ID: 947405074

View in Genome Browser
Species Human (GRCh38)
Location 2:229767225-229767247
Sequence CCACATTTATTGTTCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947405072_947405074 -4 Left 947405072 2:229767206-229767228 CCAGAATTAAACTGCACAGCCAC 0: 1
1: 0
2: 1
3: 8
4: 126
Right 947405074 2:229767225-229767247 CCACATTTATTGTTCCAGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 140
947405071_947405074 -3 Left 947405071 2:229767205-229767227 CCCAGAATTAAACTGCACAGCCA 0: 1
1: 0
2: 0
3: 9
4: 204
Right 947405074 2:229767225-229767247 CCACATTTATTGTTCCAGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947405074 Original CRISPR CCACATTTATTGTTCCAGCC TGG Intronic
902198015 1:14812487-14812509 TCACATTCATTTTTCAAGCCTGG + Intronic
902738036 1:18414147-18414169 ACACTTTTATGGCTCCAGCCTGG + Intergenic
905152383 1:35940981-35941003 CCACATTTACACCTCCAGCCTGG + Intronic
906548656 1:46641928-46641950 CCATATTTATATCTCCAGCCTGG + Intronic
907232800 1:53015784-53015806 CCACCTTTATTTTTCCAAGCCGG + Intronic
908254954 1:62295462-62295484 TCACATCTTTTCTTCCAGCCAGG + Intronic
911371186 1:96996720-96996742 CCAAATTTATAGTTCCACCTAGG - Intergenic
912673614 1:111655025-111655047 CCACATTTATTTTTTCAGACAGG - Intronic
915910112 1:159909662-159909684 GCAAATTGATTTTTCCAGCCTGG - Intergenic
917053177 1:170948384-170948406 ACAAATTGATTTTTCCAGCCAGG + Intronic
918492270 1:185093945-185093967 CCAAATTTATATATCCAGCCCGG + Intronic
921266990 1:213429086-213429108 CCAGATTTTTTTTTCCAACCTGG - Intergenic
1068073368 10:52223615-52223637 CCAGATTTACGTTTCCAGCCTGG + Intronic
1068180042 10:53505236-53505258 CCACATTTATGTCTCCAGCCAGG + Intergenic
1071430912 10:85605999-85606021 CCACGTTTACTATTCCAGCTTGG - Intronic
1072244422 10:93529882-93529904 CCACATCTCTTGTTCCATACAGG - Intergenic
1078572468 11:12471294-12471316 CCACATTTAAATCTCCAGCCTGG - Intronic
1079241164 11:18723118-18723140 CCACATTTATGTTCCCTGCCTGG + Intronic
1079503464 11:21128701-21128723 GAACAATTATTGTCCCAGCCAGG + Intronic
1080035054 11:27701182-27701204 CCAAGTTACTTGTTCCAGCCAGG + Intronic
1082880623 11:58033940-58033962 CCACAGTGAGTGTTCCAGCCTGG + Intronic
1083785832 11:64946267-64946289 CCCAATTTATTCTGCCAGCCAGG - Intronic
1084236876 11:67793458-67793480 CCAGATTTCTTGTCCCATCCTGG - Intergenic
1088111922 11:106271599-106271621 CCACACATTTTGTTCCAGCTGGG - Intergenic
1088561028 11:111116448-111116470 CCTCAGTTATTGTTCCAGGATGG + Intergenic
1089608004 11:119652849-119652871 CAACTTTAATTGTCCCAGCCTGG + Intronic
1090498947 11:127242918-127242940 ACACATGCATTGTTCCATCCAGG + Intergenic
1091233669 11:134004594-134004616 CCACATTTTTTCTTCCTGCCAGG + Intergenic
1091789164 12:3261501-3261523 CTCCATCTATTCTTCCAGCCGGG - Intronic
1092092982 12:5819451-5819473 CTGCATTTAATGTTGCAGCCTGG + Intronic
1094083061 12:26558756-26558778 CCACATTTATATTTCCAGCATGG + Intronic
1095525274 12:43117786-43117808 CTACATTTAATGTTGCAGCTTGG - Intergenic
1097631677 12:62071743-62071765 CCACATTTATCCTGTCAGCCAGG - Intronic
1099735492 12:86562868-86562890 CTGCATTTAATGTTCCAGCTAGG + Intronic
1100333086 12:93603811-93603833 CCACATTTCTGGTTCCACCCTGG - Intergenic
1101268896 12:103122098-103122120 CCACAGTTCTTCCTCCAGCCTGG - Intergenic
1102211533 12:111130853-111130875 CTGCATTTAATGTTGCAGCCTGG - Intronic
1102326100 12:111985890-111985912 CAACAGTAATTGTTTCAGCCAGG - Intronic
1103148992 12:118620601-118620623 CCACATTTATGTTACCAGCCTGG + Intergenic
1108319282 13:49272096-49272118 CCACTTTTTCTGTTTCAGCCTGG - Intronic
1109173581 13:59126794-59126816 TCACATTTATTGTACCACACTGG - Intergenic
1111261071 13:85741237-85741259 CTACAATGATTTTTCCAGCCTGG - Intergenic
1112548662 13:100397711-100397733 CCATATTTATTGTGGCAGCGTGG + Intronic
1115679366 14:35719051-35719073 TAACATTAATTTTTCCAGCCTGG - Intronic
1117001298 14:51374110-51374132 CTACATTTAATGTTGCAGCTTGG + Intergenic
1119637304 14:76285342-76285364 CCACATTTAGTTTTTCAACCTGG + Intergenic
1120747160 14:88162954-88162976 GCAAACTTACTGTTCCAGCCTGG + Intergenic
1121274949 14:92661192-92661214 CCACATTTGTTGAGCCTGCCAGG - Intronic
1121715323 14:96069849-96069871 CAACCTTTATTTTTACAGCCTGG + Intronic
1125113188 15:36057806-36057828 CCACATGGATTCTTCCAGGCAGG + Intergenic
1138363583 16:56453424-56453446 CCACATTAACTCTTCCAGCTTGG + Intronic
1140678299 16:77356822-77356844 TCACATTTATTCTTCCTGTCAGG - Intronic
1141262276 16:82464627-82464649 CCAGCTTTTTTATTCCAGCCTGG + Intergenic
1144112096 17:12045340-12045362 TCACATTTATTTTTCCTGCTTGG - Intronic
1145009350 17:19358797-19358819 CCAAATTTATGTCTCCAGCCTGG + Intronic
1151037906 17:70822396-70822418 CTGCATTTAATGTTGCAGCCTGG - Intergenic
1153661166 18:7327576-7327598 CCAAATTTATGTCTCCAGCCTGG - Intergenic
1153909110 18:9690762-9690784 CCAAAGTTATTCATCCAGCCTGG - Intergenic
1158224284 18:55184510-55184532 CCACATTTATGTCTCCAGCCTGG - Intergenic
1163769265 19:19180757-19180779 GCACATGTTTTGTTGCAGCCCGG - Exonic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
1166376241 19:42328805-42328827 GCACATCTGTGGTTCCAGCCTGG + Intronic
1167681117 19:50922013-50922035 CCTCATTTATACTTCCTGCCTGG + Intergenic
1167704288 19:51069593-51069615 CCAAATTTATGTCTCCAGCCAGG + Intergenic
925791355 2:7490331-7490353 CCCCATTTATTGATTCAACCAGG - Intergenic
930059209 2:47274480-47274502 CCACATCCAGTGCTCCAGCCAGG - Intergenic
930143597 2:47978577-47978599 CCCCATTTCTTGTTTCAGTCAGG - Intergenic
930576225 2:53152425-53152447 GGACGTTTTTTGTTCCAGCCAGG - Intergenic
930903164 2:56532876-56532898 CTGCATTTAATGTTGCAGCCTGG - Intergenic
931139201 2:59438453-59438475 TCCCATTTATTTTTCCAGCCTGG + Intergenic
932130674 2:69184542-69184564 CCACATCTTTGGTTACAGCCAGG + Intronic
933685350 2:85136940-85136962 CCACATTCATTTTACCAGGCTGG - Intronic
936573395 2:113634578-113634600 CCACATTTATTTTTTCAAACTGG - Intronic
939324662 2:140672548-140672570 CTCCATTTATTGTTAAAGCCTGG + Intronic
940065269 2:149620593-149620615 ACACCTTTATTTTTTCAGCCTGG - Intergenic
940778471 2:157908324-157908346 CAAAATTTATTTTTCCTGCCAGG - Intronic
942088049 2:172461946-172461968 CCTTATTTATTGTTCCTGCTAGG + Intronic
942414887 2:175748174-175748196 CCCCATCTATTGTTCCAAACTGG + Intergenic
943014050 2:182489830-182489852 CCACATTTATATCTGCAGCCTGG - Intronic
944024531 2:195147359-195147381 CCAAATTTATGTCTCCAGCCTGG + Intergenic
947357030 2:229307475-229307497 CCACATTAATGTTTCCAGCAAGG - Intergenic
947405074 2:229767225-229767247 CCACATTTATTGTTCCAGCCTGG + Intronic
1169219482 20:3813347-3813369 CCACTTTGCTTGCTCCAGCCTGG + Intergenic
1169638852 20:7725587-7725609 CCACATGTACATTTCCAGCCTGG - Intergenic
1172886730 20:38236347-38236369 CGACACTGATTTTTCCAGCCTGG - Intronic
1174639407 20:52030409-52030431 CCAAATGTACTGTACCAGCCTGG - Intergenic
1174825681 20:53766343-53766365 CTACATTTATTTCTCCAGCATGG + Intergenic
1175362947 20:58428994-58429016 CCCCATTTGCTGTTCCAGGCTGG + Intronic
1175636469 20:60588358-60588380 CAACATTTATTATGACAGCCTGG - Intergenic
1176238336 20:64064482-64064504 TCACGTTTATTGAGCCAGCCAGG - Intronic
1177367722 21:20158850-20158872 CCACATTTCTTGTTTCTGTCAGG + Intergenic
1182037009 22:27206811-27206833 CCACATTCATTTGTGCAGCCAGG - Intergenic
1184071594 22:42150616-42150638 CCACATCGACTGTCCCAGCCTGG - Intergenic
1185426787 22:50776302-50776324 CCACATTTATTTTTTCAAACTGG + Intronic
949174186 3:1038950-1038972 CCACAATGAATGTTCTAGCCAGG + Intergenic
949643242 3:6063911-6063933 CCACCTTTGTTCTTCCTGCCTGG - Intergenic
952358165 3:32603733-32603755 CCACATTTAGTGTACTAGTCAGG + Intergenic
952842688 3:37661688-37661710 CCTCCTTTCTTGTTCAAGCCAGG + Intronic
955521204 3:59777261-59777283 CCACATTTATGTTTCTAGCCTGG + Intronic
958081528 3:88751810-88751832 CCCCATTTATTGTTTCTGTCAGG - Intergenic
960129842 3:114044099-114044121 CCACATTTATTTCTTCAGCTTGG - Intronic
961249848 3:125492460-125492482 CCACATGTTGTGTTCCAGCCTGG - Intronic
962203851 3:133419352-133419374 CCACAGTTAGTGTTCCAGCCAGG + Intronic
963116615 3:141735860-141735882 CCACACTTATTTTTCAGGCCTGG - Intergenic
963355947 3:144209031-144209053 CTACATTTAATGTTGCAGCTTGG - Intergenic
964450898 3:156811957-156811979 CTACATTTATTGTTTCAGGTGGG + Intergenic
965270440 3:166610908-166610930 CTAAATTTATAGCTCCAGCCCGG - Intergenic
968815092 4:2818005-2818027 CCACATCTGTTGGTGCAGCCTGG - Intronic
969818331 4:9702713-9702735 CCAGATTTCTTGTCCCATCCTGG + Intergenic
972362488 4:38340116-38340138 CCACATTGATTTTTGCATCCTGG - Intergenic
977165314 4:93687399-93687421 CTACATTTATATTTCTAGCCAGG - Intronic
978776305 4:112509986-112510008 CCAGTTTGATTTTTCCAGCCGGG - Intergenic
978970974 4:114806576-114806598 CCAAATTTCTTGTTCAATCCTGG + Intergenic
979466299 4:121042279-121042301 CCACACTTCTTGTTCTAGCCTGG + Intronic
981508887 4:145533268-145533290 GAACATTTATTGTCCAAGCCAGG + Intronic
982835225 4:160114380-160114402 CCTCATTTAATGTTGCAGCTTGG + Intergenic
984061348 4:174991994-174992016 CCACATTTAATGTTGCAGCTTGG - Intergenic
994691942 5:103030560-103030582 CCACCTTTATTCTGCCAACCTGG + Intronic
995716605 5:115086944-115086966 ACACAGCTATTGTTCCAGCTTGG + Intergenic
996991732 5:129641501-129641523 AAACACTTATTCTTCCAGCCTGG + Intronic
998030125 5:138859440-138859462 CTAAATTTATGTTTCCAGCCTGG + Intronic
1004517055 6:16329186-16329208 CTTCATTTTATGTTCCAGCCAGG - Intronic
1005925623 6:30443045-30443067 CTTCATGTATTGTTCCAGCTAGG + Intergenic
1009877653 6:69525139-69525161 CCTCACTGATTGTTCCAGTCAGG - Intergenic
1012480931 6:99666127-99666149 GCAAGTTTATTCTTCCAGCCAGG - Intergenic
1013572062 6:111438441-111438463 GCACACTTATAGTCCCAGCCTGG - Intronic
1014743137 6:125169334-125169356 CAAAATTTATTTTTCCTGCCTGG + Intronic
1017977404 6:159370254-159370276 CTGCATTTATTGTTGCAGCTTGG - Intergenic
1019006329 6:168799764-168799786 CCTCAATAATTGTTGCAGCCAGG - Intergenic
1020710044 7:11595425-11595447 CTGCATTTAATGTTCCAGCTTGG + Intronic
1029534223 7:101146441-101146463 CCACAGAGAGTGTTCCAGCCGGG + Intergenic
1030426493 7:109385385-109385407 CCCCATTTATTGTTCTTGTCAGG - Intergenic
1032628775 7:133624005-133624027 CCCCATTTATTGATGCAGTCAGG + Intronic
1032631985 7:133663405-133663427 CCAAATTTATATCTCCAGCCTGG + Intronic
1032923706 7:136577986-136578008 CTACATTTAATGTTGCAGCTCGG - Intergenic
1033398324 7:140996668-140996690 CCTCATTTATTCTTCAATCCAGG + Intergenic
1034216875 7:149414705-149414727 CCACATATATTGTTCAAGTAAGG - Intergenic
1037806901 8:22063055-22063077 CCACATCTCTGGTTCCAGCCTGG + Intronic
1041102991 8:54415442-54415464 CCACATTTAAGATCCCAGCCAGG + Intergenic
1042308289 8:67354200-67354222 CCCCATTTATTGTTTCTGTCAGG + Intergenic
1043588865 8:81803700-81803722 CCTCATTTCTTGTACCATCCTGG - Intronic
1043846607 8:85170794-85170816 CAACATTTATTGTCACAGCTTGG + Intergenic
1045708847 8:104959952-104959974 CCCCATTTCTTGTTCTTGCCAGG + Intronic
1055330452 9:75177984-75178006 CCAAATTTATCTTTCCATCCCGG + Intergenic
1055483299 9:76731615-76731637 ATATATTTATTGTTCCTGCCGGG - Intronic
1059947876 9:119430519-119430541 CCATAATTATTGTTCCAATCAGG - Intergenic
1060840161 9:126786607-126786629 CCACATCTCTGGTTCTAGCCTGG + Intergenic
1187828717 X:23358912-23358934 CCACATTTCTTGTTCTTGTCCGG + Intronic
1187933905 X:24317777-24317799 CCAAATGTATAGCTCCAGCCTGG + Intergenic
1188861146 X:35258460-35258482 CCACAATTGTTGTTCCAGATAGG - Intergenic
1192656413 X:72999563-72999585 CCACATTGATGCTTCCAGTCTGG + Intergenic
1192665707 X:73083438-73083460 CCACATTGATGCTTCCAGTCTGG - Intergenic
1193253895 X:79324627-79324649 ACACATTTATAGATCCAGGCAGG - Intergenic
1193939096 X:87658151-87658173 CCCCAGTTATTGTCCCAGCCAGG - Intronic
1195490394 X:105462093-105462115 CGTCATTAATTCTTCCAGCCTGG + Intronic
1197577148 X:128228974-128228996 GCAAATATATTTTTCCAGCCTGG - Intergenic
1199226116 X:145376744-145376766 CTACATTTGTATTTCCAGCCAGG - Intergenic