ID: 947392759

View in Genome Browser
Species Human (GRCh38)
Location 2:229655986-229656008
Sequence GACACTCTAGGGTCTAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947392759_947392772 21 Left 947392759 2:229655986-229656008 CCTCCTCTAGACCCTAGAGTGTC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 947392772 2:229656030-229656052 CACACCTTGATGCCTGACTATGG 0: 1
1: 0
2: 0
3: 5
4: 92
947392759_947392765 -9 Left 947392759 2:229655986-229656008 CCTCCTCTAGACCCTAGAGTGTC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 947392765 2:229656000-229656022 TAGAGTGTCTGGAGGAAGCCTGG 0: 1
1: 0
2: 3
3: 35
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947392759 Original CRISPR GACACTCTAGGGTCTAGAGG AGG (reversed) Intronic
900501536 1:3007852-3007874 ACCACTCTAGGGTCTGGAAGAGG - Intergenic
900820814 1:4886524-4886546 CACACTCTGGGGTCTATCGGAGG - Intergenic
904922148 1:34016314-34016336 CACACTCTAGGGCCTATTGGGGG - Intronic
905332332 1:37213819-37213841 CACACTCTGGGGTCTGGTGGGGG + Intergenic
906199131 1:43947891-43947913 GATACTCTAGGGTCTTGGGATGG + Intronic
906480620 1:46197119-46197141 GACCCTCTAGGATCTGAAGGAGG - Intronic
913105729 1:115612554-115612576 GACTCTTTAGAGTCTAGAGGTGG - Intergenic
918138527 1:181700114-181700136 GGCACTCCAATGTCTAGAGGAGG + Intronic
919791012 1:201290998-201291020 GACACCCCAGGGTCAAGAGAGGG + Intronic
920558948 1:206925263-206925285 CACCCTCTAGGGTCCAGAAGGGG + Intergenic
921183959 1:212654430-212654452 GACACTGAAGGTTCTTGAGGAGG + Intergenic
924275410 1:242381373-242381395 CACACACTAGGGCCTATAGGTGG + Intronic
1073404044 10:103281328-103281350 GACACTCTAAGGTCAATTGGGGG + Intronic
1081982651 11:47278296-47278318 GGCATTGTAGAGTCTAGAGGAGG + Intronic
1084950989 11:72665376-72665398 GACACTCTGGGGTGGAGTGGGGG - Intronic
1086576403 11:88343033-88343055 GACTCTCCAGAGTCTAGAGGTGG + Intergenic
1089065793 11:115660843-115660865 GTCACTCTAGGGAGGAGAGGAGG + Intergenic
1091186405 11:133651548-133651570 GACACTGGAGGCTATAGAGGGGG - Intergenic
1096240983 12:49960289-49960311 GGCTCTCTAGGGCTTAGAGGGGG - Intergenic
1097092022 12:56514087-56514109 GACAATCTAGGAGCAAGAGGTGG + Intergenic
1097716556 12:62972313-62972335 GACACTCTTGGTTCAATAGGGGG + Intergenic
1098397217 12:70032032-70032054 TAGGCTCTAGGCTCTAGAGGAGG - Intergenic
1100070008 12:90703845-90703867 GACAGTCTAGGGTCCAGTTGTGG + Intergenic
1102195147 12:111020170-111020192 TACACTCTAGGGGCAGGAGGTGG - Intergenic
1103081726 12:118029304-118029326 GTTACTCAAGGGTCTTGAGGTGG + Intronic
1103260144 12:119580457-119580479 CACACACTGGGGCCTAGAGGTGG + Intergenic
1104606610 12:130194104-130194126 GACTCTCTAGGGTTTGGAGGGGG - Intergenic
1104991197 12:132624729-132624751 GCCACTCCAGGGTCTCCAGGAGG + Exonic
1110924376 13:81131863-81131885 ATCATTCTAGGGTCTGGAGGAGG - Intergenic
1112386536 13:98945477-98945499 GACACTAGAGGGCCCAGAGGAGG - Intronic
1115617854 14:35113359-35113381 GACCATCTAAGATCTAGAGGTGG + Intronic
1119423285 14:74520896-74520918 GACACTGTAGGATCCAGATGAGG - Intronic
1129903321 15:79168517-79168539 GACAGTCCAGAGTCAAGAGGAGG + Intergenic
1134264539 16:12681902-12681924 TACTCTCCAGGGGCTAGAGGTGG + Intronic
1138766831 16:59615030-59615052 GACACTAGAGGGTGTAGGGGAGG + Intergenic
1149515494 17:57277949-57277971 TACACTCTAGGAGGTAGAGGTGG + Intronic
1158332344 18:56376380-56376402 GACACCATAGGGCCTAGAAGAGG + Intergenic
1158724507 18:59957715-59957737 GACTATCTAGGGTTTAGGGGAGG - Intergenic
1159489902 18:69118712-69118734 CACACTCCAGGGACTACAGGAGG - Intergenic
1165049566 19:33132721-33132743 GAGACTCCAAGGTCTAGATGGGG - Intronic
1165293973 19:34911212-34911234 GACACTCGAGAGGCTAGAGCAGG + Intergenic
925201116 2:1968419-1968441 GAAACTCTAGGGAGGAGAGGAGG - Intronic
925822243 2:7811219-7811241 GACAATCTAGGGTTCAGAGCTGG + Intergenic
935897603 2:107754370-107754392 TATCCTCTAAGGTCTAGAGGTGG + Intergenic
947392759 2:229655986-229656008 GACACTCTAGGGTCTAGAGGAGG - Intronic
1169747766 20:8960500-8960522 GATTCTCCAGGGTCAAGAGGTGG - Intronic
1171891290 20:30719159-30719181 GACATTCTAGGTTTGAGAGGAGG + Intergenic
1181672679 22:24433024-24433046 GAAACTATAGGGTCTTCAGGGGG + Intronic
1184688981 22:46108927-46108949 GATGCTCTAGGGCCCAGAGGAGG - Intronic
1184838439 22:47038018-47038040 GACACTCAAGGGAAGAGAGGTGG - Intronic
950248665 3:11445508-11445530 CACACACTAGGGTCTGGTGGAGG + Intronic
950331793 3:12161734-12161756 GACACTCATGGCTTTAGAGGTGG - Intronic
950660798 3:14465835-14465857 GACATTCCAGGGCGTAGAGGTGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
959772323 3:110113526-110113548 GACCCTAAAGGGTCTACAGGGGG + Intergenic
960344503 3:116515885-116515907 GACAGTCCAGGATCTAGATGAGG + Intronic
961618239 3:128200867-128200889 GACACTGTAGGGTCAAGTGGAGG + Intronic
966301321 3:178482662-178482684 TACACTCATGGTTCTAGAGGTGG - Intronic
969688090 4:8688125-8688147 GACACTCTACAATCCAGAGGCGG - Intergenic
970607270 4:17692348-17692370 GATATTTCAGGGTCTAGAGGTGG - Intronic
970925101 4:21442691-21442713 GACACTCAAGTGTTGAGAGGCGG - Intronic
976141627 4:81999268-81999290 GAGACTCTGGGGTCTCAAGGAGG - Intronic
978387105 4:108187164-108187186 GACACGCTAGAGTCAAGATGCGG + Intergenic
981894568 4:149782940-149782962 AACACTCTAATGTTTAGAGGTGG - Intergenic
990231916 5:53721951-53721973 GACACACTAGGGTCTGTTGGGGG + Intergenic
991458129 5:66826651-66826673 GAAAAACTAGGGTCTAGAGGAGG - Intronic
993208839 5:84921628-84921650 ACCATTCTAGGGTCTGGAGGAGG - Intergenic
1002417368 5:179127491-179127513 GACTCTCTGGGGTCCAGAGTGGG + Intronic
1004707782 6:18140779-18140801 GACACTCTAGGGTGTGGACTGGG + Intronic
1004739805 6:18447846-18447868 GACACTATAGGTTTTAGAAGAGG + Intronic
1015445886 6:133304327-133304349 GATTCTCTGGAGTCTAGAGGAGG + Intronic
1019346850 7:535295-535317 GACCCTCCAGGGTGAAGAGGAGG - Intergenic
1019413312 7:916043-916065 GCCACTCCAGGGGCCAGAGGCGG + Intronic
1019928147 7:4206553-4206575 GTCACTGGAGGGTCTAGAGATGG + Intronic
1020264234 7:6549731-6549753 GATACTCAAGGGTGTTGAGGTGG - Intronic
1021379123 7:19945511-19945533 GACAGTCTAGAATTTAGAGGGGG - Intergenic
1022356543 7:29620443-29620465 GGCACTCCTGGGGCTAGAGGGGG - Intergenic
1024580481 7:50796726-50796748 GCCACCCTGGAGTCTAGAGGTGG + Intergenic
1028221396 7:88201246-88201268 GATGCTCTAGGGAGTAGAGGTGG + Intronic
1031180013 7:118402179-118402201 CACACTCTGGGGCCTACAGGAGG - Intergenic
1034089979 7:148354775-148354797 GCCATTCTAGGGGCTTGAGGTGG - Intronic
1035631695 8:1111566-1111588 CACACTCTGGGGTCTATCGGAGG - Intergenic
1039752283 8:40489586-40489608 TACCCTCAAGGGTCTATAGGAGG - Intergenic
1048259325 8:132932263-132932285 GACATTCTTGGGTGCAGAGGTGG - Intronic
1050558575 9:6810461-6810483 GACATTCTGGGGTTTAGAGATGG + Intronic
1054357551 9:64076649-64076671 GACATTCTAGGTTTGAGAGGAGG - Intergenic
1056042808 9:82685637-82685659 ACCATTCTGGGGTCTAGAGGAGG + Intergenic
1058065610 9:100545103-100545125 GTCATTCTGGGGTCTGGAGGTGG + Intronic
1058314175 9:103543789-103543811 GCCACTCTTGGGGGTAGAGGGGG - Intergenic
1059161070 9:112035497-112035519 GAAACCCAAGGGTCAAGAGGTGG + Intergenic
1061012191 9:127962266-127962288 GACACTCCAGTGGCCAGAGGTGG - Intronic
1061094961 9:128451161-128451183 GACACTCTAGAGACGAGTGGAGG + Intergenic
1061825650 9:133256740-133256762 GAAGCTCTAGGGTGCAGAGGCGG - Intronic
1203560902 Un_KI270744v1:56854-56876 GACATTCTAGGTTTGAGAGGAGG + Intergenic
1187894383 X:23966794-23966816 GCCATTCTGGGGTCTGGAGGAGG + Intergenic
1197392411 X:125883739-125883761 ACCATTCTAGGGTCTGGAGGAGG - Intergenic