ID: 947380476

View in Genome Browser
Species Human (GRCh38)
Location 2:229540522-229540544
Sequence ATAGCCCATGTGGCCAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947380476_947380481 -6 Left 947380476 2:229540522-229540544 CCCAACTTGGCCACATGGGCTAT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 947380481 2:229540539-229540561 GGCTATAGAACAAGGACAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 135
947380476_947380480 -7 Left 947380476 2:229540522-229540544 CCCAACTTGGCCACATGGGCTAT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 947380480 2:229540538-229540560 GGGCTATAGAACAAGGACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 172
947380476_947380482 10 Left 947380476 2:229540522-229540544 CCCAACTTGGCCACATGGGCTAT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 947380482 2:229540555-229540577 CAGTGGGTATTATCAAGCAATGG 0: 1
1: 0
2: 0
3: 13
4: 120
947380476_947380483 23 Left 947380476 2:229540522-229540544 CCCAACTTGGCCACATGGGCTAT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 947380483 2:229540568-229540590 CAAGCAATGGACAAAGTAACTGG 0: 1
1: 0
2: 0
3: 19
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947380476 Original CRISPR ATAGCCCATGTGGCCAAGTT GGG (reversed) Intronic
903173859 1:21569357-21569379 ATACCCAATGTGGCCAGGCTCGG - Intronic
904378415 1:30095809-30095831 TCTGCCCATGTGGCCAAGTCTGG + Intergenic
904892907 1:33792748-33792770 ATAGCACATCTGGCCAATTCTGG + Intronic
905640962 1:39589543-39589565 ATTGCCTATGTTGCCAAGCTTGG + Intergenic
906731456 1:48085004-48085026 GTAGCCCATTTGGGCAAGGTTGG + Intergenic
907227996 1:52967356-52967378 ATATCCAATGGGGCCAATTTTGG + Intronic
908814498 1:68017831-68017853 CTAGAGCATGTGCCCAAGTTGGG - Intergenic
911291359 1:96060176-96060198 ACAGTCCTTGTGGCCAAGATTGG + Intergenic
911410122 1:97493663-97493685 ATAGCTCATGGGACCATGTTTGG - Intronic
911573362 1:99544553-99544575 AAAGCTCATGTGGCCAATCTTGG - Intergenic
919953009 1:202383431-202383453 ATTTCCCATATGGCCAGGTTTGG + Intronic
921194936 1:212746853-212746875 ATGGCCCCTGTGGCCAGGTGCGG + Intronic
924024512 1:239818326-239818348 ATCCCTCATGTGGCCAAATTTGG - Intronic
924028311 1:239861590-239861612 ATTGTCCATGGGACCAAGTTGGG + Intronic
1067962137 10:50865697-50865719 AAGGCCAATGTGGCAAAGTTAGG - Intronic
1078399231 11:11009584-11009606 ATAGCCCTTGTGAACAAGTTAGG + Intergenic
1081753169 11:45526567-45526589 GCATCCCATGTGGGCAAGTTTGG + Intergenic
1083210548 11:61182459-61182481 ATATCCCATGTTGACAAATTTGG + Intergenic
1087617177 11:100500579-100500601 ATAGCCCATGCCGGAAAGTTGGG - Intergenic
1087799004 11:102483839-102483861 TTAGTTAATGTGGCCAAGTTTGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092333982 12:7612214-7612236 AAAGGCCAAGTGGCCAAGTGTGG + Intergenic
1092403241 12:8195769-8195791 TTACCCCATGTGGCCAAATACGG - Intergenic
1094388013 12:29916320-29916342 AAAGCCCATGTGACAAAGTAGGG - Intergenic
1103379768 12:120485028-120485050 ATAGCCCATGCGGCCAGGGGCGG - Intronic
1104574370 12:129953383-129953405 ATAGGCCAACTGGCCAAGTCTGG + Intergenic
1106277823 13:28231017-28231039 TTAGATCATTTGGCCAAGTTTGG + Intronic
1110052367 13:70920422-70920444 AGAGACTATGTGGCCATGTTTGG - Intergenic
1112599001 13:100836747-100836769 ATAGTCCTTGTCGCTAAGTTAGG + Intergenic
1115497996 14:34025857-34025879 ATTGCCCCTGTGGCCAGGCTGGG - Intronic
1123574657 15:21655436-21655458 ATCGTCCATGAGGCCATGTTAGG + Intergenic
1123611271 15:22097932-22097954 ATCGTCCATGAGGCCATGTTAGG + Intergenic
1202983521 15_KI270727v1_random:389688-389710 ATCGTCCATGAGGCCATGTTAGG + Intergenic
1134329038 16:13233671-13233693 ATAGCCCACGGGGCCAAATCTGG - Intronic
1134482789 16:14633207-14633229 ATAGCGCAGTTGGCCAAGCTGGG - Intronic
1134835094 16:17354719-17354741 ATGGCAGATGTGGCCAAGCTTGG - Intronic
1135091729 16:19523042-19523064 ATAGACCATGAAGCCGAGTTAGG + Intergenic
1137539093 16:49349777-49349799 ACAGCCCATGTTGACAAGCTGGG - Intergenic
1148507721 17:48141406-48141428 ATAGCCCCTGTTGCCCAGTCTGG + Intronic
1149218479 17:54387393-54387415 ATATCCCATGTCCCCAAGCTAGG - Intergenic
1149418848 17:56488762-56488784 CTGGGCCATGTGGCCTAGTTTGG - Intronic
1150421420 17:65039425-65039447 GTAGCCCATGTTGAGAAGTTTGG - Intronic
1159076094 18:63683553-63683575 AAAGCCCATGTGCCCAAATTAGG - Intronic
1162905684 19:13822308-13822330 ACAGCCCATGGGGCCTAATTTGG + Intronic
1163891938 19:20024545-20024567 AGAATCCATGTGGCCAGGTTCGG + Intronic
925423220 2:3728237-3728259 AAAGCGCAAGGGGCCAAGTTTGG - Intronic
927903600 2:26841409-26841431 TTGGCCCATGTGGCCAAGTGGGG - Intergenic
932417956 2:71585071-71585093 ATGTCCCCTGTGGCCAGGTTCGG - Intronic
932464435 2:71907243-71907265 ATGGGCCATGTGCCCAAGGTAGG - Intergenic
933281157 2:80334022-80334044 TTAGCCCATGTGGCCAACTGTGG + Intronic
936286914 2:111188044-111188066 AAAGCCCATGTGGGCCGGTTTGG - Intergenic
937429185 2:121824416-121824438 GGAGCTCATTTGGCCAAGTTGGG + Intergenic
942301799 2:174570116-174570138 ATGGCCCATATGACCAAGTGAGG + Intronic
943035643 2:182742478-182742500 ATTTCCCATGTGGCCAGGTGTGG - Intronic
943878476 2:193105763-193105785 ATAGCCTAGGATGCCAAGTTTGG - Intergenic
945675772 2:212853864-212853886 ATAATTCATTTGGCCAAGTTAGG - Intergenic
947380476 2:229540522-229540544 ATAGCCCATGTGGCCAAGTTGGG - Intronic
947915717 2:233830615-233830637 ATGGCCCAGGTGGCCCAGGTGGG + Intronic
1170964546 20:21054575-21054597 CTATCCCCTGTGGCCAAGATTGG - Intergenic
1172443968 20:34983690-34983712 CTAGCCCGTTTGGCCAAATTTGG - Intronic
1173135185 20:40433209-40433231 TTACTCCATGTGGCCAAGGTGGG + Intergenic
1175245715 20:57580807-57580829 ATAGCCCAGGTGGCCATGAAGGG - Intergenic
1176922082 21:14699859-14699881 AAAGATCATGAGGCCAAGTTAGG + Intergenic
1179455373 21:41495878-41495900 ATAGCCCATTGGGCAAACTTGGG - Intronic
1180996767 22:19969718-19969740 TGAGCCCAAGTGGACAAGTTTGG + Exonic
1181177992 22:21048579-21048601 ATAGCCCAAGTGGCCATGCATGG - Intronic
1181594984 22:23908294-23908316 ATGACCCATGTGGCCAAAGTGGG - Intergenic
950662262 3:14473881-14473903 AAAGCCCAAGTGGCCTATTTTGG - Intronic
955835247 3:63047400-63047422 GTAGCCCATGTGGCCCTGTGTGG + Intergenic
955880153 3:63534946-63534968 ATACCCAATGTGGCAATGTTGGG - Intronic
959844082 3:111012892-111012914 ATACCCTATGTGCCCAATTTTGG + Intergenic
959974721 3:112445774-112445796 TTATCCCATGTAGCCAAATTTGG - Intergenic
963439606 3:145321235-145321257 CTAGCCAGTGTGGCTAAGTTTGG - Intergenic
968183651 3:196615920-196615942 ATAACCCATGTGGCCAGGTGCGG - Intergenic
969332532 4:6486124-6486146 ATAACCCATGTGTCCAAGAAAGG - Intronic
970905653 4:21213169-21213191 AGAGCACATGAGGCAAAGTTGGG + Intronic
973773762 4:54228044-54228066 ATGGCCAAAGTGGCCAGGTTGGG - Intronic
977308402 4:95354279-95354301 ATAGACCATGTGGGCAAGCTTGG - Intronic
978967041 4:114752886-114752908 AAAGCCAATGTGGCCAAGATGGG - Intergenic
984845707 4:184106440-184106462 ATGGGCCAGGTGGCCAAGTGTGG - Intronic
986248398 5:6031944-6031966 TTAGCCCATGTGCACAAGCTGGG - Intergenic
986337054 5:6763070-6763092 GTCTCCCATGTGGCCAGGTTGGG + Intergenic
991612314 5:68462275-68462297 ATAGGCCATGTGAACAACTTTGG + Intergenic
994049436 5:95345630-95345652 ATGTGCCATGTGGCCAGGTTGGG + Intergenic
994218879 5:97171627-97171649 AAAGCACATGTAGACAAGTTTGG - Intronic
994906577 5:105846691-105846713 CTATCCTTTGTGGCCAAGTTGGG - Intergenic
996900932 5:128540127-128540149 ATAGCACATCTGGGCAATTTGGG - Intronic
997226903 5:132215592-132215614 TTAGCCCATGTGGCCAGACTGGG - Intronic
997897255 5:137730262-137730284 ATAGCCCATCAGGCCAAGTGAGG + Intronic
1014893244 6:126868662-126868684 ATTGCCCATATGGGCAAGTAAGG + Intergenic
1026041731 7:66873861-66873883 ATAGCACTTGTGGCCAGGTGCGG + Intergenic
1026122374 7:67549147-67549169 ATAGTACATGTGGCCAGGCTTGG - Intergenic
1026425371 7:70286864-70286886 GTAGCTCATGTGTCCAATTTTGG - Intronic
1036865073 8:12389305-12389327 TTACCCCATGTGGCCAAATATGG - Intergenic
1039562932 8:38527623-38527645 ATAGCCCAAAAGGCAAAGTTGGG - Intronic
1046872095 8:119215076-119215098 ATAGGTCATGTGGGCAAATTTGG + Intronic
1049108450 8:140628055-140628077 ATTGCCCATTAGGCCAGGTTTGG - Intronic
1049672206 8:143874957-143874979 ATAGCCCATGTGGTGGAGGTGGG - Intronic
1057894342 9:98895295-98895317 AAAGCACATTTGGCCAAGCTTGG + Intergenic
1058092096 9:100816016-100816038 ATATCCCATTTGCCCAATTTGGG + Intergenic
1058626654 9:106940415-106940437 TTAGACCATGTTGACAAGTTGGG - Intronic
1186083920 X:5965375-5965397 GTAACCAATGTGGCCAAGTTGGG + Intronic
1189372897 X:40444100-40444122 AGAGACCATGTGGCCCACTTAGG - Intergenic
1197130727 X:123002792-123002814 ATAGCAACTGTGGCCAAGTGTGG + Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1202581639 Y:26387839-26387861 ATTTCCCATATGGCCAGGTTCGG - Intergenic