ID: 947420447

View in Genome Browser
Species Human (GRCh38)
Location 2:229937625-229937647
Sequence AAGCCAACACTGCTGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947420447 Original CRISPR AAGCCAACACTGCTGAAGCA GGG (reversed) Intronic
900002747 1:23842-23864 AAGCCAGCATGGCTGGAGCACGG - Intergenic
900022467 1:194367-194389 AAGCCAGCATGGCTGGAGCACGG - Intergenic
901422051 1:9157745-9157767 AGGCCAACACAGCTAAAGTAGGG + Intergenic
901715654 1:11151627-11151649 ACGCCAAAACTGCTGGACCAGGG + Intronic
904026684 1:27508291-27508313 AAGCCCACACTCCTCAACCAAGG + Intergenic
906394586 1:45450950-45450972 AAGCCACCACTGCCAAACCAAGG + Intronic
907249605 1:53129468-53129490 AAGCCACCACTGGTCAAGCGTGG + Intronic
908774353 1:67625876-67625898 AAGTCATGACTGATGAAGCAAGG + Intergenic
909727694 1:78855310-78855332 CAGGCAACACTGCTGAATCTTGG - Intergenic
912548332 1:110466944-110466966 AAGGCAGCAATCCTGAAGCAGGG - Intergenic
916682142 1:167114465-167114487 AAGTGCACACTGATGAAGCAGGG + Intronic
918671875 1:187227841-187227863 AAGCGAACACTGATGAAGCCAGG + Intergenic
919705883 1:200675166-200675188 AAGCCAGACCTGCTGAATCAGGG + Intergenic
920039856 1:203088553-203088575 AAGCCAAAACTGCTGAAGACTGG + Intergenic
921082838 1:211756833-211756855 AAGCAAACACTGTTGTAGAAGGG - Intronic
921755943 1:218855840-218855862 AACCCAAGAGAGCTGAAGCATGG + Intergenic
1063517658 10:6712369-6712391 AAGACAACAATGCTGGAGCTGGG - Intergenic
1073268497 10:102242408-102242430 AAACCAGCCCTGCTGAAGGAGGG - Intergenic
1073477594 10:103764398-103764420 GAGGGAACCCTGCTGAAGCAAGG + Intronic
1076564349 10:131387839-131387861 AAGGCAAAACTGTGGAAGCAGGG - Intergenic
1083094326 11:60233876-60233898 AACCTAACAGAGCTGAAGCACGG + Intronic
1083099458 11:60288001-60288023 AACCTAACAGAGCTGAAGCATGG - Intronic
1086213716 11:84351774-84351796 AACCTAAATCTGCTGAAGCAAGG - Intronic
1090358754 11:126158352-126158374 GAGACCACACTGCTGGAGCAGGG - Intergenic
1091376165 12:25905-25927 AAGCCAGCATGGCTGGAGCACGG - Intergenic
1094516109 12:31128544-31128566 AAGCTTACACTGCTGAGGAATGG - Intergenic
1095783088 12:46082223-46082245 AAATCAACACTGCTGGAGTATGG + Intergenic
1096203001 12:49699211-49699233 CAGCCAACACTGCTGTCCCATGG + Intronic
1097208105 12:57341238-57341260 AAGTCAGAATTGCTGAAGCAGGG - Intronic
1097954066 12:65465266-65465288 AAGTCAACATTGCTGTAGCCAGG + Exonic
1099565044 12:84231504-84231526 AAGCCACCACTGATGGGGCATGG + Intergenic
1100333349 12:93606550-93606572 AAGCAAACACTGATGAGGTATGG - Intergenic
1100431662 12:94536287-94536309 AAGCCAGTGCGGCTGAAGCAGGG - Intergenic
1100738245 12:97562109-97562131 AAGCCAACATTGCTGAAGGTTGG - Intergenic
1101214666 12:102568556-102568578 AAGCCATCACTGCTGAATAATGG - Intergenic
1102815608 12:115863217-115863239 CAGCCATCAATGCTCAAGCAGGG - Intergenic
1104442198 12:128802891-128802913 CAGCCAACACTGCGGAAACCAGG + Intronic
1104527475 12:129537776-129537798 AAGCCAAGAATGCGGAAGCATGG + Intronic
1104529486 12:129555404-129555426 AATCCAACTCTGCTCAAGCAGGG - Intronic
1105026551 12:132853009-132853031 AAGCCAACTCTGGTGACGCAGGG + Intronic
1113527725 13:110993973-110993995 CAGCCAACACTGCAGCTGCAGGG + Intergenic
1114617077 14:24074075-24074097 AAGCCATTATTGCTGAAGAATGG + Exonic
1115924217 14:38412866-38412888 CAGCCAACACTGCAGCTGCAGGG + Intergenic
1118914712 14:70093189-70093211 TAGCCAACACTTCTGCAGCATGG - Intronic
1120096001 14:80388355-80388377 AAGCAGACACGGCTGAATCAAGG - Intergenic
1120639649 14:86995277-86995299 AAGCCAATGCTGCTCAGGCAAGG + Intergenic
1124434514 15:29635825-29635847 GAGCCTCCACTGCTGAGGCAAGG + Intergenic
1127617193 15:60698140-60698162 AAGACATCTCAGCTGAAGCATGG - Intronic
1129152158 15:73696044-73696066 CATCCAACCCTGCAGAAGCAGGG - Intronic
1129379269 15:75155073-75155095 AAGCCAGAAGTGCTGAAGCCTGG + Intergenic
1131306008 15:91243776-91243798 AATCCAATGCTGCTGAAGCAAGG + Intronic
1132450764 15:101967097-101967119 AAGCCAGCATGGCTGGAGCACGG + Intergenic
1135749321 16:25044301-25044323 CAGCCAACACTACTGAAGACAGG - Intergenic
1135831131 16:25774478-25774500 AAACCACCATTGCTGTAGCAAGG - Intronic
1135992082 16:27224398-27224420 ATGCCCCCACTGCTGCAGCAGGG - Intergenic
1137949610 16:52771229-52771251 AATCCAAAACTCCTGGAGCAGGG - Intergenic
1139400082 16:66674363-66674385 AGGCCAACACTGCAGAGACAGGG + Intronic
1141835091 16:86533033-86533055 CAGCCAAAAATGCAGAAGCAAGG + Intronic
1147385556 17:40079356-40079378 CAGCTACCAATGCTGAAGCAGGG - Intronic
1148434132 17:47668332-47668354 AAGCCATCACTGCTGCATCCCGG - Exonic
1148464329 17:47855931-47855953 CAGCCAACTCTGCGGAAGGAAGG - Intergenic
1149983939 17:61333045-61333067 AAACCTACACTGCTGCAGCCTGG + Intronic
1158380653 18:56926305-56926327 AAGCCAACACTGTTGATGTGTGG - Intronic
1160634498 19:65450-65472 AAGCCAGCATGGCTGGAGCACGG - Intergenic
1166325270 19:42046108-42046130 AAGGCCACCCAGCTGAAGCAGGG + Intronic
1166976147 19:46606158-46606180 AAGCCAACCTGGCTGAAGCTGGG - Intronic
1168062879 19:53903268-53903290 AAGACAACACTTCAGAACCATGG - Intronic
1168523123 19:57068512-57068534 AAGCCAATCCTGCTGACGCGTGG - Intergenic
925274556 2:2639497-2639519 AAGCTCACACAGATGAAGCAAGG - Intergenic
925753688 2:7112108-7112130 AAGCAAACACTGAGGAAGCCTGG + Intergenic
925989881 2:9246077-9246099 AAGCCAACACTCCCAAACCAGGG - Intronic
926365912 2:12133120-12133142 AAGGCAGCACCGCAGAAGCAGGG - Intergenic
927440804 2:23115764-23115786 AAGCCAATGGTGCTGATGCAAGG + Intergenic
936566977 2:113589577-113589599 AAGCCAGCATGGCTGGAGCACGG + Intergenic
939900909 2:147848323-147848345 AAGCCAACAGTTCTCAAGCTGGG + Intronic
940773299 2:157860947-157860969 ATGCCATCACTGCTGACCCAAGG + Intronic
941266972 2:163374533-163374555 AAGCCAACACAGATGGAGTAGGG + Intergenic
943440758 2:187924747-187924769 AAGCCAAAACTCCAGAAACAAGG - Intergenic
945493947 2:210487253-210487275 AAGCCAACAGGGAAGAAGCAGGG - Intronic
947420447 2:229937625-229937647 AAGCCAACACTGCTGAAGCAGGG - Intronic
947747259 2:232514924-232514946 AAGGGAGCACTGCTGAAGCTGGG - Intergenic
948627622 2:239278851-239278873 AAGACCACACTCCTGAAGCCAGG + Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169109964 20:3026263-3026285 AAGCCAACGCTGCTGGTGTATGG + Intronic
1172453834 20:35050295-35050317 AATCAAACAGTGCCGAAGCATGG + Intronic
1175221239 20:57417674-57417696 AAGCTAACTCTGCTGGAGTAGGG - Intergenic
1175983160 20:62751498-62751520 AAGCCAGCACCGGTGAAGCGGGG - Intronic
1179507110 21:41848655-41848677 AAGCCACCACTTCTGAATAAGGG + Intronic
1181938091 22:26453249-26453271 AAGCAGAAGCTGCTGAAGCACGG - Exonic
1185049879 22:48548480-48548502 AAGCCACCACTGCTGACCCAGGG - Intronic
950037499 3:9897650-9897672 AAGCCAACACTGCTCAACAAGGG - Intergenic
950499456 3:13354494-13354516 ACGTCAACAGTGCTGAAGCTGGG + Intronic
951459251 3:22931603-22931625 TAGTCGTCACTGCTGAAGCATGG - Intergenic
951953534 3:28228449-28228471 ATGCTAACACTGCTGAACCTGGG - Intergenic
952965059 3:38616055-38616077 AAGCAAGGACTGTTGAAGCAAGG - Intronic
955047886 3:55377011-55377033 AAGCCAACACAGAGGAAGTAGGG - Intergenic
955598052 3:60613311-60613333 GAGCCACCACTGCTGAGGCAGGG + Intronic
955871301 3:63441589-63441611 AAGTGAACACATCTGAAGCAGGG - Intronic
956702398 3:71969981-71970003 AAACCAGCACTGCTGCAGCTGGG - Intergenic
965148136 3:164932858-164932880 AAGCCATCTCTGCAGAATCATGG + Intergenic
968531556 4:1094541-1094563 GAGCCAACACTGCCACAGCAGGG + Intronic
973947227 4:55970629-55970651 AAGCCAACACTACTAAAACTTGG - Intronic
975441369 4:74414438-74414460 GAGGCAACATTGCTGGAGCATGG - Intergenic
976120440 4:81774796-81774818 AAGCCAACACTGCTTTGGAAGGG - Intronic
979885893 4:126026965-126026987 AAGCCAAGACATCTGAGGCAGGG + Intergenic
980526658 4:133997274-133997296 AAGCCAAGACAGCAGAAGCTAGG + Intergenic
982662159 4:158220147-158220169 AAGCCATCATTGCTGAAGGAAGG - Intronic
982722128 4:158869783-158869805 AATCCACCACCTCTGAAGCAAGG - Intronic
982764721 4:159332613-159332635 AAGCCAACACTGTGGGAGGAAGG + Exonic
982794932 4:159632894-159632916 AACTCAACTCTGCTGAAGCGAGG - Intergenic
983485124 4:168323853-168323875 TAGCCAACAGTGCTGATGCTTGG + Intergenic
984006287 4:174313982-174314004 AAGCCAATACTTCTAAATCAAGG - Intronic
984593748 4:181644504-181644526 AAGACAAGATTGCAGAAGCATGG - Intergenic
986412204 5:7492390-7492412 ATGGCAAAACTGCTGAAACATGG - Intronic
986637061 5:9833918-9833940 AAGCCAACACTGATGCCTCAGGG - Intergenic
986743577 5:10725100-10725122 AAACAAACACGGCTGAAGAATGG - Intronic
987033314 5:13995824-13995846 CAGTCAACTCTGCTGAAGGAAGG - Intergenic
988458380 5:31409100-31409122 CAAGCAACACTGCTGAAGCTGGG + Exonic
989161823 5:38398648-38398670 GAGCCAGCACAGCTGGAGCACGG + Intronic
991441568 5:66655808-66655830 AGGCCAACCTAGCTGAAGCATGG + Intronic
991507625 5:67342039-67342061 AAGCCAATGCTGCTGATTCATGG + Intergenic
993256005 5:85590921-85590943 ATGTCAACAGTGCTGAAGTATGG - Intergenic
994255381 5:97587301-97587323 AAGCAAACAGTGATGAGGCAAGG + Intergenic
994711723 5:103273594-103273616 AAGCCAATCCTGCTGCATCAAGG - Intronic
994862092 5:105209834-105209856 AAAAAAACACAGCTGAAGCATGG - Intergenic
995374814 5:111462063-111462085 AAGCCAACATGGCTGGAGCATGG - Intronic
996432116 5:123392798-123392820 AAGCAAACATTGGTGGAGCATGG - Intronic
999446214 5:151641779-151641801 AATCGATCACTGCTGAAGCTAGG + Intergenic
1007243816 6:40445666-40445688 AAGCCAGCACTTCTCAAGCCGGG - Intronic
1007787198 6:44287456-44287478 GAGCCAAGACTGCAGAAGCTGGG - Intronic
1008860896 6:56148943-56148965 AATCTAACACTCCAGAAGCAGGG + Intronic
1009684058 6:66933911-66933933 AATCGAAAACTGATGAAGCAGGG - Intergenic
1010282968 6:74041552-74041574 CAGCCAACACTGCAGCTGCAGGG - Intergenic
1015061205 6:128968559-128968581 AACCCAACACTTCTTTAGCAGGG - Intronic
1016882739 6:148927053-148927075 AAGACATTACTGCTGGAGCATGG + Intronic
1017630246 6:156389878-156389900 CAGCCATCACTGCTAAAACAGGG + Intergenic
1018583302 6:165327020-165327042 AAGCCATCACTGCGGCACCACGG + Intergenic
1019973567 7:4561910-4561932 GAGCCAATCCTGCTGCAGCAGGG - Intergenic
1023483862 7:40663780-40663802 ATGCCAACACTGCTGGGCCATGG - Intronic
1023621513 7:42077965-42077987 GAGCCAACACTGCTGAGGATTGG + Intronic
1030785082 7:113650193-113650215 AAGCCAACTTTGCTGAAGACAGG - Intergenic
1032665865 7:134035744-134035766 AAGCCAACACACCTTAAGGAAGG - Intronic
1037045461 8:14296199-14296221 AAGCCAACACTCTTGAAGCAAGG + Intronic
1039334517 8:36574758-36574780 AAGCCTTCACTGTTGAAGAAAGG - Intergenic
1042741953 8:72059038-72059060 AAGCCACCAGGGCTGAAGAAGGG + Intronic
1044737060 8:95289742-95289764 AAGCCAACACTGAACATGCATGG - Intergenic
1045036032 8:98177113-98177135 ATGCCAAGGCTGCCGAAGCAGGG - Intergenic
1045239276 8:100384719-100384741 AAACCCACTCTTCTGAAGCACGG - Intronic
1047928495 8:129703515-129703537 AAGCTAACACAGCTCTAGCATGG - Intergenic
1049885552 9:23955-23977 AAGCCAGCATGGCTGGAGCACGG - Intergenic
1050649533 9:7760345-7760367 AAGCCAACATTGCAGCAGCTGGG + Intergenic
1051965566 9:22824813-22824835 AAGACTACACTGTGGAAGCAGGG - Intergenic
1052115729 9:24646554-24646576 TAGCCAACACTGTGGATGCAGGG - Intergenic
1052446886 9:28574537-28574559 AAGCCAAAACTGATGGTGCAGGG + Intronic
1053393981 9:37755622-37755644 AAGCTAACACTCCTGAAGGCGGG - Intronic
1055648065 9:78379426-78379448 AACTCAACTCTGCTGAAGCAGGG + Intergenic
1055758394 9:79580124-79580146 AAAGCAAAACTGCCGAAGCATGG + Intronic
1057281307 9:93713452-93713474 GAGCCCACACTGTTGGAGCAGGG - Intergenic
1057439127 9:95069646-95069668 AAGACCACACAGGTGAAGCAAGG + Intronic
1057504123 9:95618522-95618544 AAGCCACCACTGCTCCAGCCTGG - Intergenic
1058513330 9:105743033-105743055 ATCCAAACACTGTTGAAGCAAGG - Intronic
1186776822 X:12873059-12873081 GGGCCAATATTGCTGAAGCAGGG - Intronic
1188024776 X:25196643-25196665 AAACCAACAGTGCTGGGGCAGGG + Intergenic
1189501266 X:41561338-41561360 AAGCCCACACTGCTAAAGACAGG + Intronic
1193227239 X:78998415-78998437 CAGCCAACACTGCAGGTGCAGGG + Intergenic
1194665003 X:96667712-96667734 AAACCAACCCTGCTGATGCCTGG - Intergenic
1195687710 X:107601310-107601332 AAGCCCACCCTGCAGAAGCAGGG + Exonic
1197124170 X:122924883-122924905 CAGCCAACACTGCAGCTGCAGGG - Intergenic
1200875991 Y:8155321-8155343 AAGCCCTCACTGCTGGTGCATGG + Intergenic
1200986157 Y:9304864-9304886 CAGCCAGGACTGCTGAGGCAGGG + Intergenic
1201057638 Y:10011569-10011591 AGGCCCACACTGCTGGTGCATGG - Intergenic
1202124426 Y:21556038-21556060 CAGCCAGGACTGCTGAGGCAGGG - Intergenic
1202154582 Y:21873342-21873364 CAGCCAGGACTGCTGAGGCAGGG + Intergenic