ID: 947407003

View in Genome Browser
Species Human (GRCh38)
Location 2:229788797-229788819
Sequence TTACTGAGCTAGGAAAAACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947407003_947407008 14 Left 947407003 2:229788797-229788819 CCAGGTTTTTCCTAGCTCAGTAA 0: 1
1: 0
2: 0
3: 14
4: 192
Right 947407008 2:229788834-229788856 TTTCCTGTCATGATTACTAAAGG 0: 1
1: 0
2: 0
3: 18
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947407003 Original CRISPR TTACTGAGCTAGGAAAAACC TGG (reversed) Exonic
901278240 1:8009923-8009945 TTGCTTAGCCAGGAAAAATCAGG + Intronic
901831139 1:11893318-11893340 TTGCTTTGCTAGGAAAAGCCTGG - Intergenic
903145390 1:21368737-21368759 TTAGAGAGCTAGGGAAACCCTGG + Intergenic
904109008 1:28110610-28110632 ATACTGAGCTAGAAAGAACTAGG - Intergenic
905738107 1:40344854-40344876 TTTCTGAGCTAGGAATGAACTGG - Intronic
908000644 1:59675239-59675261 TTACTGAGCTACTAGATACCTGG - Intronic
908304864 1:62802091-62802113 TCACTGAGATAGGAAACATCAGG - Intronic
909166308 1:72230416-72230438 TTACTGATATAAGATAAACCTGG + Intronic
909745828 1:79096036-79096058 TTCCTGAGCAAGGAAATATCTGG - Intergenic
913564034 1:120053294-120053316 TTTCTGAGCTAGGAAAGGCTAGG - Intronic
913634091 1:120740271-120740293 TTTCTGAGCTAGGAAAGGCTAGG + Intergenic
914284623 1:146212642-146212664 TTTCTGAGCTAGGAAAGGCTAGG - Intronic
914545654 1:148663381-148663403 TTTCTGAGCTAGGAAAGGCTAGG - Intronic
914620909 1:149407285-149407307 TTTCTGAGCTAGGAAAGGCTAGG + Intergenic
915251523 1:154592681-154592703 TTACTAAGCTGGGAAAGACTTGG + Intronic
917732420 1:177889016-177889038 TTAGTTAGCTATGAAAATCCAGG - Intergenic
918336680 1:183522123-183522145 TTACTGAGATGGGAAACACTAGG + Intronic
918637888 1:186800776-186800798 TTACTGAGCTGGGAAATTCAGGG + Intergenic
920039625 1:203086925-203086947 TTAATGAGCCAGGAAAATTCTGG - Intergenic
921309138 1:213825448-213825470 CTACTGACCCAGGAAGAACCCGG + Intergenic
924161137 1:241233300-241233322 TTACTGATCTACGGAACACCAGG + Intronic
1065130909 10:22619317-22619339 TTACAGAGGCAGGAAAAAACGGG + Intronic
1065504621 10:26416826-26416848 TTACTGAGATGAGAAAAACTAGG + Intergenic
1066524088 10:36257106-36257128 TTACAGAGCCACAAAAAACCTGG + Intergenic
1069025355 10:63534112-63534134 TTACTTAGCAAGGAAAGATCAGG - Intronic
1069375097 10:67785747-67785769 TTATTGAGCATGGAAACACCTGG + Intergenic
1071955384 10:90751851-90751873 TTACTTAGCCAGGAAAAAGATGG - Intronic
1072322438 10:94263860-94263882 TTACTGAGTTAGAGAAAGCCTGG - Intronic
1073433512 10:103502132-103502154 ACACTGAGCTAGGAAAGAGCAGG + Intronic
1074893302 10:117753390-117753412 TTCCTGAGCTAGGTAATATCTGG + Intergenic
1077939246 11:6823041-6823063 TTATTGAGATAGGAAAAAATGGG + Intergenic
1078244916 11:9565210-9565232 TTACTGGGGTAGGAAGAACCAGG + Intergenic
1078654814 11:13228857-13228879 TGACAGAGCTAGGATAAAACTGG + Intergenic
1078724740 11:13919974-13919996 TTACAGAGCTAGGAAATGGCAGG + Intergenic
1078884253 11:15484391-15484413 TTCCTGAGCAAGAAAAATCCAGG - Intergenic
1079698755 11:23518065-23518087 TTACAGAGCCAGGAACACCCTGG + Intergenic
1079797534 11:24824407-24824429 TTACTGTGATAGGAAAACCTTGG + Intronic
1080429345 11:32184330-32184352 TTCCTGCCCTAGGAAGAACCAGG + Intergenic
1082750774 11:57013904-57013926 TTACTAAGTCAGGAAAAACAGGG - Intergenic
1085437157 11:76516943-76516965 TTAATGAGCCAATAAAAACCAGG - Intronic
1088974285 11:114801816-114801838 TTACTGAGATGGGAAAGCCCAGG + Intergenic
1090660885 11:128880763-128880785 TTACTGAGCCAGGAAGGACAAGG - Intergenic
1092621597 12:10277289-10277311 TCACTGAGCTAAGAAAAGCAAGG + Intergenic
1092875324 12:12842703-12842725 TTACTGAGGTATCAAAAACATGG + Intergenic
1094083927 12:26567915-26567937 TTACTAAGCTAGAAAAATTCTGG + Intronic
1094240830 12:28222523-28222545 TTACTAAGCCTTGAAAAACCAGG + Intronic
1108047137 13:46393962-46393984 TTACTCAAGTAGGAAATACCAGG - Intronic
1108896081 13:55330635-55330657 CTACTGAGCTATCAAACACCAGG - Intergenic
1109564297 13:64091141-64091163 TTAATGATCTAGGAATATCCAGG + Intergenic
1112138818 13:96614624-96614646 TTACTGAGCTAGTAATAAATTGG - Intronic
1112897377 13:104316447-104316469 TTACAGAGATAGGAGAAACTTGG + Intergenic
1115920884 14:38372027-38372049 TTACTGAGATAGGGAAATCTTGG + Intergenic
1120494313 14:85215490-85215512 TTACTGATCTATCAAACACCAGG - Intergenic
1121631854 14:95427074-95427096 ATCATAAGCTAGGAAAAACCAGG + Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1127858051 15:62968635-62968657 TTACAGAGCCAGGGAAGACCAGG + Intergenic
1128360165 15:66956332-66956354 TTACTCACCTAGGAAACTCCAGG + Intergenic
1128441100 15:67709339-67709361 TTCCTGAACTAGGACAAACTAGG + Intronic
1130642489 15:85691724-85691746 TTACTGAGCAGGCCAAAACCGGG - Intronic
1135018189 16:18941554-18941576 TTACTGAGATAAGAAAGGCCTGG + Intergenic
1135188654 16:20336535-20336557 TTACTGAGCTCTGAAGAACTGGG - Intronic
1135669676 16:24364499-24364521 TGACTGAGCTTGGAAAATGCTGG - Intergenic
1137015983 16:35375952-35375974 TTACTGAGATAGGAAGGAACAGG - Intergenic
1137018371 16:35397834-35397856 TTACTGAGATAGGAAAGAATGGG - Intergenic
1138039832 16:53651143-53651165 TTACTGAGATAGGGAAAACTGGG - Intronic
1138821949 16:60271263-60271285 TTACTGGGCTAGCAAAACCAAGG + Intergenic
1141253394 16:82379392-82379414 TTAAAGGGCTCGGAAAAACCTGG + Intergenic
1144124258 17:12186875-12186897 TTACTGTGCTAGCAAATACTAGG + Intergenic
1148925458 17:51080957-51080979 TTAATGAGCTAGAGAAGACCAGG - Intronic
1149259513 17:54863745-54863767 TTGCTGGGCTAGGAATATCCAGG + Intergenic
1149724077 17:58874665-58874687 TTTCTGAGGTAGTACAAACCAGG - Intronic
1153035036 18:753875-753897 TTACTTAGATAGGAAAGACTTGG - Intronic
1153892132 18:9527145-9527167 CTAGTGAGCTAGGAAAAAGAAGG - Intronic
1154252054 18:12752770-12752792 TTAATGAGCTGAGAAAAATCAGG - Intergenic
1155042554 18:22076939-22076961 TTACTGATCTATCAAACACCAGG + Intergenic
1155787993 18:29926187-29926209 TTACTCAACTATGAAAAACTCGG + Intergenic
1156711341 18:39950194-39950216 TTACTGGCCTATCAAAAACCTGG - Intergenic
1156840999 18:41609263-41609285 TTACTGAGATGGGAAAGACTGGG - Intergenic
1158692351 18:59671860-59671882 TTAATGAGCTAGAAAAATGCTGG + Intronic
1165158693 19:33803390-33803412 TCACTGATCTAGGAGACACCTGG + Intronic
1165215547 19:34269454-34269476 ATACTGAGCTATGAAAACTCAGG - Intronic
931047132 2:58367097-58367119 TTACTGAGGTAGGGAAGATCAGG - Intergenic
935180479 2:100685422-100685444 CTACTGAGATAGGAGAAAACTGG + Intergenic
937172797 2:119893353-119893375 TTACTAAGTTGGGAAAGACCTGG + Intronic
940099210 2:150014519-150014541 ATACTGAGCTAGGACAAAGGAGG + Intergenic
941429317 2:165393409-165393431 TTACAGAGCTCAGAAAAACAAGG - Intergenic
941891838 2:170590681-170590703 GAACTGAGCTAAGAAAAATCTGG + Intronic
941948024 2:171121751-171121773 TTACTGATCTAGGTCAAAGCAGG - Intronic
942356374 2:175116405-175116427 TTACTGAGATGGGGAAAACTGGG + Intronic
945779654 2:214153321-214153343 ATCATGACCTAGGAAAAACCAGG - Intronic
947407003 2:229788797-229788819 TTACTGAGCTAGGAAAAACCTGG - Exonic
947519118 2:230830187-230830209 TTACTGTGCTAGAAACATCCTGG + Intergenic
1168971324 20:1932887-1932909 TCACTGAAATAGGAAAATCCAGG + Intronic
1169560236 20:6792183-6792205 GCACTGAGCTAGAAAATACCAGG + Intergenic
1170515926 20:17130396-17130418 TTACTGAAATAGGGAACACCAGG - Intergenic
1170856917 20:20065329-20065351 TTACTGAGATAGGAAAAGTGTGG - Intronic
1172530044 20:35624602-35624624 TTTCAGATCTAGGAAAAACAGGG + Intergenic
1172818976 20:37715044-37715066 TTACAGACCTAGGACAAACATGG + Intronic
1173476651 20:43364434-43364456 TTATTAAGCTAGGAAGAAGCCGG - Intergenic
1173784388 20:45782166-45782188 TTACTGAGACAGGGACAACCTGG - Intronic
1182875931 22:33690982-33691004 TTCCAGAGCTAGGAAATAACTGG - Intronic
1184516630 22:44966272-44966294 TCACTGAGCTTCAAAAAACCCGG + Intronic
1184542212 22:45133779-45133801 TTTCTGAGCAAGGAAAAAGAAGG + Intergenic
949386982 3:3513794-3513816 TTAATAAGCAAAGAAAAACCTGG + Intergenic
949433898 3:4007440-4007462 TTACTGATCTGGGCAATACCAGG + Intronic
950074931 3:10180606-10180628 TTCCTGAGCTGGGAACCACCTGG + Intronic
951857236 3:27211345-27211367 TAAGTGAGCTAGAAAAAAACAGG + Intronic
952236631 3:31486987-31487009 TTACTGAGGCAGGACAAACAGGG - Intergenic
952788844 3:37182029-37182051 TTACTCAAAGAGGAAAAACCAGG - Intronic
953936642 3:47050062-47050084 TTACTGATCTATGAAATACTTGG - Intronic
956765576 3:72481747-72481769 TTACTGAGTTCTGAAGAACCTGG - Intergenic
957163923 3:76646223-76646245 TTGCTGAGCTAGGAAGAAGGAGG + Intronic
958137627 3:89516911-89516933 TTTCTGAGCAATGAAAAATCTGG - Intergenic
958807942 3:98834371-98834393 TTACTGATCTATCAAACACCAGG + Intronic
958850348 3:99317584-99317606 TTATTGTGCTAGGAAAAAAAAGG + Intergenic
959928076 3:111947082-111947104 TTAGTGAGATAGGGAAAACTGGG + Intronic
959976692 3:112468623-112468645 TTACTGTGCAAGTAAAACCCAGG - Intronic
960927401 3:122808631-122808653 TTTCTGAGCTAGGAAACCACTGG + Intronic
960935024 3:122894042-122894064 TTACTGAGCTAAGAAGCACTGGG - Intergenic
962347698 3:134630742-134630764 TTACTCAGCTAGGAAGACTCAGG + Intronic
963197233 3:142545856-142545878 TTACTGAGATGGGAAAGACTGGG + Intronic
964426215 3:156556492-156556514 TTAGTGAGATAGGAAAAACTGGG - Intergenic
964653381 3:159037816-159037838 CTACAGCGCTAGGAAAAACAGGG - Intronic
965272957 3:166641815-166641837 TTACAGAGCTAGTAAAAACAGGG + Intergenic
966503989 3:180678955-180678977 TTTTTGAGCAAGGAAAAAGCGGG + Intronic
967522786 3:190454357-190454379 TTACTGATCTAGGAAATATTTGG - Intergenic
971163411 4:24157594-24157616 TTATTGAGTTAGGAAGAAGCTGG - Intergenic
975113901 4:70658044-70658066 ATACTGAGTTAGGAAACACAAGG - Intronic
977940965 4:102858464-102858486 AAACTGAGCAAGGAAATACCAGG - Intronic
978105173 4:104893302-104893324 TTACTGAGACAGGAAAAAAGGGG + Intergenic
978522243 4:109628688-109628710 TTACTGAGCTAGGGAAAAGTAGG + Intronic
979359822 4:119748320-119748342 TTGCTGAGATAGGAAAAAAGTGG + Intergenic
980445234 4:132897396-132897418 ATACTGAGCAAGAACAAACCTGG + Intergenic
981757728 4:148159585-148159607 TTGCAGAGCTAGTAAATACCAGG + Intronic
982580586 4:157174702-157174724 TTACTGATCTATTAAATACCAGG + Intergenic
982826830 4:160012559-160012581 CTACTGTGCTAGCAAATACCGGG - Intergenic
986245477 5:6002987-6003009 TTACACAGCTAGGAGAAACAGGG + Intergenic
988469949 5:31528403-31528425 TTATTGAGATAGGAAATACTAGG - Intronic
991452436 5:66767291-66767313 TTACTAAGTCAGGAAAGACCAGG + Intronic
993452124 5:88085006-88085028 TCACTAAGCTAGGAGAAACTGGG + Intergenic
995077545 5:108004638-108004660 TTCTAGAGCTGGGAAAAACCAGG + Intronic
997481226 5:134186093-134186115 GTACTAAGATAGGAAACACCAGG + Intronic
998814738 5:146001955-146001977 TTACTGAGCTAGAAAGCACTAGG - Intronic
998978475 5:147674143-147674165 TTAATGATCTAGGAAAACCTGGG - Intronic
1000270043 5:159675799-159675821 ACACTGAGCAAGAAAAAACCGGG + Intergenic
1000472853 5:161667917-161667939 TTACTGTGCTAGCAAAGACTTGG + Intronic
1002161515 5:177316625-177316647 TGACTGAAATAGGAAAAGCCAGG - Intergenic
1004943455 6:20585977-20585999 TTACTGAGATATGAAGAACATGG - Intronic
1005617831 6:27592376-27592398 TTAAAGAGCTAGGAAAACACCGG - Intergenic
1008165487 6:48133111-48133133 TTACTGAGCTAGGGCAACCTGGG + Intergenic
1008757353 6:54812267-54812289 TTACAGAGATAGGAAAAAAAAGG - Intergenic
1009747608 6:67838928-67838950 TTAATGTGCTAGGAATCACCTGG - Intergenic
1010490931 6:76476144-76476166 TTGCTGAGCTAGGATCAACATGG + Intergenic
1015370767 6:132449431-132449453 TTCCAGAGCTAAGAAAAGCCTGG - Exonic
1015751629 6:136565859-136565881 TTACTGAAAAAGGAAAAACGAGG + Intronic
1016727941 6:147396857-147396879 TAACCGAGCAAGGAAAAACAAGG + Intergenic
1017230055 6:152064077-152064099 TTACTTTGCTTGCAAAAACCCGG + Intronic
1019109078 6:169695339-169695361 TTACTGAGCTGGGGAAGAACAGG + Intronic
1019283733 7:213513-213535 TTACTTAGCCATGAAAAACAGGG - Intronic
1020569325 7:9838601-9838623 TAGCTGAGCCACGAAAAACCTGG + Intergenic
1023557531 7:41438652-41438674 TTACTGTGCTAAGAAAAGCAAGG + Intergenic
1026908594 7:74079107-74079129 TTACTGAGATAAGAAACACCTGG + Intergenic
1028897400 7:96057534-96057556 TTATTGAGCCAGAAAAAACCTGG - Intronic
1029807172 7:103009885-103009907 CTACTGTCCTAGGAAACACCTGG + Intronic
1029938982 7:104459593-104459615 TTACACAGCTAGGAACAACATGG - Intronic
1033119471 7:138654196-138654218 CTACTGATCTAGCAAACACCAGG - Intronic
1038796929 8:30718365-30718387 TAACTGAGCTAGGAGAAATTTGG - Intronic
1039158775 8:34593981-34594003 TGACTGAGCTATTAAACACCTGG + Intergenic
1040702684 8:50086559-50086581 TTATAGAGATAGGAAATACCAGG + Intronic
1041004821 8:53487598-53487620 TTGCTGAACTCGTAAAAACCAGG - Intergenic
1041371950 8:57171244-57171266 TAACTGAGCTAGGAAGGACAAGG - Intergenic
1042583768 8:70312082-70312104 TCACTTAGCCAAGAAAAACCTGG + Intronic
1043416078 8:80051498-80051520 TTAATGAGCAAGGAAAAATGAGG + Intronic
1043914299 8:85903084-85903106 TTTCTGAGCTCAGAAAAACCAGG + Intergenic
1044719294 8:95130261-95130283 TTACTGAGATGGGCAAAACTGGG + Intergenic
1046900145 8:119515115-119515137 TTACTGAGCTAGGAATAGTACGG + Intergenic
1047308035 8:123669038-123669060 TTACTGAGATAGGGAAAACTGGG + Intergenic
1048903541 8:139064161-139064183 TAACTGAGATAGGGTAAACCTGG + Intergenic
1050628928 9:7538338-7538360 TGACAGAGCTGGGAAAACCCAGG - Intergenic
1052030031 9:23618227-23618249 ATACTGAGCTAGACAAATCCTGG + Intergenic
1052343359 9:27384412-27384434 TTACTGAGCTCTGAAATAACAGG - Intronic
1052973897 9:34398322-34398344 TTAGTGAGCACGGAGAAACCTGG + Exonic
1055861499 9:80755395-80755417 GTAAAGAGCTAGGAAAAACCAGG + Intergenic
1055990752 9:82102685-82102707 TTGCTGGGCCAGGAGAAACCAGG - Intergenic
1056829237 9:89901186-89901208 TTTCTGAGATAGTAAAGACCAGG + Intergenic
1057416921 9:94872037-94872059 TTGCTGAGCTAGAAAAAACTAGG - Intronic
1059548958 9:115208295-115208317 TGACTGTGCTAGGAGAACCCTGG + Intronic
1060242438 9:121915595-121915617 ATATTGAGCTGGGAAATACCAGG - Intronic
1060602033 9:124884791-124884813 TTACTGAGTGAGGAAAATCCAGG - Intronic
1062234780 9:135502577-135502599 TTACTGAGATGGTGAAAACCAGG + Intronic
1185489180 X:507764-507786 TCTCTGAGCTTGGAATAACCGGG - Intergenic
1185842514 X:3405613-3405635 GTACTGTGCTGGGAAAAAGCGGG + Intergenic
1186803271 X:13114667-13114689 TGACTGTGGTAGGTAAAACCAGG - Intergenic
1188399832 X:29730875-29730897 TCACTGAGCTAGGAGAAATCAGG - Intronic
1189669546 X:43393406-43393428 TTAGTGAGCTAGCAAACCCCAGG - Intergenic
1190922901 X:54873383-54873405 TTACTGAGCTAGAAAAGACAGGG + Intergenic
1191938604 X:66453390-66453412 TCACTGTCCTAGGACAAACCTGG + Intergenic
1194695545 X:97045234-97045256 TTATTGAGAAAGGAAAAACTTGG + Intronic
1195245675 X:102992976-102992998 TCACTGAGTTAGGAACATCCTGG - Intergenic
1195661529 X:107383913-107383935 TTAATGAGCTAGGATAAAAAGGG + Intergenic
1197957903 X:131972735-131972757 TTACTGAGATAGAAAAGACTAGG + Intergenic
1199169906 X:144722907-144722929 GTACTGTTGTAGGAAAAACCAGG - Intergenic
1199762024 X:150912250-150912272 GTACTGAGGTAGGAAAAGCTCGG - Intergenic
1199883519 X:151995819-151995841 TTACTGAGGTCAGGAAAACCTGG + Intergenic
1199987669 X:152964150-152964172 TTACAGAGATAGGAAAAAGGAGG - Intronic
1201576285 Y:15465018-15465040 TTACAGAGCTATGAAAACCATGG - Intergenic
1201922739 Y:19252441-19252463 TTGCTTATCTAGGAAAAACAGGG + Intergenic