ID: 947388887

View in Genome Browser
Species Human (GRCh38)
Location 2:229620138-229620160
Sequence CTGTGGGTGTCGCGGAAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947388880_947388887 8 Left 947388880 2:229620107-229620129 CCAAAGCGACTCGGATGGGCACC 0: 1
1: 0
2: 0
3: 4
4: 39
Right 947388887 2:229620138-229620160 CTGTGGGTGTCGCGGAAGAACGG 0: 1
1: 0
2: 1
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947388887 Original CRISPR CTGTGGGTGTCGCGGAAGAA CGG Intronic
900607548 1:3530621-3530643 CTGTGGGGCTCCAGGAAGAACGG + Intronic
901396558 1:8986334-8986356 CTGTGGTTCTCACGGAGGAATGG + Intergenic
901405116 1:9040108-9040130 CTGGGGCTCTCGGGGAAGAAGGG + Exonic
905118957 1:35666992-35667014 CTTTGGGAGTGGAGGAAGAAGGG + Intergenic
905581336 1:39084468-39084490 CTGTGGGTGTGAGGGAGGAATGG + Intronic
909322241 1:74304309-74304331 ATGTGGGTGTTGCTGAAGATTGG - Intronic
912771767 1:112470776-112470798 GTGTGGGTGTGGGGGAGGAAGGG + Intronic
913720463 1:121587463-121587485 CTGTGGGTGTAGCCAAAGAAGGG - Intergenic
915722618 1:157995450-157995472 CTGTTGGTGTCGGGGAGGAAGGG + Intronic
916827092 1:168452902-168452924 CTGTGTATGTTGAGGAAGAAGGG - Intergenic
917081560 1:171261298-171261320 CTGTGTGTGTTGGGGAAGGAGGG - Intronic
924155660 1:241173900-241173922 CTGAGTGTGTCCTGGAAGAATGG - Intronic
924431741 1:244003259-244003281 CTGTGTGTGTGGCTGAAGAGAGG + Intergenic
924431957 1:244004854-244004876 CTGTGTGTGTAGCTGAAGAGAGG + Intergenic
1073718168 10:106133129-106133151 CTGTGGTTGTAGAGAAAGAATGG - Intergenic
1075654601 10:124152781-124152803 CTGTGGGTGTCGGGGACTCAGGG - Intergenic
1076342680 10:129760249-129760271 CTGTGTGTGTGGGGGCAGAAAGG + Intronic
1077082928 11:733316-733338 CTGTGTGTGTCGGGGAAGAATGG - Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079136849 11:17780266-17780288 CTGTGGGTGCTGCGGATGGAAGG - Intronic
1079138124 11:17787998-17788020 CTGTGGGGTTGGCCGAAGAAGGG - Intergenic
1083923317 11:65791932-65791954 CTGTGCGTGTGGCCGCAGAAGGG + Intronic
1084009598 11:66340209-66340231 CTCTGGGTCTCGGGGCAGAATGG - Exonic
1086213014 11:84343493-84343515 CTGGGGATGTAGCTGAAGAAAGG + Intronic
1088756648 11:112890564-112890586 CTGTGGATGTGGCAGAAAAACGG - Intergenic
1088812444 11:113400738-113400760 CTGTGGCTGTAGCTGAGGAAGGG + Intergenic
1091155460 11:133367762-133367784 TTGTGAGTGTGGTGGAAGAAGGG - Intronic
1091677247 12:2500333-2500355 TTGTGTGTGGCGCAGAAGAAAGG + Intronic
1092257541 12:6935822-6935844 CAGTGGGTGTCACAGAAGGATGG - Exonic
1092475780 12:8817944-8817966 CTCTGGGTGTCACAGAAGCAAGG - Intergenic
1095909255 12:47409180-47409202 CTGTTGGTGTCGGGGTGGAAGGG + Intergenic
1095970080 12:47895679-47895701 CTGTTGGTGTTGGGGAAGGACGG - Intronic
1101248873 12:102911703-102911725 CTGTGGGTGGGGAGGAAGATGGG - Intronic
1104814525 12:131638100-131638122 ATGTGGGAGTGGCGGAGGAAGGG + Intergenic
1105577973 13:21670617-21670639 CTGTGTGTGTGGCCGAAGAATGG + Intergenic
1107739658 13:43435837-43435859 CTGTGGTTGAGGCAGAAGAAAGG + Intronic
1112779286 13:102880447-102880469 CTTTGGGATTCTCGGAAGAAAGG + Intergenic
1116406945 14:44578490-44578512 CTGTGGGAGTCGGGGAGGAGGGG - Intergenic
1116996788 14:51333047-51333069 TTGTGGGTGTCGTGGATGCATGG - Intergenic
1117658184 14:57977889-57977911 CACTGGGTGTGGAGGAAGAAGGG + Intronic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1121113032 14:91325327-91325349 GTGTGTGTGTCTTGGAAGAAGGG - Intronic
1122278025 14:100605191-100605213 CTGTGGGTGTTGGGGAAGGGGGG + Intergenic
1125857694 15:42966233-42966255 TTGTGGGTCTCACTGAAGAATGG - Exonic
1128224061 15:65989440-65989462 CTGTGGGTGGGGTGGAAGATTGG - Intronic
1130113749 15:80988657-80988679 CTGTGTGTGTTACGGGAGAAGGG - Intronic
1138459978 16:57142413-57142435 GTGTGGGTGTATCGGAAGGAAGG + Intronic
1138828791 16:60353898-60353920 CTGTGAGTGTCTGGGATGAATGG + Intergenic
1138828803 16:60353959-60353981 CTGTGAGTGTCTGGGATGAATGG + Intergenic
1141030818 16:80586845-80586867 ATGTGGGTGTTGTTGAAGAAGGG + Intergenic
1141297609 16:82784419-82784441 CTGTGTGTGTACAGGAAGAAGGG + Intronic
1143993516 17:10987418-10987440 CTCTGTGTGTCTCTGAAGAAAGG - Intergenic
1146090066 17:29868340-29868362 CTGTGGGTGACCGAGAAGAAAGG - Intronic
1147403293 17:40193601-40193623 GTGTGTGTGTAGAGGAAGAAGGG + Intronic
1149696245 17:58618471-58618493 CTGAAGGTGTCTTGGAAGAAGGG + Intronic
1152769409 17:82158029-82158051 CTGTGAGTGCCGGGAAAGAACGG + Intronic
1157095466 18:44682240-44682262 ATGTGTGTGTCGTGGGAGAAAGG + Intronic
1160130147 18:76218275-76218297 CTGTGAGTGTGGGGGATGAAGGG - Intergenic
1165478475 19:36046654-36046676 GTGTTTGTGTCCCGGAAGAATGG - Intronic
1166147616 19:40848380-40848402 CTGCGGGTATGGCGGGAGAAGGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166178409 19:41090381-41090403 CTGCAGGTGTGGCGGGAGAAGGG - Intronic
929083625 2:38146749-38146771 CTGCGGGGGTGGCGGGAGAAGGG - Intergenic
929456332 2:42068808-42068830 CTGTGGTTGTGGAGAAAGAAGGG + Intergenic
929828768 2:45330817-45330839 CTGTGTGTGTTGGGGAGGAAAGG - Intergenic
934562702 2:95321145-95321167 CTGGGGGTGCCGGGGAGGAAAGG - Intronic
935225059 2:101046149-101046171 CTGGGGGGGTCACAGAAGAAAGG - Intronic
939957606 2:148539954-148539976 CTGTGGTTGACTCTGAAGAAAGG + Intergenic
942119954 2:172766686-172766708 CTGTTGGTGTTGATGAAGAAAGG - Intronic
947388887 2:229620138-229620160 CTGTGGGTGTCGCGGAAGAACGG + Intronic
1169123481 20:3111073-3111095 CTGAAGGAGTTGCGGAAGAAGGG - Intronic
1173590090 20:44217939-44217961 CTGTGGCTTTCTCGGAGGAAGGG - Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174421986 20:50405285-50405307 CTGTAGGGGTGGCGGGAGAAGGG - Intergenic
1176216164 20:63948916-63948938 CTGTGGGTGTCACGGGTGCACGG - Intronic
1180928923 22:19575880-19575902 CTGGGGGTGACACGGAAGAAGGG - Intergenic
1182287317 22:29256033-29256055 CTGTGGCTGGCCCTGAAGAAAGG + Intronic
951750082 3:26025342-26025364 CTGTGGCTGTCGTGGAGGATGGG + Intergenic
953025269 3:39141525-39141547 GTGTGGGTGTGTAGGAAGAAGGG + Intergenic
961673074 3:128548944-128548966 CTGTGGGTGTCAAGGAAGGAGGG - Intergenic
964480352 3:157133080-157133102 CTTTGTGTGTGGTGGAAGAAGGG - Intergenic
965147555 3:164926144-164926166 CTATGGGTGTCACTGAAGATGGG + Intergenic
965762308 3:172092678-172092700 CTGTGGGTGTCCTGGAAAAGAGG + Intronic
967214949 3:187201866-187201888 CTGTGGGTGCAGCGGAATATAGG + Intergenic
968880294 4:3295067-3295089 ATGAGGGTCTCGGGGAAGAAGGG + Intronic
971245622 4:24924962-24924984 CTTTGGGTGTCTTCGAAGAAAGG - Intronic
971586014 4:28406850-28406872 TTGTGAGTGGCGCGGAAGATGGG + Intergenic
973652766 4:53013161-53013183 CTGTAGGTGTAAAGGAAGAATGG - Intronic
974683554 4:65195259-65195281 CTGAGGGTGCTGAGGAAGAAGGG + Intergenic
981296563 4:143140061-143140083 CTGTGGGTGTCTAGCAAGATGGG + Intergenic
982295331 4:153822123-153822145 CAGTGGGTGTAGAGGAAGACAGG + Intergenic
983903492 4:173161685-173161707 ATTTGGGTGTTGGGGAAGAAGGG - Intergenic
992811920 5:80397192-80397214 GTGTGAGTGACGCAGAAGAAGGG - Intergenic
996631724 5:125640831-125640853 TTATTGGTGTCTCGGAAGAAGGG + Intergenic
998547027 5:143038001-143038023 TTGTGGCTGTCTCTGAAGAAGGG - Intronic
999342382 5:150783292-150783314 CTGAGGTTGTCAAGGAAGAATGG - Intronic
1002413215 5:179101119-179101141 GCGTGGGTGACGCAGAAGAAGGG + Intergenic
1003081168 6:3023000-3023022 CTGGGGGCGTTGAGGAAGAAGGG - Intergenic
1006837303 6:37006789-37006811 CTGTGGGTGTGAGGGAAGCAGGG + Intronic
1007187099 6:39981199-39981221 CAGTGGGTGGCGGGGAAGAGGGG + Intergenic
1007309314 6:40932940-40932962 CTGTTTGTGTGGCGGAAGCATGG + Intergenic
1011625742 6:89282190-89282212 CTGTGGGTGTGGTGGAGGAGGGG - Intronic
1017798267 6:157867414-157867436 CTGTGGCTGTTTTGGAAGAAAGG - Intronic
1018576313 6:165263621-165263643 CTGAGGGTGTGGTGGAAGAAGGG + Intergenic
1026118085 7:67513207-67513229 CTGTGGGCTTCCCGGAAGCAGGG - Intergenic
1037980486 8:23249944-23249966 CTGAGGGTGTTGCTGAGGAAGGG - Intronic
1038277638 8:26135075-26135097 TTGAGGGTGTGGCAGAAGAAGGG - Intergenic
1040576004 8:48652157-48652179 CCGTGGGCGTCCCGGTAGAAAGG - Intergenic
1043286554 8:78538893-78538915 GTGTGGGTGTCTTGGCAGAAAGG + Intronic
1045860145 8:106807185-106807207 CTGTGGGTGTTGCTAAATAATGG + Intergenic
1049180702 8:141220645-141220667 CCGTGGGAGGCGCGGGAGAAGGG + Intronic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049865492 8:144932900-144932922 GTGTGGGTGTCGAGGAAGAGGGG - Intronic
1050592117 9:7171737-7171759 CTGTGGCTGTCTCGGAACACAGG + Intergenic
1057208747 9:93188161-93188183 CTGCGGGAGTAGGGGAAGAAAGG - Intronic
1057758376 9:97854176-97854198 TTGGGGTTGTCGCGGTAGAAGGG - Exonic
1062572498 9:137192056-137192078 CTGTGGGAGTCCCGGAAGCTGGG - Exonic
1062636494 9:137494294-137494316 ATGTGGGTGTGGCAGAGGAAAGG - Intronic
1203397793 Un_KI270519v1:43919-43941 GTGTGAGTGACGCGGAAGATGGG + Intergenic
1186481754 X:9901520-9901542 CTGTGGGTGGCACAGAAGAGGGG + Intronic
1186529220 X:10278513-10278535 TTGTGGGTGGCGGGGGAGAAAGG + Intergenic
1186844797 X:13520009-13520031 CTGTGTGTGTCTCGGCATAAAGG + Intergenic
1188481359 X:30639970-30639992 CTGTGGGTTTACCGGAATAAGGG - Intergenic
1196617889 X:117788394-117788416 CTGTGGGAGTTGCTCAAGAAAGG - Intergenic