ID: 947396895

View in Genome Browser
Species Human (GRCh38)
Location 2:229695473-229695495
Sequence TCTGGGCATTAATGCTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 122}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947396891_947396895 6 Left 947396891 2:229695444-229695466 CCACAGGATGGTCTTCAGTGTTT 0: 1
1: 0
2: 1
3: 22
4: 254
Right 947396895 2:229695473-229695495 TCTGGGCATTAATGCTCTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 122
947396890_947396895 7 Left 947396890 2:229695443-229695465 CCCACAGGATGGTCTTCAGTGTT 0: 1
1: 0
2: 1
3: 12
4: 197
Right 947396895 2:229695473-229695495 TCTGGGCATTAATGCTCTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 122
947396889_947396895 8 Left 947396889 2:229695442-229695464 CCCCACAGGATGGTCTTCAGTGT 0: 1
1: 0
2: 0
3: 11
4: 166
Right 947396895 2:229695473-229695495 TCTGGGCATTAATGCTCTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 122
947396880_947396895 23 Left 947396880 2:229695427-229695449 CCCCACCCATGCCTCCCCCACAG 0: 1
1: 0
2: 11
3: 103
4: 961
Right 947396895 2:229695473-229695495 TCTGGGCATTAATGCTCTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 122
947396881_947396895 22 Left 947396881 2:229695428-229695450 CCCACCCATGCCTCCCCCACAGG 0: 1
1: 0
2: 3
3: 56
4: 490
Right 947396895 2:229695473-229695495 TCTGGGCATTAATGCTCTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 122
947396886_947396895 17 Left 947396886 2:229695433-229695455 CCATGCCTCCCCCACAGGATGGT 0: 1
1: 0
2: 4
3: 32
4: 268
Right 947396895 2:229695473-229695495 TCTGGGCATTAATGCTCTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 122
947396884_947396895 18 Left 947396884 2:229695432-229695454 CCCATGCCTCCCCCACAGGATGG 0: 1
1: 0
2: 1
3: 12
4: 235
Right 947396895 2:229695473-229695495 TCTGGGCATTAATGCTCTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 122
947396883_947396895 21 Left 947396883 2:229695429-229695451 CCACCCATGCCTCCCCCACAGGA 0: 1
1: 1
2: 9
3: 47
4: 443
Right 947396895 2:229695473-229695495 TCTGGGCATTAATGCTCTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 122
947396887_947396895 12 Left 947396887 2:229695438-229695460 CCTCCCCCACAGGATGGTCTTCA 0: 1
1: 0
2: 2
3: 19
4: 219
Right 947396895 2:229695473-229695495 TCTGGGCATTAATGCTCTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 122
947396888_947396895 9 Left 947396888 2:229695441-229695463 CCCCCACAGGATGGTCTTCAGTG 0: 1
1: 0
2: 2
3: 16
4: 236
Right 947396895 2:229695473-229695495 TCTGGGCATTAATGCTCTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947396895 Original CRISPR TCTGGGCATTAATGCTCTGG TGG Intronic
907163722 1:52391528-52391550 TCTGGGTATTAGTCCTCTGTTGG - Intronic
907471141 1:54674231-54674253 CCTTGGCATTAAGGCACTGGTGG + Intronic
907500323 1:54875033-54875055 TCTGGGCATTAAGGATCCTGAGG - Intronic
907982247 1:59495220-59495242 TCTGGGTATTAATCCTTTGTTGG + Intronic
909214346 1:72867226-72867248 TTTGGGAATTAATTCTCTGAGGG - Intergenic
914912797 1:151800951-151800973 TCTGGGGATAAAAACTCTGGGGG - Exonic
917160077 1:172047394-172047416 TCTGGGCTTTAAAGCACAGGTGG + Intronic
924508801 1:244711476-244711498 TCTGGGGATGAATGGCCTGGGGG - Intergenic
1068856247 10:61800251-61800273 TCTAGGCATGAATGGTTTGGGGG + Intergenic
1071898817 10:90095752-90095774 TCTGTTCAGTAATGCTCAGGAGG - Intergenic
1088589435 11:111390658-111390680 AGTGGGCACTAAGGCTCTGGTGG + Intronic
1089708396 11:120297545-120297567 TCTGGGCACCACTGATCTGGAGG - Intronic
1091079899 11:132656639-132656661 GCTGGTCATGCATGCTCTGGAGG - Intronic
1092001638 12:5037535-5037557 TCTAAGTATTAAAGCTCTGGTGG - Intergenic
1093697724 12:22181078-22181100 TCTGAGCCTTAATGACCTGGGGG + Intronic
1095550650 12:43434910-43434932 TCTGGGAAATGATGTTCTGGAGG - Intronic
1097652054 12:62311107-62311129 TCTGGATATTAATCCTCTGTTGG + Intronic
1099630165 12:85132450-85132472 TCTGGGTATTTATGCTCTCTTGG - Intronic
1102653863 12:114463436-114463458 TCTTGGCATATGTGCTCTGGGGG + Intergenic
1108416234 13:50200592-50200614 TCTGGGCCTTAATGCTTGGAAGG + Intronic
1110838635 13:80114766-80114788 TCTGGGTATTAATTCCCTGTTGG + Intergenic
1111565958 13:90016371-90016393 TGTGTGCATTAATGCTATGTTGG + Intergenic
1112764541 13:102726817-102726839 TCTGGATATTAATCCTCTGTTGG - Intergenic
1113011699 13:105774930-105774952 TCTGTGGATTAATGCACTGGCGG - Intergenic
1119405756 14:74398137-74398159 GCTTGGCATTGAGGCTCTGGGGG - Intergenic
1122893898 14:104745848-104745870 TCTGGGAGTTGATGCTCTTGGGG + Intronic
1122903017 14:104789663-104789685 TCTGGCCATTGGTGGTCTGGTGG - Intronic
1123505464 15:20938989-20939011 TCTGGATATTAATCCTCTGCTGG + Intergenic
1123562701 15:21512698-21512720 TCTGGATATTAATCCTCTGCTGG + Intergenic
1123598945 15:21949981-21950003 TCTGGATATTAATCCTCTGCTGG + Intergenic
1125341035 15:38675359-38675381 GCTGGGCATTGATGCTATTGTGG + Intergenic
1126663073 15:51051496-51051518 TCTGGGCATTTCTGCACTGTAGG - Intergenic
1126705826 15:51403950-51403972 TCTGGGCATTAGTGAAGTGGGGG + Intronic
1128323414 15:66707656-66707678 TCTGGGCAATTAGGCTCAGGCGG + Intronic
1129293841 15:74588619-74588641 CCTCGGGATTAATGATCTGGAGG - Intronic
1131185802 15:90273015-90273037 TCTGCTCATTAGTGCTCTGGTGG + Exonic
1131734870 15:95321351-95321373 TCTTGGCATTAATCCCCTGTTGG + Intergenic
1202971053 15_KI270727v1_random:239831-239853 TCTGGATATTAATCCTCTGCTGG + Intergenic
1133285375 16:4688286-4688308 TCTGGGCATTGGGGCTCTGTGGG + Intronic
1133520460 16:6550970-6550992 TGTGGGCATTAATAGTTTGGAGG + Intronic
1133885204 16:9821040-9821062 TCTGGGCTTTGATGCTTTAGAGG + Intronic
1136153555 16:28367726-28367748 TCTGGGTATTAATCCTTTGATGG - Intergenic
1136209531 16:28747541-28747563 TCTGGGTATTAATCCTTTGATGG + Intergenic
1138906449 16:61340806-61340828 TATGGGCATAAGTGCTCTGGTGG + Intergenic
1141873465 16:86805689-86805711 CCTGGACATTTATGCTCTAGGGG + Intergenic
1141961958 16:87414691-87414713 TCCTTGCCTTAATGCTCTGGGGG - Intronic
1143399011 17:6628832-6628854 TCTTAGCACTAATGATCTGGTGG - Intronic
1146238739 17:31193615-31193637 TCTGGATATTAATCCTCTGCTGG - Intronic
1146272387 17:31492849-31492871 TCTTGTCATCAATGCTCTTGAGG - Intronic
1149172173 17:53824008-53824030 TAAGGGCATTTATGCTCTGGTGG + Exonic
1151015820 17:70551550-70551572 TCAGCACATCAATGCTCTGGAGG - Intergenic
1152988671 18:342700-342722 GCTGGGCATTGCTGGTCTGGAGG + Intronic
1154293605 18:13131324-13131346 TCTGGGCACCAAGGCTTTGGGGG - Intergenic
1154361135 18:13662057-13662079 TCTGGACTTGAATGGTCTGGGGG - Intergenic
1155095299 18:22549643-22549665 TGTGGGCACAAAGGCTCTGGAGG - Intergenic
1158102924 18:53851067-53851089 TCTGGGGATTAAGACTCTGTGGG - Intergenic
1160759418 19:775463-775485 TCTGGGCATTAAATATTTGGGGG + Intergenic
1164894486 19:31860385-31860407 TCTGGGTATTAGTCCCCTGGAGG + Intergenic
928632646 2:33209559-33209581 TCAGTGAATTAATGCTGTGGAGG - Intronic
928731081 2:34233677-34233699 TTTGGGAATGAAGGCTCTGGAGG - Intergenic
929443934 2:41988363-41988385 TCTGGCCATTAACGCTCACGGGG + Intergenic
936151727 2:110025525-110025547 TCTGGCCACTACTGCCCTGGAGG - Intergenic
936192947 2:110345844-110345866 TCTGGCCACTACTGCCCTGGAGG + Intergenic
944138888 2:196433321-196433343 TCTGGGCGGCAAGGCTCTGGAGG + Exonic
947396895 2:229695473-229695495 TCTGGGCATTAATGCTCTGGTGG + Intronic
1169157784 20:3348188-3348210 TCTTGGCATTCATTATCTGGAGG + Intronic
1169332802 20:4729980-4730002 TCGGGGCTTTAGTGCTCTGGGGG - Intergenic
1170796086 20:19547964-19547986 TCTGGGCATTTTTGATCTGGGGG - Intronic
1170927540 20:20739420-20739442 TCTGGGCATTAGTCCTTTGTTGG - Intergenic
1174659097 20:52195038-52195060 TCTGGGCCTTACTGGTTTGGTGG + Intronic
1175774877 20:61646730-61646752 TCTTGGCCTTAATGAACTGGAGG - Intronic
1176128056 20:63484810-63484832 TCTGAGCATTACTGTCCTGGAGG + Intergenic
1179440285 21:41388576-41388598 CCTGGGCTGTAAGGCTCTGGGGG + Intronic
1182814115 22:33143458-33143480 TCTGGGCATTGAAGCTCTTTTGG - Intergenic
1183106026 22:35615696-35615718 TCTGGGCCTTATTTCTCTGCTGG - Intronic
1183339240 22:37269896-37269918 TCTGGACATTAATTCTTTGTTGG - Intergenic
1184321240 22:43743748-43743770 TCTGGGCAATGGTGCTGTGGAGG - Intronic
1184636258 22:45834411-45834433 TCTGGGCAGTGAAGCTCTGCCGG + Intronic
953814878 3:46147070-46147092 TCTGGGGACTACTGCTCTGCTGG - Intergenic
955257008 3:57342706-57342728 TCTGGATATTAATTCTTTGGTGG - Intronic
955783185 3:62507926-62507948 TCTTTGCAATAATTCTCTGGGGG + Intronic
956796110 3:72720121-72720143 GCTGAGCATTAATTCTCTGGGGG + Intergenic
960527543 3:118727045-118727067 TCTGGGCATGAACACTTTGGTGG - Intergenic
961480721 3:127178043-127178065 TCTTGGAATCAATGCTATGGGGG - Intergenic
966338839 3:178902625-178902647 TCTGGGCAGTAAGCCTGTGGAGG - Intergenic
969105383 4:4803550-4803572 TCTGGGCAGCAATGCCCAGGAGG - Intergenic
970031984 4:11686254-11686276 TCTGTGAATTGATCCTCTGGGGG - Intergenic
971884261 4:32423442-32423464 TCTGGTCATTCAGACTCTGGTGG + Intergenic
975301288 4:72794377-72794399 TCTGGGTATTAGTCCTCTGTTGG - Intergenic
975779791 4:77826020-77826042 TCTGGGCTCTACTGCTATGGTGG - Intergenic
976116817 4:81736658-81736680 TCTGGGCATTCAGGCACTGATGG - Intronic
977229649 4:94436785-94436807 TCTGGGTATTAGTCCTCTGTTGG - Intergenic
978698283 4:111610242-111610264 TCTGAGCATTAATGCTGTCTTGG + Intergenic
981062015 4:140435197-140435219 TATGGGCATTAATGTTTTGGTGG + Intergenic
985291161 4:188389514-188389536 TCTTGGCTTTGATGCTTTGGTGG + Intergenic
986079972 5:4380450-4380472 TCTGGGGATTAATGATCAGCTGG - Intergenic
987081398 5:14428299-14428321 TCTAGGCATTAATGTGCTTGGGG - Intronic
987596178 5:20002255-20002277 TATGTGCAATAATGTTCTGGGGG - Intronic
992185585 5:74241416-74241438 TCTGGGCATTGCTTCTCAGGAGG + Intergenic
999883306 5:155891189-155891211 TCTGGGCCCTACTGCACTGGAGG + Intronic
1002883176 6:1270923-1270945 TCTGGGCATGCATGCTGAGGAGG - Intergenic
1003701365 6:8468579-8468601 TATAGGAATTAATGCTCTGTGGG + Intergenic
1004482760 6:16036912-16036934 TCTGGGCATGAATGTTCAGGTGG - Intergenic
1007077460 6:39076958-39076980 TCTGGGCATTGAGGCTCTGAAGG + Intronic
1011747060 6:90416486-90416508 TCTGGGCAGTGATGCTTTGCTGG + Intergenic
1012263476 6:97113956-97113978 GCTGTGCATAGATGCTCTGGTGG - Exonic
1012967533 6:105690964-105690986 TCTGGGAATTAAAGCTCTTAGGG + Intergenic
1014137969 6:117908937-117908959 TCTGGGGCTCAAAGCTCTGGTGG + Intronic
1018999956 6:168741568-168741590 TCTTGGAATTTATGCTATGGAGG + Intergenic
1020480004 7:8647330-8647352 GCTGGGCATGAGTGGTCTGGAGG - Intronic
1024026642 7:45414755-45414777 TGTGGGCATCAAGGGTCTGGAGG - Intergenic
1024438197 7:49383529-49383551 TCTGGGCTTTCAGACTCTGGAGG - Intergenic
1024859346 7:53819356-53819378 TCTGGGCAACAATGCTCGAGTGG - Intergenic
1028496932 7:91472020-91472042 TCTTGTCTTTAATGCACTGGGGG + Intergenic
1030807607 7:113936760-113936782 TCTGTGCATTAATGCAGTTGGGG + Intronic
1033472383 7:141661709-141661731 TCTGGACACGAATTCTCTGGAGG - Exonic
1038411013 8:27359965-27359987 TGTGGGCACTAAAGCTATGGAGG - Intronic
1038703799 8:29875503-29875525 TCTGGGAATAAATGCCCAGGGGG - Intergenic
1042662518 8:71170814-71170836 TTTAGCCATTAAGGCTCTGGGGG + Intergenic
1043231711 8:77810564-77810586 TCTGGACATTAATCTTCTGTAGG - Intergenic
1043879509 8:85525896-85525918 TGTGTGCATTATTGCTCTTGAGG + Intergenic
1044498328 8:92918607-92918629 TCTGGGTATTAATCCTTTGTTGG + Intronic
1046250797 8:111628417-111628439 TCTGGATATTAATCCTCTGTTGG - Intergenic
1052379686 9:27756545-27756567 TCTGTGCATAAATGCTCAGCAGG - Intergenic
1054702532 9:68427522-68427544 TGTGGGCATGAATGCTGGGGAGG + Intronic
1058842776 9:108926079-108926101 TCTGGGCATTAAGGCTGTGGGGG - Intronic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1187046390 X:15651375-15651397 TTTGGTATTTAATGCTCTGGTGG - Intronic
1187052651 X:15709903-15709925 TTTGGTATTTAATGCTCTGGTGG - Intronic
1190107445 X:47570375-47570397 TCTGGGCTTTGAGGATCTGGGGG - Intronic
1190368237 X:49717445-49717467 TCTGGGTATTAATTCTTTGTTGG - Intergenic
1192279754 X:69672418-69672440 GCTGGGGAATAGTGCTCTGGAGG + Intronic
1197047905 X:122022244-122022266 TCTGGGTATTAGTGCTTTGATGG + Intergenic
1199715881 X:150507016-150507038 GCTGGGCCTTAGTTCTCTGGGGG + Intronic