ID: 947383776

View in Genome Browser
Species Human (GRCh38)
Location 2:229570688-229570710
Sequence TGGAGTATGAGGGGCACGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947383776 Original CRISPR TGGAGTATGAGGGGCACGAG AGG Intronic
902169329 1:14598198-14598220 TGGAGAGTGAGAGGCACGCGGGG + Intergenic
902755234 1:18545064-18545086 TGAGGAATGAGGGGCACCAGAGG + Intergenic
903360880 1:22776240-22776262 TGGAGTGGGAGGGGCACGCTAGG - Intronic
906187482 1:43872177-43872199 TGGGGTGTGAGGGACAGGAGGGG + Intronic
909561804 1:77016082-77016104 AGGAGCATGAGGGGGAGGAGTGG - Intronic
911364921 1:96926516-96926538 TGAAGGATGAGGGGTACTAGGGG + Intergenic
915316732 1:155033034-155033056 TGCAGGATGAGGGGGGCGAGGGG + Intronic
918100835 1:181372635-181372657 TTGAGTAGGAGTGGCAAGAGTGG + Intergenic
919936008 1:202251493-202251515 TGGGGTATGGGGGGCAGGAGAGG + Intronic
919936097 1:202251807-202251829 TGGAGTGTGGGGGGCTGGAGGGG + Intronic
920213880 1:204348661-204348683 TGAAGCAAGAGGGGCGCGAGTGG - Intronic
920656481 1:207879368-207879390 TGGAGTATCAAGGGCATGTGTGG - Intergenic
921334980 1:214076810-214076832 TGGAGGAGGAGGGGCAGGAAGGG - Intergenic
922027709 1:221767136-221767158 AGGAGTAGGAGAGGCAGGAGGGG - Intergenic
1063078133 10:2736770-2736792 TGGAGGAAGAGGGGCTCGAGGGG + Intergenic
1063398272 10:5714492-5714514 TGGAATGTGAGGGGTAAGAGAGG + Intronic
1064982595 10:21179479-21179501 TGGAGCGTGAGGGGCTGGAGCGG - Intergenic
1065122298 10:22541946-22541968 TGGAGTGTGAGGAGAACGATGGG - Exonic
1069590559 10:69639157-69639179 TGGAGTATGAGAGGAGGGAGAGG - Intergenic
1069813423 10:71178955-71178977 TGGAGAATGAGGGGCTGGAGTGG - Intergenic
1070189420 10:74098103-74098125 TGTAGCATGAGGGGGAAGAGTGG - Intronic
1072782649 10:98261020-98261042 TGAAGTATGAGGGCCACTGGCGG - Exonic
1075448325 10:122529368-122529390 GGGAGTAGAAGGGGCACAAGGGG - Intergenic
1076314063 10:129528496-129528518 TGGAGTGTGAGGGGCAGTGGCGG + Intronic
1077043313 11:534022-534044 GGGGGCATGAGGGGCATGAGAGG - Intronic
1078059331 11:8033171-8033193 TGGAGGAAGTGGGGCACGATGGG - Intronic
1079357478 11:19742147-19742169 TGGAGTATAAGGGGCTCAGGAGG - Intronic
1079489111 11:20967720-20967742 TGGACTATGGTGGGCAAGAGTGG - Intronic
1081645261 11:44785836-44785858 TGGGGTTCGAGGGGCAAGAGTGG + Intronic
1082094032 11:48112344-48112366 TGGAGTTTGGGGGTCAAGAGTGG + Intronic
1084117372 11:67050099-67050121 TGGAGTACGAGGGGCACCCTGGG + Exonic
1084501131 11:69536098-69536120 TGGGGCATGATGGGCATGAGGGG - Intergenic
1086415895 11:86588710-86588732 TGAAGTATGAAGGGCAGGGGAGG + Intronic
1087462611 11:98463774-98463796 TGGGGGATGGGGGGCAGGAGAGG + Intergenic
1089654058 11:119934364-119934386 TGCAGGATGAGGGTCAAGAGTGG - Intergenic
1090433086 11:126663128-126663150 TGGAGTGTGAGAGGCAGGAGAGG + Intronic
1094180348 12:27585893-27585915 TGGAGTGTGAGGGGCAGTGGGGG + Intronic
1095089104 12:38087601-38087623 TGGAGGATGAGAGGCCTGAGAGG - Intergenic
1102453498 12:113057493-113057515 TGGGGGACGAGGGGGACGAGGGG - Intronic
1103400896 12:120641745-120641767 TGGAGTCTGGGGGTCAAGAGAGG + Intronic
1110415793 13:75250910-75250932 TGGAGGATGGGGTGGACGAGGGG - Intergenic
1111253973 13:85641642-85641664 TGGACTATGAGGGGCTTGTGTGG + Intergenic
1112225595 13:97536559-97536581 TGGAGTGTGAAGGGCTTGAGCGG - Intergenic
1114769042 14:25408095-25408117 TGGAGTGAGAGGGGGAAGAGTGG + Intergenic
1115288709 14:31746226-31746248 TGGAATAAGAGTGGCAAGAGTGG + Intronic
1115782300 14:36783279-36783301 TGGAGCATTAGGGGCACCAGTGG + Intronic
1117930841 14:60838957-60838979 TGGGGAATGAGGAGCATGAGAGG + Intronic
1118260321 14:64240398-64240420 TGGAGGATAAGGGTCAGGAGAGG - Intronic
1119617663 14:76109497-76109519 TTGAGGTTGAAGGGCACGAGTGG + Intergenic
1119640987 14:76314794-76314816 TGGAGTAGGAGGGGAGAGAGAGG - Intronic
1120790696 14:88578746-88578768 TGAAGTATGTTAGGCACGAGGGG - Intronic
1121250802 14:92498014-92498036 AGGAGTACGTGGGGCACGTGAGG + Exonic
1123108628 14:105854887-105854909 TGCAGGAAGAGGGGCAAGAGTGG + Intergenic
1124078430 15:26468879-26468901 TGGAGTGTGGAGGGCAGGAGGGG + Intergenic
1127320643 15:57841850-57841872 TGGAGGATGAGAGGAAGGAGAGG - Intergenic
1130859993 15:87877330-87877352 TGGAGTATGAAGGGCAGCAGAGG - Intronic
1131738089 15:95356218-95356240 TGGAGTATAAGGGCCAGAAGAGG - Intergenic
1133862057 16:9605311-9605333 GGGAGTATGAGAGGCAGGGGAGG - Intergenic
1134083272 16:11339152-11339174 TGGAGAAAAAGGGGCACCAGAGG + Intronic
1135996280 16:27251871-27251893 TGGAGTATAAGGTGGACCAGAGG - Intronic
1136073504 16:27803010-27803032 TGGAGTTTGAGGGGCTCGTGAGG - Intronic
1138657503 16:58499684-58499706 GGGAGTATGGAGGGCCCGAGAGG - Intronic
1142961459 17:3554678-3554700 GGCACTGTGAGGGGCACGAGTGG - Intronic
1143377692 17:6477106-6477128 TGGAGGATGAGGAGCCCAAGAGG - Exonic
1143996516 17:11011241-11011263 TGGGGTGAGAGGGGCAAGAGTGG + Intergenic
1144284874 17:13764148-13764170 AGGAGAATGAGGGACAAGAGAGG + Intergenic
1144676557 17:17165931-17165953 TGGAGCAGGAGAGGCAGGAGAGG + Intronic
1148107839 17:45128645-45128667 GGGAGGATGAGGGGCAGGGGCGG + Intronic
1148742819 17:49902299-49902321 AGGAGGGTGAGGGGCAGGAGAGG + Intergenic
1150210916 17:63441014-63441036 TGGAGTACAAAGGGCAGGAGAGG + Intronic
1152021174 17:77781154-77781176 TGGAGTTGGAGGGGCAGGAGTGG - Intergenic
1154305372 18:13226911-13226933 TGGAGAATGAGGGCCAGGAGGGG + Intronic
1154338076 18:13481885-13481907 TGGAGTTTGCTGGGCAGGAGGGG + Intronic
1155787986 18:29926117-29926139 TGGAGTCTTAGAGGCAAGAGGGG + Intergenic
1156197341 18:34790176-34790198 GGCAGTGTGAGGGGCACTAGGGG + Intronic
1160122211 18:76140747-76140769 GGAAGTATGAGGGGCAAGACAGG + Intergenic
1160875367 19:1294217-1294239 TGGACCAAGCGGGGCACGAGGGG - Intronic
1160969156 19:1759773-1759795 GGGGGTATGAGGGGCTGGAGGGG + Intronic
1161948773 19:7455514-7455536 GGGGGACTGAGGGGCACGAGGGG + Intronic
925117197 2:1389675-1389697 TGGATTATCAGTGGCAGGAGTGG - Intronic
925588856 2:5490324-5490346 TGGAGTGTGAGGGGGACGTAAGG + Intergenic
926087309 2:10028575-10028597 TGGAGCATGAGGGGCCTGGGGGG - Intergenic
927912219 2:26907711-26907733 TGGAGGAGGAGTGCCACGAGAGG - Intronic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
928284752 2:29980097-29980119 AGGAGAATAAGGGGCAGGAGAGG + Intergenic
932076850 2:68672310-68672332 TGGAGTAAGGAGGGCATGAGCGG + Intergenic
933043589 2:77503319-77503341 TGGAGTATGAGGGTGAGGATGGG + Intronic
933684543 2:85133163-85133185 TGCAGTGTGAGGCGCAGGAGGGG + Intergenic
935117100 2:100146163-100146185 TGGAGTTTGGGGGGCAGCAGGGG - Intergenic
935449809 2:103196243-103196265 TGGAGTATAAGAGGAAGGAGAGG + Intergenic
935514479 2:104019656-104019678 TGGAGGATGAGGGGCTTCAGTGG + Intergenic
940988546 2:160074465-160074487 TGGAGTTAGAGAGGCAGGAGAGG + Intergenic
942499820 2:176577882-176577904 TGTAGTATCAGGGGGAGGAGGGG - Intergenic
943581139 2:189684879-189684901 TGGAGGATGAGGGGAATGAGGGG - Intronic
943879677 2:193125376-193125398 TGCAGAATGTGGGGCAAGAGTGG + Intergenic
947383776 2:229570688-229570710 TGGAGTATGAGGGGCACGAGAGG + Intronic
948538873 2:238670937-238670959 ATGAGTAGGAGGGGCATGAGGGG - Intergenic
948625841 2:239267358-239267380 TGGAGTCTGAAGAGCACCAGTGG + Intronic
948972679 2:241441523-241441545 TGGAGTGCGGGGGGCCCGAGGGG - Exonic
1170041847 20:12047117-12047139 TGGAGTATGAATGGCACCAGAGG + Intergenic
1170358317 20:15517221-15517243 TGGAGCATGAGGGTGACGGGTGG - Intronic
1173249442 20:41356934-41356956 AGGAGAATGAGAGGCCCGAGGGG + Intronic
1173772240 20:45670832-45670854 TTGAGTAGGAGTGGCAAGAGTGG - Intergenic
1174513250 20:51071951-51071973 AGGAAGATGAGGGGCATGAGGGG - Intergenic
1175752908 20:61511333-61511355 TGGAGTTAGAGGGGCAGGAGGGG - Intronic
1181317298 22:21978954-21978976 GGGAGGGTGAGGGGCAAGAGAGG + Intronic
1182053021 22:27327723-27327745 TGGAGTAGGGTGGGCACGAGGGG + Intergenic
949142303 3:649557-649579 AGGAGGATGAGGGGGAGGAGCGG - Intergenic
950271137 3:11616141-11616163 TGGAGTCTGAGGGGCGGGGGAGG - Intronic
955723823 3:61911098-61911120 AGGAGTATGAAGGTCAAGAGGGG - Intronic
958103932 3:89049066-89049088 TGGAGCATCAGGGGCATGAAGGG + Intergenic
961345609 3:126261354-126261376 GGGAGTGAGGGGGGCACGAGAGG - Intergenic
961437067 3:126926578-126926600 TGGAGTATTAGGGGAAAGATGGG + Intronic
962333406 3:134501866-134501888 TTGAGTAGGAGTGGCAAGAGAGG + Intronic
965672058 3:171157526-171157548 GGGAGAATGAGGAGCACAAGCGG - Exonic
966618399 3:181937645-181937667 TGGAGTTGCAGTGGCACGAGTGG + Intergenic
975163324 4:71148534-71148556 TGGAGGATGAGAGGAAGGAGAGG - Intergenic
975822862 4:78289647-78289669 TGGGGTAGGATGGGCAAGAGGGG - Intronic
976893071 4:90074516-90074538 TGGATTAGGAGGGGCTTGAGAGG + Intergenic
976989366 4:91345842-91345864 AGGAGTTTGTGGGGCATGAGGGG - Intronic
977732359 4:100368945-100368967 TGGAGGATGAGAGGAAGGAGAGG - Intergenic
980455968 4:133043681-133043703 TTGAGTATAAGTGGCAAGAGTGG - Intergenic
980859873 4:138486342-138486364 TGGACTATGAGGGGCTGGAGTGG - Intergenic
989602963 5:43217127-43217149 TGGAGTATGAGGGGAGAGATTGG - Intronic
989823148 5:45819779-45819801 TGGGGTATAGGGGGCAAGAGGGG + Intergenic
990236639 5:53775639-53775661 TGGAGTAGAAGTGGCAAGAGTGG - Intergenic
991615093 5:68488546-68488568 TTGAGTATAAGTGGCAAGAGTGG + Intergenic
992291969 5:75288685-75288707 TTGAATATGAGTGGCAAGAGAGG + Intergenic
994089660 5:95798985-95799007 TGAAGGATGCGGGGCATGAGGGG - Intronic
998876763 5:146608123-146608145 TGGTGTTTGAGGGGTAGGAGGGG + Intronic
999192557 5:149759473-149759495 TGGAGCAGGAGGGGCAGGAGAGG + Intronic
999247675 5:150163860-150163882 TGGAGTGGTAGGGGCAAGAGAGG - Intergenic
1002503913 5:179665754-179665776 AGGAGGATGAGGGACATGAGAGG - Intergenic
1002637865 5:180617086-180617108 CAGAGTCTGAGGGGCAGGAGAGG - Intronic
1002637914 5:180617286-180617308 CAGAGTCTGAGGGGCAGGAGAGG - Intronic
1002637926 5:180617336-180617358 CAGAGTCTGAGGGGCAGGAGAGG - Intronic
1004516669 6:16327200-16327222 TGTAGTCTGAGGGGCTCGGGTGG + Exonic
1007637023 6:43305756-43305778 TGGACCATGAGGGGCATGATGGG + Exonic
1017287269 6:152690413-152690435 TGGATTATCTGGGGCAGGAGGGG - Intergenic
1018105605 6:160483399-160483421 TGCAGAATGCGGGACACGAGAGG - Intergenic
1018117340 6:160600242-160600264 TGCATTATGCTGGGCACGAGAGG - Intronic
1019109464 6:169698316-169698338 TGGAGCAGGAGAGGCAGGAGAGG - Intronic
1019294151 7:265109-265131 AGGGGTAGGAGGGGCAGGAGGGG + Intergenic
1024944387 7:54794204-54794226 TGGAGAATGAGGGGAGGGAGAGG + Intergenic
1029451110 7:100642165-100642187 TGGAGAAGGAGGGGCACAGGTGG + Intronic
1029714707 7:102319629-102319651 TGGGGTGTGTGGGGCAAGAGGGG - Intronic
1029900309 7:104032244-104032266 TGAAGTATGAGTGGCAAGGGCGG + Intergenic
1033602751 7:142900081-142900103 TGGAGGAGAAGGGGCAGGAGGGG - Intergenic
1034527961 7:151678089-151678111 TGGAGCAGGAGGGACACGGGTGG - Intronic
1035763602 8:2087557-2087579 TGGAAGATGAGGGGAATGAGGGG - Intronic
1036019382 8:4826708-4826730 TGGGGCATGAGGGTCACGAAAGG - Intronic
1036448741 8:8846325-8846347 AGGAGTAGGAGGGGGAGGAGGGG + Intronic
1040423093 8:47259325-47259347 TGCTGTGTGAGGGGCAAGAGTGG + Intergenic
1041015875 8:53592858-53592880 TGGGGGGTGAGGGGCAAGAGAGG - Intergenic
1041335609 8:56779252-56779274 AGGAATATGAGGGGTATGAGGGG + Intergenic
1043089672 8:75882383-75882405 TGGAGAATTAGGGGCAGTAGGGG + Intergenic
1044670086 8:94670991-94671013 TGGAGTATGAAGGTAATGAGGGG + Intronic
1045731839 8:105251421-105251443 TGAAGTATGAGGGGAATGTGGGG - Intronic
1045899380 8:107258080-107258102 TGAAGTATGAGGGAGAAGAGAGG - Intronic
1046915946 8:119678567-119678589 GGGAGAATGAGGGGTACAAGGGG - Intergenic
1048354986 8:133646032-133646054 AGGAGTGGGAGGGGCAGGAGTGG + Intergenic
1049478970 8:142811010-142811032 TGGAGGAGGAGTGGCCCGAGTGG - Intergenic
1049658717 8:143810241-143810263 TGGAGTATGGGGAGAACCAGTGG - Intronic
1050731907 9:8718365-8718387 TGGAGTGAGAGGGAAACGAGGGG - Intronic
1054725666 9:68647557-68647579 TGGAGGATGAGGGGTTGGAGAGG - Intergenic
1055032394 9:71783598-71783620 TGGATTTTGAGGGGAACAAGAGG + Intronic
1056342405 9:85650338-85650360 AGGAGGAGGAGGGGCAGGAGGGG - Intronic
1056714209 9:89014733-89014755 TGGAGAGGGAGGGGCAAGAGTGG - Intronic
1061636098 9:131909421-131909443 TGGACTCTGAGGGGCTCAAGGGG + Intronic
1061878272 9:133555771-133555793 TGGATTATGAGGAGAACGAGGGG + Exonic
1062066773 9:134532451-134532473 TGGAGGTTGAGGGGCAAAAGGGG + Intergenic
1062372518 9:136247385-136247407 CAGAGTAGGAGGGGCAGGAGGGG + Intergenic
1203780106 EBV:96267-96289 AGGAGCAGGAGGGGCAGGAGGGG + Intergenic
1203780153 EBV:96396-96418 AGGAGCAGGAGGGGCAGGAGGGG + Intergenic
1203780162 EBV:96420-96442 AGGAGCAGGAGGGGCAGGAGGGG + Intergenic
1203780171 EBV:96444-96466 AGGAGCAGGAGGGGCAGGAGGGG + Intergenic
1203780200 EBV:96522-96544 AGGAGCAGGAGGGGCAGGAGGGG + Intergenic
1203780209 EBV:96546-96568 AGGAGCAGGAGGGGCAGGAGGGG + Intergenic
1203780218 EBV:96570-96592 AGGAGCAGGAGGGGCAGGAGGGG + Intergenic
1185603703 X:1355267-1355289 TGGAGGAAGAGGAGCAGGAGGGG + Intronic
1186157496 X:6740763-6740785 TGTGGGATGAGGAGCACGAGAGG - Intergenic
1187426444 X:19181577-19181599 TGGAGTATGAAGGGCAACAGGGG + Intergenic
1189647475 X:43149120-43149142 TGGAGTATGAGGGGCAGCTTTGG + Intergenic
1192224473 X:69218689-69218711 TGGAGTAAGAGAGGCAAGAGAGG + Intergenic
1194510881 X:94792935-94792957 TGGAGTAGGAGTGGTAAGAGAGG - Intergenic
1195654755 X:107323939-107323961 TGGAGCACGAGAGGCAGGAGGGG + Intergenic