ID: 947408647

View in Genome Browser
Species Human (GRCh38)
Location 2:229809698-229809720
Sequence TCTTCAGGACCACTCAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947408645_947408647 4 Left 947408645 2:229809671-229809693 CCAATCTTATTTAGGGAAAGAGC 0: 1
1: 0
2: 0
3: 9
4: 123
Right 947408647 2:229809698-229809720 TCTTCAGGACCACTCAAAATAGG 0: 1
1: 0
2: 0
3: 7
4: 122
947408644_947408647 5 Left 947408644 2:229809670-229809692 CCCAATCTTATTTAGGGAAAGAG 0: 1
1: 0
2: 5
3: 16
4: 180
Right 947408647 2:229809698-229809720 TCTTCAGGACCACTCAAAATAGG 0: 1
1: 0
2: 0
3: 7
4: 122
947408643_947408647 10 Left 947408643 2:229809665-229809687 CCTTTCCCAATCTTATTTAGGGA 0: 1
1: 0
2: 0
3: 13
4: 136
Right 947408647 2:229809698-229809720 TCTTCAGGACCACTCAAAATAGG 0: 1
1: 0
2: 0
3: 7
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947408647 Original CRISPR TCTTCAGGACCACTCAAAAT AGG Intronic
904586655 1:31584510-31584532 TCTTCAACACAAGTCAAAATTGG + Intronic
907940248 1:59080588-59080610 TTTTCAGGACCAGTCAAACTAGG + Intergenic
908431801 1:64065859-64065881 TCTTCAGAACCACTAACTATCGG - Intronic
908760062 1:67503514-67503536 TGTTCAGGCTCACTCAACATGGG - Intergenic
909419950 1:75452238-75452260 TCTTTAAGAACACTGAAAATAGG - Intronic
911932158 1:103918674-103918696 TCTTAGGAACAACTCAAAATTGG - Intergenic
915875054 1:159603799-159603821 TCTTCTGCATCACTCACAATGGG - Intergenic
920817945 1:209352972-209352994 TGTTCAAGACCACACAAAAATGG + Intergenic
922722181 1:227904761-227904783 GCTCCTGGACCACTCAACATGGG + Intergenic
923739121 1:236639727-236639749 TCCTCAGGATCATTAAAAATAGG + Intergenic
1067975438 10:51019595-51019617 TCTTGAGGATGACACAAAATAGG + Intronic
1068757569 10:60671731-60671753 TCTCTAGGACCACTCACAGTGGG + Intronic
1068886305 10:62100596-62100618 TTTTGATGACCAATCAAAATAGG + Intergenic
1069419059 10:68230095-68230117 CCATCAAGACCAATCAAAATGGG - Intergenic
1072768559 10:98116671-98116693 TCCTCAGGACACCTTAAAATTGG - Intergenic
1074468936 10:113709224-113709246 TCCACAGGACCATTCAAACTCGG - Intronic
1076131765 10:128018446-128018468 TCTTGTGGTCCAATCAAAATAGG + Intronic
1085235149 11:75008867-75008889 TCTTTAGGACTACTCAAGAAGGG + Exonic
1087966275 11:104420208-104420230 TTTTCAGAAGCACTCAAGATAGG + Intergenic
1092608916 12:10151807-10151829 TCTTTAAGAACACTGAAAATAGG + Intergenic
1092919447 12:13218089-13218111 TCTCCATGACCACTCAAGAATGG + Exonic
1095862756 12:46936685-46936707 TCTTTGTGACCACTGAAAATGGG + Intergenic
1099572847 12:84347267-84347289 TCTTTAAGATCACTGAAAATAGG + Intergenic
1099849885 12:88080310-88080332 TCTTCTGGACCAGTCACAAAAGG - Exonic
1103214508 12:119191241-119191263 TCTTCCTGACCACACAACATGGG - Intronic
1104493108 12:129211690-129211712 ACTTCAGGAGCATTCCAAATTGG - Intronic
1104619950 12:130303368-130303390 TCTTCAGGGCCATTCAAAGAGGG - Intergenic
1105654802 13:22424703-22424725 TCTTCAGCCCCATTCAAAATTGG - Intergenic
1105838767 13:24234831-24234853 GCTTCCTGACCACTCAAATTGGG - Intronic
1106206895 13:27606282-27606304 TCTTCATGATAACTTAAAATAGG - Intronic
1108166816 13:47701786-47701808 TTTTGAGCACCACTCAAAACTGG - Intergenic
1108398240 13:50011056-50011078 TCTTCATCACCACCCAAATTGGG - Intronic
1113739777 13:112703366-112703388 TCTTCAGGTCCAATCACATTAGG + Intronic
1114003173 14:18283376-18283398 TCCTTAAGACCACTCAATATTGG + Intergenic
1114351332 14:21854904-21854926 TCTGCAGTACCACGCAAAAATGG - Intergenic
1116755476 14:48942639-48942661 TCATCAGTACTACTCAAAACTGG - Intergenic
1117256535 14:53984012-53984034 TCTTCAGAATCAAACAAAATAGG + Intergenic
1118110561 14:62713873-62713895 TATTCAGTGTCACTCAAAATTGG - Intronic
1118945898 14:70387217-70387239 TCTTCAGGACTAGTGAAAAATGG - Intronic
1119620987 14:76131650-76131672 CCTTCAGCTCCACTTAAAATGGG + Intergenic
1121556946 14:94845332-94845354 TCCCCAGGGCCATTCAAAATGGG - Intergenic
1123459484 15:20456282-20456304 TGTTCAGGAACAATCAAATTAGG + Intergenic
1123658577 15:22544139-22544161 TGTTCAGGAACAATCAAATTAGG - Intergenic
1124265715 15:28232108-28232130 TGTTCAGGAACAATCAAATTAGG + Intronic
1124312442 15:28638632-28638654 TGTTCAGGAACAATCAAATTAGG - Intergenic
1125238249 15:37541657-37541679 TCTTTAAGAACACTGAAAATAGG - Intergenic
1126198576 15:45958592-45958614 TCTTCTGTACAACTAAAAATGGG - Intergenic
1127195552 15:56582061-56582083 TCTATAGGACCACTAAAAAATGG + Intergenic
1136703894 16:32169506-32169528 TGTTCAGGAACAATCAAATTAGG + Intergenic
1137498262 16:48988130-48988152 TCTCCATAACCACTCAAAATTGG - Intergenic
1139454190 16:67059020-67059042 TCTTTAGAATCACTCAAAAGAGG + Intronic
1140302351 16:73770729-73770751 TCTTCTGCACCCCTCAAAGTAGG + Intergenic
1203066162 16_KI270728v1_random:1020222-1020244 TGTTCAGGAACAATCAAATTAGG - Intergenic
1143421968 17:6800539-6800561 TCTTTAGAATCACTCAATATTGG + Intronic
1160147136 18:76375046-76375068 TATTCAGCAACACTCAAAAAAGG + Intronic
1163989316 19:20983635-20983657 TCTTCATGTCCAATCAAGATGGG - Intergenic
1165527037 19:36364826-36364848 TCTTAAGGAAAGCTCAAAATAGG + Intronic
1168298286 19:55388601-55388623 TCTTCAGGCCACCTCACAATGGG - Intronic
1168460527 19:56552601-56552623 ACTTCTAGACCACACAAAATTGG - Intronic
1168672457 19:58250990-58251012 TATACAGGACCACGCATAATGGG - Intronic
926395077 2:12432674-12432696 TCTGCAGGACAATTTAAAATTGG - Intergenic
927783083 2:25954845-25954867 TCTTCAGGGGCTCTCAAAAGTGG + Intronic
930679413 2:54240573-54240595 TTTTGAGGACCAATAAAAATGGG - Intronic
936018554 2:108977579-108977601 ACTTCAGGAACACTCAAAAAAGG - Intronic
937321697 2:120964758-120964780 TCTTCAGAGCCACTGAAAGTGGG + Intronic
938752741 2:134349708-134349730 CCTTCAAGACTACTAAAAATAGG - Intronic
941441967 2:165549635-165549657 TCTTCACTAACACTCAAACTGGG + Intronic
947386011 2:229591141-229591163 TCTTCATAACCACTCAAGAATGG + Intronic
947408647 2:229809698-229809720 TCTTCAGGACCACTCAAAATAGG + Intronic
1180427688 22:15214177-15214199 TCCTTAAGACCACTCAATATTGG + Intergenic
950138789 3:10601249-10601271 ACTCCAGGAACACTCAGAATTGG + Intronic
954695134 3:52420182-52420204 CATTCAGGACCACTGAAGATAGG + Intronic
954999900 3:54918031-54918053 TCTTCCCAAGCACTCAAAATTGG + Intronic
955448630 3:59042320-59042342 TCTTCAAGACCCCACATAATTGG - Intronic
964141851 3:153411216-153411238 TCTTAAGGAGCTCTCAAAACAGG - Intergenic
970749681 4:19342598-19342620 GCCTCAGGACCACACAAATTTGG - Intergenic
974718078 4:65697616-65697638 TGTTTAGGCCCACTCAAACTTGG - Intergenic
976888874 4:90020529-90020551 TTATCAAGACCACACAAAATTGG - Intergenic
977071793 4:92399349-92399371 CCTTCAGGCCCACTCCTAATTGG + Intronic
977251184 4:94691526-94691548 TCTACAGAACCTCTCAAAAGGGG - Intergenic
979363198 4:119788860-119788882 TCTTATGGACTACTCAGAATGGG - Intergenic
979626235 4:122848346-122848368 TCTTCAGGATTTCTGAAAATAGG + Intronic
980418712 4:132529457-132529479 TGTGATGGACCACTCAAAATTGG - Intergenic
982353165 4:154438249-154438271 TCTTTATTATCACTCAAAATGGG - Intronic
986037294 5:3952426-3952448 TCTTCTGGACCCCTCCATATGGG + Intergenic
986462148 5:7983409-7983431 TTCTCTTGACCACTCAAAATAGG + Intergenic
986635347 5:9816697-9816719 TCTTAAAGACCTTTCAAAATAGG - Intergenic
990198001 5:53340736-53340758 TTTTTAGCACCACGCAAAATAGG + Intergenic
991192269 5:63888553-63888575 TCTTCAGGCCAACTCACATTTGG - Intergenic
991346414 5:65673513-65673535 TCTTGAGGAGCACTCAACCTAGG - Intronic
993838754 5:92849576-92849598 TTTTCAATACCACTCAAAATAGG + Intergenic
1003823406 6:9925427-9925449 TCTTCAGGAATAGCCAAAATAGG - Intronic
1005404181 6:25467914-25467936 ACTTCAGTACCAATCAAAAGGGG - Intronic
1005656740 6:27946420-27946442 TCTTTAGGACCACTCATGAGTGG + Intergenic
1007027362 6:38590000-38590022 TCTTTAGGACCAGTCAAAGCTGG - Intronic
1008879697 6:56368776-56368798 TCCTCAGCACCACTGAGAATAGG - Intronic
1008951796 6:57169884-57169906 TCTGCAGGAGCTCACAAAATGGG + Exonic
1010243751 6:73643109-73643131 TCTTCGTGAGCACTGAAAATGGG + Intronic
1014296418 6:119624008-119624030 TCTTAGGAAACACTCAAAATGGG - Intergenic
1014421961 6:121257323-121257345 TCTTTAGCACCACTAAAATTGGG - Intronic
1015053985 6:128876909-128876931 TACTCAGGTGCACTCAAAATGGG + Intergenic
1016348580 6:143142548-143142570 TCCTCAGGCCCACTCAGAAAGGG - Intronic
1016834476 6:148463567-148463589 TCTTTATGACCACTAAAAATCGG + Intronic
1020651979 7:10886555-10886577 ATTTCAGGAGTACTCAAAATGGG + Intergenic
1023126781 7:36962183-36962205 TCTTCAGGGGCCCCCAAAATGGG - Intronic
1024459110 7:49641880-49641902 TCATCAAAACAACTCAAAATTGG + Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1024551547 7:50566505-50566527 TCCTAAGGACCATTCAAAGTAGG + Intergenic
1028649161 7:93131296-93131318 TATTCAGGTCCACTCAGAAGTGG - Exonic
1028724717 7:94074197-94074219 TCTTTATGACCACAAAAAATAGG + Intergenic
1029089231 7:98035208-98035230 TCTCCAGGCCCACTGACAATTGG + Intergenic
1030207785 7:106967273-106967295 TCTCCAGGACCACAGAAAAGAGG + Intergenic
1030452262 7:109727072-109727094 TCATCAGGTTCACTCAAAAAGGG - Intergenic
1032001790 7:128270743-128270765 GCCTCAGGACCATTTAAAATAGG + Intergenic
1032010136 7:128340801-128340823 TCTTTAGAACACCTCAAAATAGG + Intronic
1035987444 8:4450257-4450279 TCTTCAGGAGCACACAACATGGG + Intronic
1042656250 8:71100700-71100722 TGTTCAGGACCACAAAAATTGGG + Intergenic
1046883823 8:119340644-119340666 TATTCTGGACCCCTCAAAACTGG - Intergenic
1048070617 8:131017027-131017049 CCTTGAGGACCACTCCAACTTGG + Intronic
1051730346 9:20135891-20135913 TCTTGATTTCCACTCAAAATTGG + Intergenic
1061870541 9:133517990-133518012 ACTTCAGGTCCACTCCAAAGAGG + Intronic
1062487668 9:136788189-136788211 TATTCTGGACCACTAAAATTGGG - Intergenic
1186839079 X:13467092-13467114 TCTTATGGCCCACTCAAAAAGGG + Intergenic
1187115388 X:16344863-16344885 TCTTTAAGAACACTGAAAATAGG + Intergenic
1188257059 X:27975907-27975929 ACATCAGGAAAACTCAAAATAGG + Intergenic
1188625317 X:32277017-32277039 TCTTGAGGTCAACACAAAATTGG - Intronic
1189045900 X:37590695-37590717 TCTTCAGTACCACACCAACTGGG + Intronic
1198452565 X:136782028-136782050 TTTTCAGAACCACTTGAAATAGG + Exonic
1199322554 X:146457296-146457318 TCTTCAAGAATACTGAAAATAGG - Intergenic
1199383449 X:147196658-147196680 TCTTCAGTACCACACTATATTGG + Intergenic