 12:76329052-76329074 GGTAGCAGGATTTAAATTCTTGG - Intergenic
1099315871 12:81081566-81081588 GGCAGCTGGATTTCAATTTCAGG - Intronic
1101175255 12:102143286-102143308 AGGAGCAGGATATAATCTGCTGG + Intronic
1101501273 12:105306515-105306537 GGCTGCAGGATGTTTACTGCAGG + Intronic
1103424965 12:120825657-120825679 GTTAGCAGGATTTTAGCTGCTGG + Intronic
1107095769 13:36533441-36533463 GTAAGCAGGATTCAAAATGCTGG - Intergenic
1110286608 13:73756853-73756875 GGGAGCAAGATTTAATCAGCAGG - Intronic
1112668493 13:101606687-101606709 GGCAGGAGGATTTGCAGTGCTGG + Intronic
1113556846 13:111242853-111242875 GGCACCTGGATGTGAACTGCAGG - Intronic
1113696936 13:112353809-112353831 GGCAGCAGGATTAAGAATGAGGG + Intergenic
1114635244 14:24183458-24183480 TGAAGAAGTATTTAAACTGCTGG - Exonic
1117491164 14:56249430-56249452 GGCTGCAGGATTTAAATAGGAGG - Intronic
1118366817 14:65102953-65102975 GGCAGCATTATTTAGACAGCCGG - Intergenic
1122157500 14:99759037-99759059 GGCAGCAGCTTTTCAACTGCTGG - Intronic
1126061786 15:44789857-44789879 GGCAGCAGGATATGACCTGGAGG + Intergenic
1128580767 15:68808064-68808086 GGATGCAGGATTTAATCTGCTGG - Intronic
1132234703 15:100210586-100210608 CACAGAAGGATTTCAACTGCAGG + Intronic
1133853412 16:9526954-9526976 GGCAGCAGAGATTACACTGCTGG - Intergenic
1134806821 16:17133061-17133083 GTAAGCAGAGTTTAAACTGCAGG + Intronic
1136173101 16:28499893-28499915 GGCTGCAGGATTCAACCTCCCGG - Exonic
1137362846 16:47835437-47835459 GGCAGTGGGATTCAAACTGCTGG + Intergenic
1137930746 16:52584988-52585010 GGCAGCAGGGTTGAGAGTGCAGG - Intergenic
1140329991 16:74046753-74046775 GACAGCAGGAACGAAACTGCTGG + Intergenic
1140747422 16:77993502-77993524 GGCAGCTGGATATAGACTACAGG - Intergenic
1140748452 16:78001889-78001911 TGCAACAGGATTTGCACTGCAGG - Intergenic
1141716228 16:85728612-85728634 TGCAGGAAGACTTAAACTGCAGG - Intronic
1142711683 17:1727060-1727082 GGCCGCAGGAATAAAGCTGCTGG + Exonic
1143875301 17:9986620-9986642 GACAGCAGCATTCAGACTGCAGG - Intronic
1145231818 17:21178523-21178545 GGCATCAGGATGTAAACCACTGG - Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151258857 17:72901178-72901200 GGCAGCTGGAATTCCACTGCAGG + Intronic
1155800238 18:30092597-30092619 GGCAGGACTCTTTAAACTGCTGG - Intergenic
1156801527 18:41120755-41120777 GGCAGCAGAAGTGACACTGCCGG - Intergenic
1160533212 18:79577345-79577367 GCCAGCAGGATTTGAGCTTCTGG - Intergenic
1165839759 19:38781275-38781297 GGCAGCAGAACTTAAAATGAGGG - Intergenic
1167810045 19:51821729-51821751 GGCAGCAAGATTTGAAATTCAGG - Intronic
928096453 2:28408043-28408065 GGCAGCAGGATTTTACCTGCTGG + Intronic
932437702 2:71712382-71712404 GGGGGCAGGATTTTAGCTGCAGG + Intergenic
932654031 2:73592623-73592645 GGCAGGAGGATTGGTACTGCTGG - Intronic
933110065 2:78386716-78386738 GGCAGCATGATTTCAAATGTAGG - Intergenic
935939999 2:108228305-108228327 AGCAGCAGTATTTAAACAGAGGG + Intergenic
936081303 2:109434427-109434449 GGAAGCTGGATTTCAACCGCAGG - Intronic
937862821 2:126724300-126724322 TGCAGAAGGATTTAAATTGAAGG + Intergenic
941795885 2:169597928-169597950 GGCAGAAGGATTGAAACACCAGG - Intronic
943367655 2:186981202-186981224 GCCAGCATGACTTAATCTGCTGG + Intergenic
943368270 2:186985093-186985115 GACAGCATGATTTAATCTGCTGG + Intergenic
944177053 2:196842219-196842241 AGAACCAGGATTTAAACTCCAGG + Intronic
944883917 2:204043513-204043535 GTGAGCAGGATTTCAACTCCTGG - Intergenic
946374464 2:219299752-219299774 GGCTGCAGGAGTGAAGCTGCTGG - Exonic
947375809 2:229493885-229493907 GGCAGCAGGATTTAAACTGCTGG + Intronic
1170761511 20:19255253-19255275 GGCAGCAAGAGTTAAACTGATGG - Intronic
1174268456 20:49349091-49349113 GGCTGGAGGATTCCAACTGCAGG + Intergenic
1175007941 20:55705578-55705600 GGCAGCAGGATTTGGCCTGTGGG - Intergenic
1175146424 20:56899898-56899920 GGAACCAGGATTTGAACTGGAGG - Intergenic
1175419648 20:58823233-58823255 GGCAGTGGTATTTAAACAGCTGG - Intergenic
1182874246 22:33676840-33676862 GAGAGCAAGATTTAACCTGCAGG + Intronic
949482483 3:4506859-4506881 GGCAGCAGTTTTCAAACTTCTGG + Intronic
950088734 3:10279778-10279800 GGCAGAAGGACTTCAGCTGCTGG + Exonic
952512024 3:34067695-34067717 GGCTGCAGGAGGGAAACTGCTGG - Intergenic
953007984 3:38995521-38995543 GGGAGCATCATTTAATCTGCTGG + Intergenic
954439920 3:50516239-50516261 GGCAGCAGGATGTAAGTTGTGGG + Intergenic
954726999 3:52620957-52620979 GGCAGCCGGATTAAAACTAATGG - Intronic
955300580 3:57774958-57774980 GGCAGCAGGACTTAAATATCAGG - Intronic
955403898 3:58613302-58613324 GGGAGCAGGAGTCAAACTGTGGG + Intronic
959276650 3:104285168-104285190 GGCTGCAGGTTTTTTACTGCAGG + Intergenic
960169493 3:114442032-114442054 GGGGGCAGGATTTACACTGATGG + Intronic
964331247 3:155605697-155605719 GGCAGCCCGAGTTCAACTGCTGG + Intronic
964754640 3:160082445-160082467 GACAGCATGACTTAATCTGCTGG + Intergenic
964755055 3:160085082-160085104 GCCAGCATGACTTAATCTGCTGG + Intergenic
964755943 3:160090905-160090927 GCCAGCATGATTTAATCTGCTGG + Intergenic
964756031 3:160091549-160091571 GCCAGCATGATTTAATCTGCTGG + Intergenic
965382422 3:168006447-168006469 GGCAGAAGGAACTACACTGCTGG + Intergenic
967482491 3:189989713-189989735 GGCAGAAGGATGTAAACTAAAGG + Intronic
967706593 3:192658421-192658443 GGCAGAAGTAATAAAACTGCTGG - Intronic
969517646 4:7656549-7656571 GGCAGCAGGACTTAGAATGTGGG - Intronic
972061483 4:34879126-34879148 TGCAGCAGGATGTGAGCTGCAGG + Intergenic
976474435 4:85467665-85467687 TGCAGCAGGATTGAACCTGAAGG + Intergenic
977872078 4:102103732-102103754 GGTAGCAGGAATTACAATGCTGG + Intergenic
982266010 4:153538894-153538916 GGCAGCAGTTTGGAAACTGCCGG + Intronic
984169932 4:176346998-176347020 GGCTGCAGGATGTTTACTGCAGG - Intergenic
991138255 5:63208769-63208791 TGCAGCAGGAATTTAACTACAGG - Intergenic
993440474 5:87950711-87950733 GTTAGCAGGATTTAAACATCTGG - Intergenic
994026482 5:95090425-95090447 AGCAGCAGCATTTAAGCGGCAGG - Intronic
995681694 5:114727538-114727560 GGCATCAGCATTTAGGCTGCTGG + Intergenic
997749870 5:136333711-136333733 ACCAGCAGGATTTAAAGTACAGG + Intronic
997877421 5:137561695-137561717 GGCACTAGGATTTAAACTCATGG + Intronic
999178780 5:149654080-149654102 GGCAGCCGGATTTGGCCTGCAGG + Intergenic
1001699374 5:173695755-173695777 GGCAGCAGGATTCAGACTCAGGG + Intergenic
1001764969 5:174238523-174238545 GGCAGGAGGAATTAAACCTCGGG + Intronic
1004442003 6:15662813-15662835 TGCAGCAGGATTTCACCTCCGGG - Exonic
1005680094 6:28198032-28198054 AGCAGCAGTGTCTAAACTGCTGG - Intergenic
1005900801 6:30214714-30214736 GGCAGCGTGAGTTATACTGCTGG - Intergenic
1010285906 6:74077593-74077615 GGCATCAAGATTTAAAATTCTGG - Intergenic
1010933868 6:81836873-81836895 GGAAGAAGGATTGAAACTGAGGG - Intergenic
1011983430 6:93416360-93416382 GACAACAGGATTTTAAATGCAGG + Intronic
1012625448 6:101399436-101399458 GGCAGCCGGATGTAAACAGGCGG + Intronic
1013079135 6:106797208-106797230 GGCAGAAGCATTGAAACTGGTGG + Intergenic
1014855040 6:126389917-126389939 GGCAGCAGCATTTTACTTGCAGG - Intergenic
1015571763 6:134629077-134629099 GGAAGCAGGAATAAAACTGGTGG + Intergenic
1016311200 6:142735444-142735466 TGCAGCAAGATTTAATCAGCAGG + Intergenic
1016403111 6:143701640-143701662 GTAAGCAGGATTTAAACTCAGGG - Intronic
1018750834 6:166803562-166803584 GGCAGCGAGAGTTAAACTACTGG + Intronic
1021267719 7:18545562-18545584 AGCAGAAGGCTTGAAACTGCTGG + Intronic
1021518295 7:21510806-21510828 AGAAGCAGGACTTAAACTTCAGG + Intronic
1024540052 7:50468705-50468727 GGCAACAGGACTTAAAATGGAGG + Intronic
1030265826 7:107620977-107620999 GGAAGCAGGAGTGACACTGCAGG - Exonic
1031044129 7:116868333-116868355 GGGAGAAGTATATAAACTGCAGG - Intronic
1031648817 7:124260311-124260333 GGAAACAGGATATAAACTTCAGG + Intergenic
1032063406 7:128744683-128744705 GGCAGCAGGGTAGAAACTGTGGG + Intronic
1032753520 7:134866072-134866094 GGCAGTAGGGTCTAAACTCCTGG - Intronic
1033385125 7:140866140-140866162 TGGAGCAGGATTTAAATTGAAGG + Intronic
1035443281 7:158921661-158921683 GGTAGCAGGATGTGAACTGAGGG + Intronic
1039674752 8:39649875-39649897 GGCAGCTGGATTTAACCAACTGG - Intronic
1041977162 8:63813111-63813133 TGGAAAAGGATTTAAACTGCTGG - Intergenic
1042091284 8:65162451-65162473 GGCTGCAGGAGTTAAGGTGCTGG - Intergenic
1044973024 8:97638316-97638338 GGGAGGAGGATTTAAAGTCCTGG - Intergenic
1047989445 8:130270340-130270362 TGCAGAAGTATTCAAACTGCAGG - Intronic
1048722888 8:137347231-137347253 GGCAGCATGAATGAAACTGGAGG - Intergenic
1049154988 8:141060901-141060923 GGGAGCCTCATTTAAACTGCAGG + Intergenic
1050792774 9:9495352-9495374 GGCTGCAGGTTTCAAACTGTTGG - Intronic
1051467331 9:17395366-17395388 GGCAGGTTGATTTAATCTGCTGG + Intronic
1052030440 9:23622243-23622265 GGCAGCAGGTTGGAAAGTGCTGG - Intergenic
1052251288 9:26400560-26400582 GGTATCAGGATTTAAACCTCAGG + Intergenic
1052580718 9:30350287-30350309 GGCAGCAGCAGTCAAACAGCAGG - Intergenic
1052612302 9:30790861-30790883 GGGGGCAGGATTTAATCTCCTGG + Intergenic
1053339225 9:37308692-37308714 GCCACCAGGTTTTAAACTCCTGG - Intronic
1055045361 9:71918534-71918556 CACAGCAGGAGTTGAACTGCAGG + Intronic
1055656246 9:78452920-78452942 GGCAGAAGGTTTTAAGTTGCTGG - Intergenic
1056075515 9:83034629-83034651 GGCAGGAGGATAGAAACAGCAGG + Intronic
1056779746 9:89540213-89540235 CTCAGGAGGAGTTAAACTGCAGG - Intergenic
1057336588 9:94160409-94160431 GGCAGCAGCATTTGAATTGGTGG - Intergenic
1059985213 9:119814458-119814480 GGCAGCTGGATTTGGCCTGCAGG - Intergenic
1060857183 9:126924173-126924195 AGCAGCAGTATATGAACTGCAGG - Intronic
1185722193 X:2391172-2391194 GGCACCAGGAATTCCACTGCTGG - Intronic
1186248473 X:7640242-7640264 GCAAGCAGGATTTGAACTGTAGG + Intergenic
1187237523 X:17482203-17482225 GGCAGCAGAAATTCCACTGCAGG - Intronic
1188654929 X:32681522-32681544 TGCAGCAGGGTTTATATTGCAGG + Intronic
1188687850 X:33091385-33091407 TGCAGGAGCATTTGAACTGCTGG + Intronic
1189774127 X:44455103-44455125 GGCAGCAGGATTTTCTCTTCGGG - Intergenic
1190759966 X:53430961-53430983 GGCTGCTGGTGTTAAACTGCTGG - Exonic
1192496683 X:71620920-71620942 GACAGCAGGAGGTAAGCTGCAGG - Intergenic
1193838233 X:86373525-86373547 GGAAGCAGGATTAAAAATGTAGG + Intronic
1198053744 X:132974062-132974084 CGCATCAGGTGTTAAACTGCAGG - Intergenic
1199685653 X:150263039-150263061 GGAGGCAGGACATAAACTGCTGG - Intergenic
1201756665 Y:17494010-17494032 GGCAGCAGGCTGGAAACAGCTGG + Intergenic
1201844888 Y:18411974-18411996 GGCAGCAGGCTGGAAACAGCTGG - Intergenic