ID: 947384270

View in Genome Browser
Species Human (GRCh38)
Location 2:229575634-229575656
Sequence CTCCAACACCACCGCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947384267_947384270 -6 Left 947384267 2:229575617-229575639 CCATCTTTGATCACCTGCTCCAA 0: 1
1: 0
2: 5
3: 52
4: 301
Right 947384270 2:229575634-229575656 CTCCAACACCACCGCAGCCTGGG 0: 1
1: 0
2: 1
3: 21
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947384270 Original CRISPR CTCCAACACCACCGCAGCCT GGG Intronic
900428903 1:2592791-2592813 CTCCGGTACCCCCGCAGCCTGGG + Intronic
901196051 1:7440309-7440331 CTCCATCCTCACTGCAGCCTGGG + Intronic
902777836 1:18685933-18685955 CACCACCATCACCTCAGCCTGGG + Intronic
902810128 1:18883339-18883361 CTCCAGCTCCACCGCATACTTGG + Exonic
903767876 1:25746562-25746584 CTCCAATGCCAGCGCAGGCTTGG - Intronic
904236417 1:29120471-29120493 CTCCATCACCAGTGCCGCCTTGG + Exonic
904489619 1:30850319-30850341 CTCCTCCAGCACCGCAGGCTGGG + Intergenic
906324942 1:44839683-44839705 CACCCACACCACTGCTGCCTGGG - Intronic
906551286 1:46668302-46668324 CGCCACCACCACAGCAGCCATGG + Exonic
910963665 1:92786557-92786579 CTCCATCACCACCCTAGTCTAGG + Intronic
911205355 1:95086763-95086785 CACCAACACCTCCGCCTCCTGGG - Intergenic
911227255 1:95319653-95319675 TTCCCGCACCACCGCACCCTTGG + Intergenic
912153225 1:106883862-106883884 CTATGACACCACCTCAGCCTGGG + Intergenic
912357607 1:109068034-109068056 CTGCAACACCACTCCAGCCTGGG - Intronic
913994975 1:143644211-143644233 CTCCATCACCACCCTAGTCTAGG + Intergenic
913995940 1:143652082-143652104 CACGAACACCACCGCAGACAAGG + Intergenic
914345198 1:146793116-146793138 CTCCATCTCCAACACAGCCTGGG - Intergenic
914361186 1:146937810-146937832 CTCCATCACCACCCTAGTCTAGG - Intergenic
914376878 1:147079858-147079880 CACGAACACCACCGCAGACTAGG - Intergenic
914491401 1:148152813-148152835 CTCCATCACCACCCTAGTCTAGG + Intergenic
915849485 1:159306006-159306028 CTCCATCACCACCTCAGCAGAGG - Exonic
916096651 1:161357439-161357461 CGCCAACTGCACCCCAGCCTGGG - Intronic
923149042 1:231217696-231217718 CTCCACCATCACCACAGCCCAGG + Intronic
1063849850 10:10175484-10175506 CTCCACCAGCACTCCAGCCTAGG - Intergenic
1071580591 10:86766026-86766048 CCACAGCACCACTGCAGCCTGGG - Intronic
1073574794 10:104613260-104613282 CTCCATCACCACAGCTGGCTTGG - Intergenic
1075842286 10:125515357-125515379 CTCCAATATCCCCGTAGCCTTGG - Intergenic
1076112613 10:127872495-127872517 CTCCATCACCGCTGGAGCCTGGG + Intergenic
1076767719 10:132645777-132645799 CTCCACCGCCCCCACAGCCTGGG - Intronic
1076798905 10:132811658-132811680 CCCCAACTCCCCAGCAGCCTCGG - Intronic
1077330778 11:1982983-1983005 CGCCACCACCCCCCCAGCCTGGG - Intronic
1077444671 11:2585449-2585471 CCCCATCACCACAGCAGCCAAGG - Intronic
1077735041 11:4782269-4782291 ATCCAAGACCACCTCAGCCTGGG - Intronic
1078627495 11:12970922-12970944 CTCCAACCCCACCCCAGCCAAGG + Intergenic
1079112472 11:17612558-17612580 CTCCAAGACCAAGGCCGCCTAGG - Intronic
1080854226 11:36097860-36097882 TTCCAAAAGCACAGCAGCCTAGG + Intronic
1082000843 11:47393108-47393130 CCCCAACCCCACCTCTGCCTGGG - Intergenic
1083800115 11:65041651-65041673 CTCCAGCACCACAGCTGCCTCGG - Exonic
1084371881 11:68750601-68750623 CTCCGTCACCATCGCATCCTCGG + Exonic
1085494003 11:76950669-76950691 CTTCAAGACCAGCTCAGCCTGGG - Intronic
1087907167 11:103711686-103711708 CTAAAAAACCACTGCAGCCTTGG + Intergenic
1088197792 11:107294590-107294612 CTCCAACAGAACTGCAGCCGAGG + Intergenic
1088562815 11:111133021-111133043 TTCCCACACCACAGTAGCCTTGG - Intergenic
1088892188 11:114053671-114053693 CTCAAAGCCCACCACAGCCTTGG + Intergenic
1089658843 11:119972515-119972537 CTCCAGCACCACCCCAGGCAGGG - Intergenic
1089695485 11:120213565-120213587 CTCCAACTCCACCCCGTCCTAGG - Intronic
1202813758 11_KI270721v1_random:38162-38184 CGCCACCACCCCCCCAGCCTGGG - Intergenic
1091728963 12:2865726-2865748 CTCCACAACCACCGCCTCCTGGG + Intronic
1092605371 12:10112372-10112394 CACCACCACCTCCGCTGCCTCGG - Intergenic
1094441726 12:30485475-30485497 CTCCACCACCAAGGCACCCTGGG + Intergenic
1096052647 12:48624586-48624608 TTCCAGCACCACCACACCCTTGG + Intergenic
1097421784 12:59390025-59390047 AACCCACACCACCGGAGCCTAGG + Intergenic
1100820135 12:98422473-98422495 CTCCAACAGCATCGTAGACTGGG + Intergenic
1101148553 12:101864426-101864448 CGCCAACTGCACTGCAGCCTGGG - Intergenic
1101354741 12:103966216-103966238 CACCACCACCGCCGCAGCCAGGG - Intronic
1102007521 12:109597942-109597964 CTCCACCCCCACGCCAGCCTTGG + Exonic
1102453297 12:113056885-113056907 CTCCAGCACCGCCGCCTCCTGGG - Intronic
1102637182 12:114334694-114334716 CTACTGCACCACCCCAGCCTGGG - Intergenic
1105439442 13:20403147-20403169 ATCCAACACCTCCACAGCCCTGG + Intergenic
1106114253 13:26803360-26803382 CTCTATAACCACAGCAGCCTAGG + Intergenic
1106929140 13:34645039-34645061 CTAGAACACCACTTCAGCCTTGG - Intergenic
1110573354 13:77029236-77029258 TTCCCACACCACCCCAGCCTTGG + Intergenic
1114579433 14:23744152-23744174 CTCCAACAGAACTGCAGCCGAGG - Intergenic
1117426627 14:55605317-55605339 CTCCAACTGCACTCCAGCCTGGG - Intronic
1119776585 14:77252934-77252956 GTCCTACACCAACACAGCCTAGG - Intronic
1120801489 14:88693812-88693834 CTCCCACTGCACTGCAGCCTGGG - Intronic
1121851516 14:97225590-97225612 CTCCAGCCCCACCCCAGTCTAGG + Intergenic
1122463848 14:101917267-101917289 CACCAAAACAAACGCAGCCTGGG - Intronic
1122707622 14:103630915-103630937 CTCTAACCCTACTGCAGCCTTGG + Intronic
1123121464 14:105918868-105918890 CACCCCCACCACCTCAGCCTGGG + Intronic
1123404177 15:20010533-20010555 CACCCCCACCACCTCAGCCTGGG + Intergenic
1123513516 15:21017179-21017201 CACCCCCACCACCTCAGCCTGGG + Intergenic
1124370030 15:29099256-29099278 CCCCAAGACCACCACAGGCTGGG + Intronic
1125522788 15:40357502-40357524 CCCCCACCCCACCTCAGCCTGGG - Intergenic
1125720861 15:41844575-41844597 CTCCTACATCACCGGGGCCTCGG + Exonic
1125965641 15:43873745-43873767 CTCAAAGTCCACTGCAGCCTAGG - Exonic
1128324871 15:66717763-66717785 CCCCAGGACCACCGCAGCCCAGG - Intronic
1129828309 15:78650257-78650279 GGCCAGCACCACTGCAGCCTGGG - Intronic
1130255618 15:82324785-82324807 CTCCATCCCCACACCAGCCTTGG - Intergenic
1130599348 15:85265201-85265223 CTCCATCCCCACACCAGCCTTGG + Intergenic
1132712889 16:1277122-1277144 CTCCACCCACCCCGCAGCCTGGG + Intergenic
1132767149 16:1540141-1540163 CCCACACACCACCTCAGCCTGGG + Intronic
1132869401 16:2109056-2109078 CTCCAACAGCCCCGCGGCCACGG + Exonic
1132985917 16:2767590-2767612 CTCCAGAACCGCCGCAGCCTTGG + Exonic
1134314353 16:13104680-13104702 CTCCATCCCCACCCCAGCCCAGG - Intronic
1134718010 16:16366542-16366564 CTCCAACAGCCCCGCGGCCACGG - Intergenic
1134956741 16:18385617-18385639 CTCCAACAGCCCCGCGGCCACGG + Intergenic
1139544668 16:67644780-67644802 CTCGTCCACCTCCGCAGCCTGGG + Intergenic
1139988796 16:70922176-70922198 CTCCATCTCCAACACAGCCTGGG + Intronic
1140209148 16:72957600-72957622 ATCCAACACAACCGCCACCTGGG - Exonic
1143156981 17:4843856-4843878 CTCCAACAGCATGGCAGCCCAGG - Intronic
1144824584 17:18098615-18098637 CCCCAACACCACCACAGCTCTGG + Intronic
1145959834 17:28880951-28880973 CTCCAACCCCAAAGCAGCCTGGG + Intronic
1147386155 17:40083621-40083643 CCCCAACCCCTCAGCAGCCTGGG + Intronic
1148904362 17:50902520-50902542 CTGCAACTGCACCCCAGCCTGGG + Intergenic
1149366630 17:55951911-55951933 ATCTGACACCACCTCAGCCTGGG - Intergenic
1149616585 17:58006412-58006434 CTCCACCCCCGCCGCCGCCTCGG + Exonic
1150184899 17:63170085-63170107 CTCCAACTGCACTCCAGCCTGGG + Intronic
1151398274 17:73839220-73839242 CTCCACCCCTACCCCAGCCTCGG - Intergenic
1151398505 17:73840636-73840658 CTCCACCCCCACCCCAGCCTCGG - Intergenic
1151831565 17:76555275-76555297 CAGCAGCACCACTGCAGCCTGGG + Intergenic
1151940367 17:77288117-77288139 CTCCTACCCCACCCCGGCCTGGG + Intronic
1152930621 17:83107824-83107846 CAGCAACACCACTGCAGGCTCGG + Intergenic
1153403472 18:4707436-4707458 CTCCAACTGCACTCCAGCCTGGG + Intergenic
1155963110 18:32011820-32011842 CTCACACATCACTGCAGCCTTGG - Intergenic
1157985242 18:52430331-52430353 CTCCCTCACCACCGTTGCCTTGG - Intronic
1160440220 18:78883942-78883964 CACCAACCCCACTGCAGGCTTGG + Intergenic
1160710144 19:547643-547665 CTCCTTCCACACCGCAGCCTGGG + Intronic
1161039997 19:2105210-2105232 TCCCAACACCTCCCCAGCCTGGG - Intronic
1161801435 19:6418628-6418650 CGCCACCACCACAGCAGCCCAGG - Intronic
1162054302 19:8053440-8053462 CTCCAACCCCACCCCTGGCTCGG - Intronic
1163158527 19:15451844-15451866 CTCCAAGACCCCCGCGTCCTTGG + Exonic
1167070925 19:47221628-47221650 CTCCAGCCCCAGCCCAGCCTGGG - Exonic
1167300620 19:48675486-48675508 CGCCAGCACCCTCGCAGCCTCGG + Intergenic
1167668406 19:50836218-50836240 CTTCACCTCCACCGCGGCCTGGG + Intronic
1167840234 19:52110848-52110870 CTCCAGCTCCACCTCAGCCTTGG + Intergenic
1168501495 19:56897083-56897105 CTCCACCACCACCGCCTCCACGG - Intergenic
1168560051 19:57374803-57374825 ATCTAAGACCACCACAGCCTGGG + Intronic
925172369 2:1758160-1758182 GTCCAACACCACCTCAGGGTTGG + Intergenic
925245515 2:2379173-2379195 CTCTGAGACCACCTCAGCCTGGG - Intergenic
928604983 2:32937250-32937272 CACCACCACCACTCCAGCCTGGG - Intergenic
931469147 2:62520757-62520779 CTCCAACACACCCGCAGCTGAGG - Intergenic
931606924 2:64061836-64061858 CTCCCACTGCACCCCAGCCTGGG + Intergenic
934739189 2:96706911-96706933 GTCAAACAACACGGCAGCCTGGG + Exonic
934774776 2:96930163-96930185 CTCCAGCACTCCAGCAGCCTGGG + Intronic
938069365 2:128300360-128300382 CTCCCAAACCAGCGCCGCCTTGG + Intronic
940530765 2:154873579-154873601 CTCCAAAACCGCCGAGGCCTTGG + Intergenic
940853818 2:158714450-158714472 CTCTAACACCACCCCAGCCGAGG + Intergenic
941890829 2:170579694-170579716 CTGGAGCACCACCACAGCCTGGG + Intronic
943140552 2:183976336-183976358 CTCCAACACACCCGCAGCTGAGG + Intergenic
944498488 2:200333045-200333067 CTCAAACAACCCCCCAGCCTTGG - Intronic
944606691 2:201358267-201358289 CTGCCACTGCACCGCAGCCTGGG - Intergenic
946344074 2:219094149-219094171 CTCCATCACCACCCCAGCCATGG - Intronic
947384270 2:229575634-229575656 CTCCAACACCACCGCAGCCTGGG + Intronic
947582514 2:231330460-231330482 CTCCAACACCACCCCAGGAAGGG + Intronic
948083955 2:235230629-235230651 CTCCCACAACACCGGAGCCCTGG + Intergenic
948681452 2:239637902-239637924 CTCCAACACCTCTGCTTCCTTGG - Intergenic
1169416929 20:5425440-5425462 CTCCACCATCACCCCTGCCTAGG + Intergenic
1172429028 20:34875213-34875235 CACCACCACCACCACAACCTGGG - Intronic
1172606346 20:36216784-36216806 CTCCAGCCCCACCCCAGCCTGGG - Intronic
1174065623 20:47862831-47862853 TTCCAACACCACAGGAGCATGGG - Intergenic
1174127469 20:48317574-48317596 CTCCAACACCACCCCAGTCGGGG - Intergenic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1177593226 21:23201020-23201042 ATGCAACTCCACCCCAGCCTGGG + Intergenic
1180050172 21:45327474-45327496 CCGCAACTCCACCTCAGCCTCGG - Intergenic
1180131048 21:45827276-45827298 CTCCGACACCATCGCAGCGGGGG - Intronic
1180185455 21:46137011-46137033 GTCCAGCACCAGTGCAGCCTGGG + Exonic
1180820953 22:18827262-18827284 CTCCCATGCCACAGCAGCCTTGG - Intergenic
1181083041 22:20426553-20426575 CCCCAACACCCCTCCAGCCTTGG + Intronic
1181192024 22:21148783-21148805 CTCCCATGCCACAGCAGCCTTGG + Intergenic
1181207173 22:21261727-21261749 CTCCCATGCCACAGCAGCCTTGG - Intergenic
1181460978 22:23085792-23085814 CTGCAACACCATCGAACCCTAGG + Intronic
1183315674 22:37135700-37135722 CACCACCCCCACAGCAGCCTGGG + Intronic
1184357975 22:43995439-43995461 CTCCTACACAGCCGCAGCCGGGG - Intronic
1184388798 22:44191268-44191290 CCCCCACCCCACCCCAGCCTCGG + Intronic
1184449066 22:44572232-44572254 CTCCAGCACTGCCGCAGCCCAGG + Intergenic
1185220320 22:49626382-49626404 CCCCAACCCCACCCCACCCTGGG + Intronic
1203219747 22_KI270731v1_random:33689-33711 CTCCCATGCCACAGCAGCCTTGG + Intergenic
1203271080 22_KI270734v1_random:53138-53160 CTCCCATGCCACAGCAGCCTTGG - Intergenic
950040777 3:9917807-9917829 CTCCATGCCCACCTCAGCCTAGG + Intronic
950273553 3:11639409-11639431 CCCCAACATCACAACAGCCTCGG + Intronic
952764361 3:36942439-36942461 CTGCAACCCTACTGCAGCCTTGG - Intronic
952831055 3:37565340-37565362 CACTAACACCACCCCAGTCTAGG - Intronic
954625557 3:52020182-52020204 CTCCAGCCCCACTGCAGCCTGGG - Intergenic
955628842 3:60950521-60950543 CTCCATCTCCACTCCAGCCTGGG - Intronic
956054391 3:65283058-65283080 CTCTAACAGCACTGCAGCCATGG + Intergenic
958894337 3:99813445-99813467 CTCCAACAGCAGCACAGCCTGGG + Intergenic
959716809 3:109442692-109442714 CTCCAAGCCCAGCGCAGCATTGG - Intergenic
961364049 3:126388314-126388336 ATCCAGCCCCACCCCAGCCTTGG - Intergenic
961667501 3:128502872-128502894 CTCCACCATCATCCCAGCCTTGG - Intergenic
961760656 3:129164956-129164978 CTCCCACAGCACTCCAGCCTTGG + Intergenic
961942173 3:130649466-130649488 CTCCATCACCACGGCTGCCATGG + Exonic
963326769 3:143871716-143871738 CTCCTGCACCACCCCAGCTTAGG - Intergenic
963909911 3:150807983-150808005 CTCCCACTCCATGGCAGCCTGGG - Intergenic
964065655 3:152575578-152575600 ATCCAACACAACCACAGCATAGG + Intergenic
964624854 3:158748998-158749020 CTCCAACCCCAGCCCAGCCATGG - Intronic
966179599 3:177176270-177176292 CTGCAACACCTCCGCCCCCTGGG + Intronic
968625065 4:1623334-1623356 CCCCACCCCCACCGCAGCCCCGG + Intronic
969229313 4:5818746-5818768 CACCAGCACCACCCCAACCTTGG + Intronic
970053705 4:11947546-11947568 CTGTAACACCATCACAGCCTGGG - Intergenic
973650109 4:52990897-52990919 CTCCACCACCACCTCAGCCCAGG - Intronic
975689098 4:76948321-76948343 CTCCGACGCCCCCGCAGCCTTGG - Intergenic
975922446 4:79408239-79408261 CCCCAACACCGCCGTGGCCTGGG - Exonic
976176320 4:82356588-82356610 CTCCATAACCACCGTAACCTTGG + Exonic
980059677 4:128115695-128115717 CAGCAACAGCACCCCAGCCTGGG - Intronic
980991302 4:139740829-139740851 CTCCAGAACCGCCACAGCCTTGG + Intronic
981416271 4:144497681-144497703 CTCAACCACCACTGAAGCCTAGG + Intergenic
988371337 5:30371694-30371716 CTGCAACACCTCCGCTTCCTGGG - Intergenic
989173377 5:38495440-38495462 CTCCAGCAGCACTGCTGCCTGGG + Intronic
991059376 5:62356826-62356848 CTGCCACTCCACCTCAGCCTGGG - Intronic
994553953 5:101272810-101272832 CTTCCACTCCACCCCAGCCTGGG + Intergenic
996967465 5:129322465-129322487 CTCCATCCCCACCTCAGGCTTGG - Intergenic
998689012 5:144566542-144566564 TTCCAAAACAACCACAGCCTAGG - Intergenic
1000059141 5:157637733-157637755 CACCAACTTCACTGCAGCCTGGG - Intronic
1000245698 5:159446935-159446957 CTCCAACACCACCACAGCCAAGG + Intergenic
1000788137 5:165571286-165571308 ATCAGACACCACCTCAGCCTAGG + Intergenic
1001044317 5:168360177-168360199 CTCCATCAGGACTGCAGCCTAGG + Intronic
1002292483 5:178209416-178209438 CACCACCACCTCCGCTGCCTCGG - Exonic
1005484534 6:26286931-26286953 CTCCCACCCCACCCCACCCTTGG - Intergenic
1015205364 6:130631950-130631972 TTCCAACCACACCGCAGGCTTGG - Intergenic
1018478464 6:164166856-164166878 CTCCAGCACCACTGCACCCCCGG + Intergenic
1019091167 6:169535682-169535704 GTCCAAGACCACCCCAGCTTAGG + Intronic
1019545549 7:1573314-1573336 CTGGACCACCACCTCAGCCTAGG - Intergenic
1023529350 7:41136726-41136748 CACCAGCACCCCCGCCGCCTCGG - Intergenic
1024230070 7:47357044-47357066 CACCAACTACACTGCAGCCTGGG + Intronic
1024635946 7:51290654-51290676 TTCCCACACAACCTCAGCCTCGG + Intronic
1026775792 7:73230275-73230297 CTCCCACACCCCTACAGCCTCGG - Intergenic
1027016649 7:74783647-74783669 CTCCCACACCCCTACAGCCTCGG - Intronic
1027071379 7:75162289-75162311 CTCCCACACCCCTACAGCCTCGG + Intergenic
1027108334 7:75419326-75419348 GTCCAACACCAACAAAGCCTTGG + Exonic
1030191090 7:106810778-106810800 CTCCAACCCCACCCCACCCCTGG + Intergenic
1031008463 7:116499771-116499793 CTCCAGCCCCATCGCAGCCTTGG - Exonic
1032722759 7:134564305-134564327 CTCCAAAACCACTGAGGCCTAGG + Intronic
1033453160 7:141479390-141479412 CACCAACACCACCACCTCCTAGG - Exonic
1034271165 7:149804002-149804024 CTCCAACCCTCCGGCAGCCTGGG + Intergenic
1034940442 7:155226972-155226994 CTCAGACCCCACTGCAGCCTGGG + Intergenic
1034997444 7:155587113-155587135 CTCCAAGAACAGCGCTGCCTTGG - Intergenic
1037100155 8:15033602-15033624 CTCCAAGCCCACCACAGCATCGG + Intronic
1037585694 8:20274528-20274550 CTCCAACACGCCCACAGGCTCGG - Intronic
1037862375 8:22414817-22414839 CCCAAACACCACTGCAGACTTGG - Exonic
1041791965 8:61706360-61706382 CTGCCACAGCACTGCAGCCTGGG + Intronic
1042797863 8:72684324-72684346 CTTCTACAACACTGCAGCCTTGG - Intronic
1042850744 8:73213645-73213667 CTCCAGCCCCACTGCAGCCCAGG + Intergenic
1044604938 8:94040293-94040315 CTCCAATCTCACAGCAGCCTTGG + Intergenic
1048185276 8:132234838-132234860 CTCCATCACCACGGCTGCCCTGG + Intronic
1049565455 8:143335648-143335670 CTCTGGCAGCACCGCAGCCTTGG + Intronic
1052868075 9:33478096-33478118 CTACAACTGCACTGCAGCCTGGG - Intergenic
1053182113 9:35981596-35981618 TTCCAACAGCACCGCAGAATTGG - Intergenic
1056621850 9:88221349-88221371 CACCCCCACCCCCGCAGCCTGGG + Intergenic
1056963296 9:91145474-91145496 CCCCAACCCCACCCCAGCTTGGG - Intergenic
1059248855 9:112870413-112870435 CATCAACAGCACCACAGCCTTGG - Exonic
1059349895 9:113657037-113657059 CTGCAACAGCTCCCCAGCCTGGG - Intergenic
1060761065 9:126249258-126249280 CTCCACCTCCACCTCAGCCGAGG + Intergenic
1060933456 9:127503138-127503160 CTGCACCACCACCCGAGCCTGGG + Exonic
1061395439 9:130341219-130341241 CTGCAACACCACGCCATCCTTGG - Intronic
1061594737 9:131621578-131621600 CTCCACCACCTCCCCACCCTGGG - Intronic
1061743319 9:132722852-132722874 CATCACCACCACCGCAGGCTCGG - Intergenic
1061818342 9:133208990-133209012 CTCCACCACCACCCCAGGCTGGG + Intronic
1062155549 9:135046246-135046268 CCCCAGCCCCACAGCAGCCTGGG - Intergenic
1062228139 9:135465462-135465484 CACCACCACCACCGTGGCCTTGG - Intergenic
1062242109 9:135546368-135546390 CTCCACCACCACCCCAGGCTGGG - Intronic
1062261298 9:135664525-135664547 CTCGAACCTCACCCCAGCCTTGG - Intronic
1062493895 9:136822528-136822550 TTCCAGCACCTCCGCAGGCTGGG + Intronic
1187304098 X:18079414-18079436 TTCCAACCCCTCTGCAGCCTAGG - Intergenic
1187419624 X:19122762-19122784 CGCCCACCCCACCGCAGCCGGGG + Intergenic
1190119799 X:47650515-47650537 CACCACCTCCACCGCCGCCTCGG - Exonic
1192806506 X:74514475-74514497 CTCTGACACCACCTCAGCATGGG - Intronic
1192909064 X:75583956-75583978 CTCCAACACCACGAAATCCTTGG - Intergenic
1197520918 X:127495239-127495261 CCCCAGCACTACCGCACCCTAGG - Intergenic
1199772287 X:150982939-150982961 CTCCCACCGCACCGCGGCCTTGG - Intronic
1200073877 X:153541882-153541904 CCCCACCACCAGCGCAGCCACGG - Exonic
1200154574 X:153968699-153968721 GTCCACCACCACTGCTGCCTTGG - Intronic
1200158595 X:153992309-153992331 CTCCCTCACCACCGCTGTCTCGG + Intergenic
1201013367 Y:9573023-9573045 CTCCAACAGAACTGCAGCTTAGG - Intergenic
1201797453 Y:17913662-17913684 CTGCCATAGCACCGCAGCCTAGG - Intergenic
1201804100 Y:17992297-17992319 CTGCCATAGCACCGCAGCCTAGG + Intergenic