ID: 947404975

View in Genome Browser
Species Human (GRCh38)
Location 2:229765921-229765943
Sequence CACTGCCCAAGTGAACTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 131}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947404972_947404975 -4 Left 947404972 2:229765902-229765924 CCCTTCCACTTAATGGGGTCACT 0: 1
1: 0
2: 0
3: 14
4: 112
Right 947404975 2:229765921-229765943 CACTGCCCAAGTGAACTCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 131
947404967_947404975 14 Left 947404967 2:229765884-229765906 CCAACTCCTCTGACAGTTCCCTT 0: 1
1: 1
2: 1
3: 31
4: 271
Right 947404975 2:229765921-229765943 CACTGCCCAAGTGAACTCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 131
947404968_947404975 8 Left 947404968 2:229765890-229765912 CCTCTGACAGTTCCCTTCCACTT 0: 1
1: 0
2: 0
3: 24
4: 284
Right 947404975 2:229765921-229765943 CACTGCCCAAGTGAACTCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 131
947404974_947404975 -9 Left 947404974 2:229765907-229765929 CCACTTAATGGGGTCACTGCCCA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 947404975 2:229765921-229765943 CACTGCCCAAGTGAACTCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 131
947404966_947404975 15 Left 947404966 2:229765883-229765905 CCCAACTCCTCTGACAGTTCCCT 0: 1
1: 0
2: 1
3: 16
4: 261
Right 947404975 2:229765921-229765943 CACTGCCCAAGTGAACTCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 131
947404965_947404975 16 Left 947404965 2:229765882-229765904 CCCCAACTCCTCTGACAGTTCCC 0: 1
1: 0
2: 6
3: 30
4: 285
Right 947404975 2:229765921-229765943 CACTGCCCAAGTGAACTCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 131
947404973_947404975 -5 Left 947404973 2:229765903-229765925 CCTTCCACTTAATGGGGTCACTG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 947404975 2:229765921-229765943 CACTGCCCAAGTGAACTCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 131
947404964_947404975 17 Left 947404964 2:229765881-229765903 CCCCCAACTCCTCTGACAGTTCC 0: 1
1: 0
2: 2
3: 24
4: 281
Right 947404975 2:229765921-229765943 CACTGCCCAAGTGAACTCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947404975 Original CRISPR CACTGCCCAAGTGAACTCTC AGG Intronic
900907723 1:5572478-5572500 CACTGCCCAAGACAACTTCCTGG - Intergenic
901066956 1:6498724-6498746 CACAGCCTACGGGAACTCTCAGG + Intronic
903257069 1:22109577-22109599 CTCTGCCCAACTGAAGTCTTGGG + Intergenic
904933946 1:34113199-34113221 CACTTCCCAACTGAATTCTTAGG + Intronic
905008666 1:34731666-34731688 CACTGTCCAAGGGAAGTTTCTGG - Intronic
906711275 1:47931713-47931735 TAATACCCGAGTGAACTCTCAGG + Intronic
907856145 1:58305932-58305954 CACAGTTCCAGTGAACTCTCAGG + Intronic
908155644 1:61349995-61350017 AAATGCCCCAGTGGACTCTCTGG + Intronic
910576759 1:88774217-88774239 CAATGCTCAAGTGAACTTCCTGG - Intronic
912519436 1:110235122-110235144 CACTGCCCAAGACAGCTCCCGGG - Intronic
913459527 1:119069648-119069670 CACTGGCCTAGTGTACTCTTGGG + Intronic
916915147 1:169398752-169398774 CACTGTCCAATAGAACTTTCTGG - Intronic
919691535 1:200532290-200532312 CCCTGACCAAATGGACTCTCAGG + Intergenic
919941851 1:202292707-202292729 CACTGCCCAGTAGAACTTTCTGG + Intronic
1063164943 10:3452884-3452906 CACTGCAAAAGTGAATTCTAGGG + Intergenic
1065593338 10:27287876-27287898 CACTGCCCAGTTGAACTTACTGG + Intergenic
1065657037 10:27962411-27962433 CACTGCCCAGTTGAACTTACTGG - Intronic
1066125373 10:32336483-32336505 TACTGCCCAAGTGAGCTGACTGG + Intronic
1066279356 10:33900000-33900022 AACTGGCCATGTGAAGTCTCAGG + Intergenic
1073424375 10:103447403-103447425 CACGGCCGAGGTGCACTCTCGGG - Exonic
1075466795 10:122657508-122657530 CAGTGCCCAAGCGAAGGCTCTGG - Intergenic
1076144320 10:128105108-128105130 CACAGTCCAAGAGAAGTCTCAGG - Exonic
1076144501 10:128106560-128106582 CACAGCCCAAGAGAAGTCTCAGG - Exonic
1076144579 10:128107292-128107314 CACAGTCCAAGAGAAGTCTCAGG - Exonic
1078534999 11:12165819-12165841 CACTGCTCTAGAGAGCTCTCAGG - Intronic
1085086565 11:73671795-73671817 CACTGCCCTAGTAAAGGCTCCGG + Intergenic
1089139531 11:116274813-116274835 CCCAGCCTAAGTGAAATCTCTGG + Intergenic
1091137656 11:133206634-133206656 CTCGGCCCTAGTGATCTCTCAGG - Intronic
1091897633 12:4117875-4117897 GACAGCCCAGGTGAACTCTCTGG - Intergenic
1096079589 12:48824798-48824820 TCCTGCCCAAGTGAACTGTGTGG + Intronic
1106987464 13:35372423-35372445 CAGTGCCCAAGGACACTCTCTGG - Intronic
1109675986 13:65676103-65676125 CCCTGCCCAACTGTACACTCAGG - Intergenic
1111436077 13:88209947-88209969 CAATCCCCAAGTGAATTCTGAGG + Intergenic
1113391610 13:109903307-109903329 CACTCCCCACGTGAAATCTTTGG - Intergenic
1114991901 14:28298195-28298217 CAGTGCCCCAGTGAAGACTCTGG - Intergenic
1118445487 14:65847395-65847417 CACTGCTGAAATGAACTCTTTGG + Intergenic
1118697513 14:68399114-68399136 CAATGACCAAGTAATCTCTCTGG + Intronic
1121081815 14:91114585-91114607 CACTGCCCTTGAGAACTCCCAGG + Intronic
1121215321 14:92243083-92243105 CACAGCCCAAGAGAGCTCACAGG + Intergenic
1121409890 14:93742580-93742602 CCCTGCCCAAGGGAATTTTCTGG - Intronic
1121814170 14:96916307-96916329 AACTGCCCAGCTGAACTTTCTGG + Intronic
1121821119 14:96967002-96967024 CACTGCCCAATTGGAGTCTCTGG - Intergenic
1122578101 14:102754649-102754671 CACTTCCCAGGTGAAGTCACGGG + Intergenic
1123854857 15:24398392-24398414 CACTGCCCAAAAGAAATCTTTGG - Intergenic
1123870887 15:24571378-24571400 CACTGCCCAAAAGAAATCTTCGG - Intergenic
1124216910 15:27815203-27815225 CTCTGCCCAGGTGAACTCTGTGG + Intronic
1124374763 15:29123069-29123091 CACGTCCACAGTGAACTCTCTGG - Exonic
1127560882 15:60134845-60134867 TACTGGCCAATTGAGCTCTCAGG - Intergenic
1129364665 15:75046964-75046986 CCCTGCCCATGTGAATTCCCAGG + Intronic
1129782592 15:78283059-78283081 CACTGCATAAGTCAACTCCCTGG + Intronic
1130032822 15:80331976-80331998 CACTACCTGAGTGAACACTCAGG + Intergenic
1131428601 15:92368087-92368109 CACAGCCCAAGTGAAACCGCTGG + Intergenic
1133899328 16:9958617-9958639 CTTTGCCAAAGTGAACTATCAGG + Intronic
1138016049 16:53429726-53429748 CCCTGCCCAACTGAAATCTGTGG - Intergenic
1141808051 16:86354968-86354990 CACTGTCCAAGTGATCAGTCAGG + Intergenic
1143805615 17:9423940-9423962 CACTGCCATACTGAACTCTGTGG - Intronic
1143944299 17:10576670-10576692 AAATGCCCAGGGGAACTCTCTGG + Intergenic
1146626988 17:34442453-34442475 CACTGCCCCGCTGACCTCTCAGG - Intergenic
1147325932 17:39669619-39669641 CCCTGCCCAGGTGAAGTGTCCGG + Exonic
1147877993 17:43635152-43635174 TACAGCCCCAGGGAACTCTCTGG - Intergenic
1151551597 17:74825538-74825560 CTCGGGCCAAGTGAACTCTCAGG - Intronic
1152318751 17:79596256-79596278 CAGAGCCCAACTGAACCCTCAGG + Intergenic
1157567533 18:48689809-48689831 CCCTGCCGCAGTTAACTCTCTGG + Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1164783942 19:30914476-30914498 CCCAGCCCCAGTGAGCTCTCTGG - Intergenic
1166293645 19:41878627-41878649 CTCTGGCCCTGTGAACTCTCTGG - Intronic
1166752873 19:45173016-45173038 GGCTGCCCAAGTGCACTCTCGGG + Intronic
926956728 2:18309887-18309909 CTTTGGCCAAGTGAACTCTTGGG - Intronic
927199685 2:20570675-20570697 AACTGCCCAAGTGAGTTCCCAGG + Intronic
927690845 2:25207160-25207182 CACTGAAAAAGTGAACCCTCCGG + Intergenic
928181347 2:29071059-29071081 CACTGAGCAGGTGCACTCTCGGG + Exonic
930933666 2:56919944-56919966 GTCTGCCCATGAGAACTCTCAGG - Intergenic
933970205 2:87463876-87463898 CCCAGCCCAAGGGAACCCTCAGG - Intergenic
935553699 2:104484272-104484294 CACAGCAAAAGTGAACTTTCTGG + Intergenic
936323576 2:111486620-111486642 CCCAGCCCAAGGGAACCCTCAGG + Intergenic
936376454 2:111945535-111945557 CAGTGCCCAAAAGAAGTCTCAGG - Intronic
938656661 2:133441811-133441833 CATTTCCTAAGCGAACTCTCAGG + Intronic
944973907 2:205025553-205025575 GACTGCCCAAGAGAACACTGTGG - Intronic
946313077 2:218893515-218893537 CCCAGCCCAACTGAACTGTCTGG - Exonic
947057747 2:226126389-226126411 CACTGCAGCATTGAACTCTCAGG + Intergenic
947404975 2:229765921-229765943 CACTGCCCAAGTGAACTCTCAGG + Intronic
948143811 2:235693409-235693431 CTCTGCCCAAGTGCAGTCTCTGG + Intronic
948194115 2:236082440-236082462 CGCTGCCCATTTGATCTCTCAGG + Intronic
948915712 2:241034268-241034290 CACAGCCCAAAGGCACTCTCGGG - Intronic
949057953 2:241939394-241939416 TACAGCCCAAGTGAACTTCCTGG + Intergenic
1170018546 20:11810272-11810294 CATTGCCCAAGAAAGCTCTCAGG + Intergenic
1173399816 20:42714838-42714860 TACTCCCCATATGAACTCTCTGG - Intronic
1176021405 20:62964112-62964134 CACTGCCCAGGAAAGCTCTCCGG - Intronic
1180939488 22:19648071-19648093 CACTGCCCTCTTGAACTCTCGGG - Intergenic
1184010744 22:41746112-41746134 GACTGCTCAAAGGAACTCTCTGG + Intronic
955896677 3:63707748-63707770 CATTTTCCAAGTGAACTGTCAGG - Intergenic
956515560 3:70042918-70042940 CACTGGCAAAGCGAAATCTCTGG - Intergenic
956873922 3:73443559-73443581 CACTGCAGCACTGAACTCTCGGG + Intronic
957124922 3:76146792-76146814 CACTGCCCAAGGTAACTCTGTGG + Intronic
959541447 3:107544130-107544152 CATTTCCCAGGTGAACTCCCAGG - Intronic
959775725 3:110160458-110160480 CACTTCCCAATGAAACTCTCTGG + Intergenic
960284967 3:115818034-115818056 CACTTCGCAAATGACCTCTCTGG - Intronic
962129195 3:132654590-132654612 CTCTGCCCATGAGAACTCTGAGG + Intronic
962302590 3:134255921-134255943 CACTGCCCAATAGAAATGTCAGG - Intergenic
970450379 4:16160542-16160564 CACTGACCAAATGATCTCTCAGG - Exonic
970962520 4:21889565-21889587 CACTCCCCAAGAGAAACCTCTGG - Intronic
973924557 4:55724263-55724285 CATTACCCAGGTGACCTCTCAGG + Intergenic
979712003 4:123790801-123790823 GACTGCAAAAGTGAACTTTCTGG - Intergenic
982027593 4:151266738-151266760 ACCTGCCTAAGTGAATTCTCTGG + Intronic
984450644 4:179896978-179897000 CATTCCCCAAGTTACCTCTCTGG - Intergenic
986767211 5:10939037-10939059 CACAGCCCGAGAGATCTCTCAGG + Intergenic
992918400 5:81483991-81484013 CACTGCCCAATAGAACTTTCTGG - Intronic
996388828 5:122938096-122938118 CACAGCCCAGCTGTACTCTCCGG + Intronic
999451901 5:151684927-151684949 CCCTGCCCTTGTGATCTCTCAGG - Intronic
1000579506 5:163018033-163018055 CACTGCCCAGTAGAAGTCTCAGG - Intergenic
1004113948 6:12749166-12749188 CGCTGCCCAAGTGCACACTACGG - Intronic
1006473516 6:34241181-34241203 CACTGGCCATGTGACCTCTGGGG - Intronic
1007476158 6:42121479-42121501 CCCTGCCCTCCTGAACTCTCAGG - Intronic
1007663065 6:43498122-43498144 CAAGGCCCAAGAGAGCTCTCTGG - Intronic
1013255534 6:108380766-108380788 CTCTCCTCAAGTTAACTCTCGGG + Intronic
1014690663 6:124559580-124559602 CATTGCCCAACTTAACTCTGAGG - Intronic
1016208081 6:141494589-141494611 GACTGCCCAAGAGAACTGTAGGG - Intergenic
1017900779 6:158716857-158716879 CACTACCAAAGTGAACACACTGG + Intronic
1022406100 7:30091836-30091858 CTCTGCCCAAGTGAAATTGCTGG + Intronic
1023959347 7:44913588-44913610 CTCTGGCCAAGTGCACTCTGAGG + Intergenic
1026589882 7:71685353-71685375 CACTGACCCAGTGAACCCTCTGG + Intronic
1029525287 7:101090065-101090087 CACTGCCCATTCGAAATCTCAGG - Exonic
1030343037 7:108402137-108402159 AAATGCCCAACTGAAATCTCTGG + Intronic
1032360172 7:131247972-131247994 CACTGCAGCCGTGAACTCTCGGG + Intronic
1033443821 7:141403179-141403201 CACTGCCCCGCTGACCTCTCCGG - Intronic
1035241045 7:157529373-157529395 CACAGCCCAAGTGGGCTCTGTGG - Intergenic
1036945998 8:13095495-13095517 CACTGTCCAGGAGAACTGTCTGG - Intronic
1037216209 8:16455673-16455695 CAATGCACAACTGAACTCTCTGG + Intronic
1040588284 8:48764883-48764905 CTCTTCTCAAGAGAACTCTCTGG + Intergenic
1042145076 8:65719795-65719817 CACTGCCCATCTAAACTCTGAGG + Intronic
1043055528 8:75432990-75433012 CCCTGCCCCAGTGAAGTCTTCGG + Intronic
1043930105 8:86081227-86081249 CACTGCCCAAGAGAAGACTGTGG + Intronic
1044897469 8:96907715-96907737 CATTGCCCAGGATAACTCTCAGG - Intronic
1044931650 8:97257773-97257795 CACTGCCCAAATGCCCTTTCTGG + Intergenic
1046448665 8:114358906-114358928 CACTTCCCTGGTGAACTCTATGG + Intergenic
1047674679 8:127187463-127187485 CACTGCCCTGGTGCACTCCCTGG - Intergenic
1051509115 9:17857909-17857931 ATCTGCCCAAGAGAATTCTCAGG - Intergenic
1052312454 9:27082477-27082499 CAATGCCCCAGTGAGCTCACTGG + Intergenic
1053057414 9:35001937-35001959 ACCTGCCCAAGTGAACTTTCAGG + Intergenic
1059362535 9:113756400-113756422 CACTGCCCAAGGCAAGTCTGAGG - Intergenic
1062023115 9:134328437-134328459 CACTGCCCCAGGGATCTCCCTGG + Intronic
1062166563 9:135110713-135110735 CACTCCCCAAGTGGAGCCTCCGG + Intronic
1188941392 X:36241822-36241844 CTCTGCCCAAGTGAGCCCCCTGG + Intronic
1190097926 X:47497295-47497317 GACTCCCCAAGAGAAATCTCTGG - Intergenic
1192286489 X:69743705-69743727 AACTGCCCACATGAACTCTTAGG + Intronic
1192811848 X:74554071-74554093 CACTGCCCAACTGACCCCTGTGG + Intergenic
1197954403 X:131930776-131930798 CAATGCCCAAGTGAAAGGTCTGG + Intergenic