ID: 947378385

View in Genome Browser
Species Human (GRCh38)
Location 2:229520956-229520978
Sequence TCCTATGCCAAGGGAGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947378375_947378385 19 Left 947378375 2:229520914-229520936 CCTCCAAACAACCCTGTCAGCTT 0: 1
1: 0
2: 1
3: 22
4: 259
Right 947378385 2:229520956-229520978 TCCTATGCCAAGGGAGGGTCTGG 0: 1
1: 0
2: 0
3: 14
4: 153
947378374_947378385 20 Left 947378374 2:229520913-229520935 CCCTCCAAACAACCCTGTCAGCT 0: 1
1: 0
2: 3
3: 14
4: 277
Right 947378385 2:229520956-229520978 TCCTATGCCAAGGGAGGGTCTGG 0: 1
1: 0
2: 0
3: 14
4: 153
947378376_947378385 16 Left 947378376 2:229520917-229520939 CCAAACAACCCTGTCAGCTTGAA 0: 1
1: 0
2: 1
3: 11
4: 152
Right 947378385 2:229520956-229520978 TCCTATGCCAAGGGAGGGTCTGG 0: 1
1: 0
2: 0
3: 14
4: 153
947378379_947378385 7 Left 947378379 2:229520926-229520948 CCTGTCAGCTTGAAGAAAAGGCT 0: 1
1: 0
2: 1
3: 19
4: 166
Right 947378385 2:229520956-229520978 TCCTATGCCAAGGGAGGGTCTGG 0: 1
1: 0
2: 0
3: 14
4: 153
947378378_947378385 8 Left 947378378 2:229520925-229520947 CCCTGTCAGCTTGAAGAAAAGGC 0: 1
1: 0
2: 0
3: 9
4: 162
Right 947378385 2:229520956-229520978 TCCTATGCCAAGGGAGGGTCTGG 0: 1
1: 0
2: 0
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947378385 Original CRISPR TCCTATGCCAAGGGAGGGTC TGG Intronic
900783395 1:4632260-4632282 CCCTATGCCATGTGAGGCTCTGG + Intergenic
901110113 1:6786414-6786436 CCCTGTGCCAAGGAAGGATCGGG - Intronic
903895293 1:26599108-26599130 ACAGAAGCCAAGGGAGGGTCAGG + Intergenic
904539368 1:31222481-31222503 TCCTTTGCCAAGGCAGGGTATGG + Intronic
905370726 1:37481426-37481448 TGCCACGCCAAGGGAGGGGCTGG + Intronic
905517390 1:38571926-38571948 TCCTCTGCCAAGGCAGGAGCTGG + Intergenic
906033201 1:42736084-42736106 TCCTCTGCCAGGGCAGGGACTGG - Intronic
906944040 1:50280403-50280425 TCTTGTGACATGGGAGGGTCAGG - Intergenic
907887780 1:58609441-58609463 TCCTATGCCAAGGGAAGAGTAGG - Intergenic
908398811 1:63751097-63751119 TCCTCTGCCAAAGGATGCTCAGG - Intergenic
908547261 1:65174017-65174039 ACCTAAGCCAGGGGAGGGGCAGG - Intronic
912565198 1:110582490-110582512 TCTTCTGCCAAAGGAGGGGCTGG + Intergenic
915653223 1:157334930-157334952 TCAACTGCCAAGGGATGGTCAGG - Intergenic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
918047753 1:180951766-180951788 TCTTTTGCCAAAGGACGGTCTGG - Intergenic
921172020 1:212558710-212558732 TCCAAGGCCGAGGGAGGGGCGGG + Intergenic
923803819 1:237236962-237236984 CCATATGTCAAGGGAGGGACTGG + Intronic
1064581593 10:16798392-16798414 TCGTATGTCAAGGGAGAGACCGG + Intronic
1064834450 10:19510246-19510268 TCCATTGCCAAGGGAGGAGCAGG + Intronic
1068191604 10:53659646-53659668 TCCCATACAAAGGGAGGGTCCGG - Intergenic
1073670150 10:105579198-105579220 ACATCTGCCAAGGGAGAGTCAGG + Intergenic
1076434832 10:130433179-130433201 GCCATTGCCAAGGAAGGGTCTGG + Intergenic
1078246302 11:9574863-9574885 TCCTATGGCTCGGGAGTGTCAGG - Intronic
1079893050 11:26082163-26082185 TCGTATACCAAAGGAGAGTCAGG + Intergenic
1081520730 11:43878784-43878806 TCCACTGCCAAGGAAGGCTCAGG + Intergenic
1090867007 11:130709928-130709950 TCCTGTGCCTTGGGAAGGTCAGG + Intronic
1091651544 12:2313939-2313961 TCCCATGGCCAGGGAGGCTCAGG + Intronic
1093008297 12:14076337-14076359 TCCTAGGCCTACGCAGGGTCAGG - Intergenic
1093197775 12:16149076-16149098 TCCTCAGCTAAGAGAGGGTCAGG + Intergenic
1095379702 12:41575783-41575805 TCCCATGCCAAGGGAGGTGTAGG - Intergenic
1096452500 12:51756117-51756139 TTCTATGTCAGGGGAGAGTCTGG - Intronic
1096460444 12:51819135-51819157 ACCTCTGCCAAGGCAGGGCCAGG + Intergenic
1096718962 12:53507141-53507163 TCCTGTGCCAAGGGGGTATCAGG + Exonic
1102535536 12:113577794-113577816 TCCTCTGTCAAGGAAGGGTGAGG - Intergenic
1103092383 12:118106474-118106496 TCCATTGCCCAGGGAGGGGCAGG - Intronic
1104094925 12:125548274-125548296 TCCCAAGCCATTGGAGGGTCAGG + Intronic
1105209890 13:18251450-18251472 TCCTTTGCCCAGGGACGATCAGG - Intergenic
1105879541 13:24592058-24592080 TCCATTGCCCAGGGAGGGGCAGG - Intergenic
1109421031 13:62112891-62112913 TTCTATGCAAAAAGAGGGTCAGG + Intergenic
1111635501 13:90898306-90898328 CCATATGCCAAGGGAGGGACAGG + Intergenic
1113940380 13:114015790-114015812 TCCTAGGAAAAGGGAGGGGCAGG + Intronic
1114170615 14:20269422-20269444 TCCATTGCCCAGGGAGGGGCAGG - Intronic
1114631215 14:24160762-24160784 TCCTGAGTCCAGGGAGGGTCAGG - Exonic
1114799701 14:25759812-25759834 TCCCTTGCCAAGGCAGAGTCAGG + Intergenic
1117749956 14:58910997-58911019 TATTATGCCAAAAGAGGGTCTGG + Intergenic
1122761737 14:104033701-104033723 TCCTAAGCCAAGGAGTGGTCGGG + Intronic
1124545073 15:30619122-30619144 GCCTAGGCCTAGGCAGGGTCAGG - Intergenic
1126534859 15:49750363-49750385 TCTGATGCCAAGCCAGGGTCAGG + Intergenic
1128183077 15:65621941-65621963 TCCTAATTCAAGGCAGGGTCGGG - Exonic
1128798928 15:70484731-70484753 TCCTCTGTCAAGTGAGGGTAAGG + Intergenic
1128862137 15:71082958-71082980 TCAGATGCCACGGAAGGGTCAGG + Intergenic
1130011904 15:80158750-80158772 TCCTATGCCAGAGGGTGGTCAGG - Intronic
1131941048 15:97565783-97565805 TGCTGTGCAAAGGGAGGCTCAGG - Intergenic
1132567632 16:630683-630705 TCCTATGCCATGGGGGTGGCAGG - Intronic
1135323410 16:21511741-21511763 TCCTAGGGCAGGGGAGGGGCGGG + Intergenic
1135607714 16:23837395-23837417 TCCAGTGCCAAGGTAGGCTCTGG + Exonic
1136863061 16:33714062-33714084 GCCAATGCCAAGGCAGGGGCAGG - Intergenic
1140355706 16:74304158-74304180 TTCTATGGCAAGGGTGGGTAAGG - Intronic
1141046435 16:80719894-80719916 CTCTATGCCAGGGGAGGGCCAGG - Intronic
1141369037 16:83470413-83470435 GCCTATGCAAAGGGATGGCCAGG - Intronic
1141435485 16:83997412-83997434 TCCTGTGCCAGGGCAGGGTCTGG - Intronic
1142035614 16:87860825-87860847 TCCTAGGGCAGGGGAGGGGCGGG + Intronic
1142141755 16:88475757-88475779 TCCTCTGCTTAGGGAGGGGCTGG + Intronic
1142666028 17:1464375-1464397 TCCCATGCCAGGGAGGGGTCAGG + Exonic
1143149375 17:4798048-4798070 TCCTTTGCCATTGGAGGCTCCGG + Exonic
1146552673 17:33795286-33795308 TCCTAATCCAAGGGAAGGGCTGG - Intronic
1147015251 17:37487131-37487153 GTCTATGCCCAGGGAGGGTTTGG - Intergenic
1148061143 17:44837273-44837295 TCCTAAGCCCAGGGAGGCTGAGG + Intergenic
1148682305 17:49481522-49481544 TCCAGTGCCAGGGGAGGGGCTGG + Intergenic
1149992275 17:61389844-61389866 GCCTATGCCAAGGGACGGTGGGG + Intronic
1151973656 17:77471884-77471906 TCCACTGCAGAGGGAGGGTCAGG - Intronic
1152122861 17:78429346-78429368 TTCTCTGCCATGAGAGGGTCAGG + Intronic
1153952071 18:10065950-10065972 TCCTATGCCAAGGGAGAGGTTGG - Intergenic
1153967801 18:10197321-10197343 TCCAAGGCCAAGGGAGGGGAAGG - Intergenic
1157667695 18:49501533-49501555 TGCTCAGCAAAGGGAGGGTCTGG - Intergenic
1160675198 19:387168-387190 TCCATTGCCCAGGGAGGGGCAGG - Intergenic
1165258715 19:34595901-34595923 TACTGTGTCAAGGGAGGGTCTGG + Exonic
1166674676 19:44732695-44732717 TCCTGTGCAAAGGGAGGACCAGG + Intergenic
1166975750 19:46604140-46604162 GGCAATGCCCAGGGAGGGTCAGG - Intronic
1167048267 19:47064135-47064157 TCCCAGGGCAAGGGATGGTCTGG + Intergenic
927455976 2:23249583-23249605 TCCTGGCCCAAGGGAGGGTTTGG + Intergenic
928176925 2:29040614-29040636 TCATGTTCCAAGGGAAGGTCGGG - Intronic
930234014 2:48871833-48871855 ACCTTTGCTAAGGGAGGGTAAGG + Intergenic
931736029 2:65195520-65195542 GCCTCAGCCCAGGGAGGGTCAGG + Intergenic
932044974 2:68339345-68339367 TGCCATGCCCAGAGAGGGTCTGG + Intergenic
932562484 2:72885779-72885801 TCCTATACTAGGAGAGGGTCTGG - Intergenic
940210718 2:151253881-151253903 TTCTAGGCCAAGGGAGGGACTGG - Intronic
942841423 2:180366255-180366277 TTCTAGGCCAAGGGAAGGACAGG + Intergenic
946251816 2:218418630-218418652 TCAGAAGCCAAGGGAGGGGCTGG + Intergenic
946364899 2:219243032-219243054 TCCTAGGCCAAGGGTGGGAAAGG - Intronic
946662671 2:222018352-222018374 TCCTATGGAAAGGGAGAGCCAGG + Intergenic
947378385 2:229520956-229520978 TCCTATGCCAAGGGAGGGTCTGG + Intronic
948373107 2:237503257-237503279 TCCGCTGCCAAGGCAGGGCCTGG + Intronic
948459224 2:238121107-238121129 CCCAAGGCCCAGGGAGGGTCAGG - Intronic
948800867 2:240433000-240433022 GCCTCTGCCTAGGGAGGGTGGGG - Intergenic
1171291044 20:23983138-23983160 TCCTTTGCCCAGGGACGATCAGG - Intergenic
1171451910 20:25241748-25241770 TCCATTGCCCAGGGAGGGGCAGG - Intergenic
1173674230 20:44820160-44820182 TCCTGAGCCAAGGGAGGCTCTGG + Intergenic
1173811696 20:45959828-45959850 TCATCTGCCAAGGCAGGGTCTGG + Intronic
1177732749 21:25049444-25049466 TTCCATGCGAAGGGAGGGTCGGG - Intergenic
1180766370 22:18347949-18347971 TCCTTTGCCCAGGGACGATCAGG + Intergenic
1180779945 22:18514429-18514451 TCCTTTGCCCAGGGACGATCAGG - Intergenic
1180812659 22:18771750-18771772 TCCTTTGCCCAGGGACGATCAGG - Intergenic
1181198818 22:21205998-21206020 TCCTTTGCCCAGGGACGATCAGG - Intergenic
1181400920 22:22649797-22649819 TCCTTTGCCCAGGGACGATCAGG + Intergenic
1181442346 22:22943189-22943211 CCCTCTCCCAAGGGAGGGGCTGG + Intergenic
1181624263 22:24112738-24112760 TTCTATTCTAAGGGAGGGGCAGG - Intronic
1181702898 22:24630889-24630911 TCCTTTGCCCAGGGACGATCAGG + Intergenic
1183356810 22:37364153-37364175 TCCTTGGCCAAGGGAGGCTTAGG - Intergenic
1184244667 22:43229935-43229957 TGCTATGCCCAAGGAGGGGCAGG - Intronic
1184495519 22:44839019-44839041 TCCTACGGGAAGGGAGGGACAGG + Intronic
1184963214 22:47946874-47946896 TCCCATTCCAGGGAAGGGTCTGG + Intergenic
1185101808 22:48844619-48844641 TCCAACGACAAGGGTGGGTCAGG - Intronic
1185337168 22:50275878-50275900 TACTATGACGAGGTAGGGTCAGG - Exonic
1203227987 22_KI270731v1_random:88839-88861 TCCTTTGCCCAGGGACGATCAGG + Intergenic
952582569 3:34851995-34852017 TCCTTTGCCCAGGTAGGGCCTGG - Intergenic
954406646 3:50348947-50348969 TCCTGGGCCACCGGAGGGTCTGG + Exonic
959583481 3:108004719-108004741 TCCGATCCCACGGCAGGGTCTGG - Intergenic
963258143 3:143166919-143166941 TCCTAGGCCTACAGAGGGTCAGG - Intergenic
968727147 4:2252989-2253011 GCCTAGGTCAAGGGAGGGCCAGG + Intronic
972982775 4:44726137-44726159 TCCTTTGCCAAGTGAGGGCCAGG - Intronic
974766919 4:66359204-66359226 TCCATTGCCCAGGGAGGGGCAGG + Intergenic
983591721 4:169420149-169420171 GCCTATGCCTACAGAGGGTCAGG + Intronic
984916509 4:184730049-184730071 CCCTATGCCTTGGGAGGGGCTGG - Intronic
990527243 5:56640107-56640129 TCATATGTCAAGGAAGGATCTGG + Intergenic
990789768 5:59464285-59464307 TCCATTGCCCAGGGAGGGGCAGG - Intronic
993602279 5:89942043-89942065 GCTTATGCCAAGGTTGGGTCTGG + Intergenic
994157770 5:96522875-96522897 TCCTAAGTAAAGGGAGAGTCGGG + Intergenic
994157857 5:96523501-96523523 TCCTAAGCAAAGAGAGAGTCGGG - Intergenic
996457449 5:123700865-123700887 TCCTCTGCCAGGGAAGAGTCAGG + Intergenic
997508613 5:134437826-134437848 TCCTAGGCAAAGGCAGGGGCCGG - Intergenic
998429852 5:142061486-142061508 GACTATGCCAAGGTAGGCTCAGG + Intergenic
1000325564 5:160169437-160169459 TCCTTTCCCAAGGCAGGCTCTGG - Intergenic
1011979807 6:93359122-93359144 TCCTCTGCCGAGAGAGGGTTAGG + Intronic
1012864092 6:104596671-104596693 TCTAATGCCATAGGAGGGTCAGG - Intergenic
1017455798 6:154600230-154600252 CCCAATACCAAGGGTGGGTCTGG - Intergenic
1018585309 6:165350674-165350696 TCCCATGACAAGTGAGGGTTAGG - Intronic
1018610270 6:165641754-165641776 TCCTAAGCAAAGTGAGGCTCAGG - Intronic
1019029093 6:168995052-168995074 GCCAATGCCAATGGAGGGGCAGG + Intergenic
1019887629 7:3919269-3919291 TCCTCTGCCAAGGCAAGATCTGG + Intronic
1023366934 7:39474159-39474181 TGCTTTGCCAAGGGACGGGCAGG - Intronic
1031185611 7:118476092-118476114 TCCACTGGCAAGGGAGGTTCGGG + Intergenic
1034987376 7:155524780-155524802 TCCAATGACCAGGGAGGGTGGGG - Intronic
1035230809 7:157464420-157464442 TCTTATGCAAAGAGAGGGCCGGG + Intergenic
1036215599 8:6877439-6877461 TCCTATGCAGAGAGAGGGGCCGG - Intronic
1041557693 8:59176304-59176326 TCTCATGCAAAGGGAGGCTCGGG - Intergenic
1042903120 8:73747262-73747284 TCGTCTGCCAAGGGTGGGCCTGG + Intronic
1043226344 8:77735814-77735836 TTCTGTGCCAAGTGAGGGTAAGG - Intergenic
1045358629 8:101411863-101411885 GCCTATTCCCAGGGAGGGTGTGG - Intergenic
1045864167 8:106845808-106845830 TCCTATGGCAGTGGAGGGTAGGG - Intergenic
1049845041 8:144796392-144796414 TCCATTGCCCAGGGAGGGGCAGG - Intergenic
1057169547 9:92953048-92953070 TCATATGCCCAGGGAGGTGCGGG - Intronic
1059391829 9:114004205-114004227 TCTTATGCCAAAGGAGAGGCCGG + Intronic
1060732844 9:126049075-126049097 TCCTGGGCCCAGGGAGGGACTGG + Intergenic
1061725453 9:132580001-132580023 TCCTCTGCCCCGGGCGGGTCCGG - Intergenic
1061793181 9:133069249-133069271 GCCAATGCCAAGTGAGGATCTGG + Exonic
1061795785 9:133085033-133085055 GCCAATGCCAAGTGAGGATCTGG + Intronic
1186506684 X:10099207-10099229 TACTATGCCATGCGAGGGTTCGG - Intronic
1186576883 X:10776202-10776224 TAATATGCCAAGGTAGGGGCAGG + Intronic
1189840922 X:45076773-45076795 TCCTTTGGCAAGGGAGGGTATGG - Exonic
1192215781 X:69157077-69157099 TCCTCTCCCAAGGTAGGCTCAGG - Intergenic
1192235255 X:69291549-69291571 TCCTATCACAAGGGAGGGCTGGG - Intergenic
1192535599 X:71924527-71924549 TCTTAGGCCAAGGGATGGCCAGG - Intergenic
1195456122 X:105072059-105072081 CCATATGTCAAGGGAGGGACTGG + Intronic
1198216278 X:134557763-134557785 TCCACTGCCAAGGGTGGGTCAGG - Intergenic
1199543147 X:148979867-148979889 CCCTTTGCGAAAGGAGGGTCAGG - Intronic
1201282133 Y:12351367-12351389 TCCCATGCCAGGGGAGTGTGGGG + Intergenic
1201376425 Y:13326252-13326274 TCCTTTGGCAAGGGTGGGTATGG + Exonic