ID: 947377299

View in Genome Browser
Species Human (GRCh38)
Location 2:229509701-229509723
Sequence CTACTTAGGAGGGCTGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2882
Summary {0: 1, 1: 3, 2: 89, 3: 611, 4: 2178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947377292_947377299 9 Left 947377292 2:229509669-229509691 CCGGGCATGGTAGTGGGTGCCTG 0: 88
1: 2675
2: 13722
3: 42751
4: 82272
Right 947377299 2:229509701-229509723 CTACTTAGGAGGGCTGAAGCAGG 0: 1
1: 3
2: 89
3: 611
4: 2178
947377291_947377299 10 Left 947377291 2:229509668-229509690 CCCGGGCATGGTAGTGGGTGCCT 0: 4
1: 51
2: 272
3: 769
4: 2014
Right 947377299 2:229509701-229509723 CTACTTAGGAGGGCTGAAGCAGG 0: 1
1: 3
2: 89
3: 611
4: 2178
947377294_947377299 -10 Left 947377294 2:229509688-229509710 CCTGTAATCCCTGCTACTTAGGA 0: 22
1: 3179
2: 110890
3: 242985
4: 268248
Right 947377299 2:229509701-229509723 CTACTTAGGAGGGCTGAAGCAGG 0: 1
1: 3
2: 89
3: 611
4: 2178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947377299 Original CRISPR CTACTTAGGAGGGCTGAAGC AGG Intronic
Too many off-targets to display for this crispr