ID: 947399669

View in Genome Browser
Species Human (GRCh38)
Location 2:229718452-229718474
Sequence GGGTCCTGATAGAACTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947399669_947399670 -10 Left 947399669 2:229718452-229718474 CCAGAACAGTTCTATCAGGACCC No data
Right 947399670 2:229718465-229718487 ATCAGGACCCATGACAACACTGG No data
947399669_947399671 -9 Left 947399669 2:229718452-229718474 CCAGAACAGTTCTATCAGGACCC No data
Right 947399671 2:229718466-229718488 TCAGGACCCATGACAACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947399669 Original CRISPR GGGTCCTGATAGAACTGTTC TGG (reversed) Intergenic
No off target data available for this crispr