ID: 947421169

View in Genome Browser
Species Human (GRCh38)
Location 2:229942642-229942664
Sequence GTGGAGCAGCAAGTAGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947421169_947421176 14 Left 947421169 2:229942642-229942664 CCAGTGCCTACTTGCTGCTCCAC 0: 1
1: 0
2: 0
3: 24
4: 188
Right 947421176 2:229942679-229942701 CTTGTCTCCCACCACGTCTCTGG 0: 1
1: 0
2: 4
3: 9
4: 136
947421169_947421177 15 Left 947421169 2:229942642-229942664 CCAGTGCCTACTTGCTGCTCCAC 0: 1
1: 0
2: 0
3: 24
4: 188
Right 947421177 2:229942680-229942702 TTGTCTCCCACCACGTCTCTGGG 0: 1
1: 0
2: 1
3: 15
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947421169 Original CRISPR GTGGAGCAGCAAGTAGGCAC TGG (reversed) Intronic
901431249 1:9216345-9216367 GTGGAGAAGGAAGAAGACACAGG - Intergenic
902837899 1:19058521-19058543 GTCGAGCAGCATGGAGTCACTGG - Intergenic
902991524 1:20190856-20190878 CTGCAGCAGCAAGTACCCACTGG + Exonic
904286520 1:29456211-29456233 GTGGAGGGGCAAGAAGGAACAGG + Intergenic
905287163 1:36889052-36889074 GTGGAGCAGTAAAAAGACACGGG + Intronic
905790835 1:40788444-40788466 GTGCAGCACCAACTATGCACAGG + Intronic
906745089 1:48215874-48215896 GTTGAGCAGCCAGGAAGCACAGG + Intergenic
912052897 1:105553068-105553090 CTAGAGCAGCAACTAGGCACAGG - Intergenic
913973068 1:143431082-143431104 TTGGAGCAGTAAGTTAGCACTGG + Intergenic
914067452 1:144256689-144256711 TTGGAGCAGTAAGTTAGCACTGG + Intergenic
914111701 1:144709665-144709687 TTGGAGCAGTAAGTTAGCACTGG - Intergenic
915553868 1:156650547-156650569 GTGGTGGGGCAAGTAGGCAAGGG - Intronic
916749946 1:167714555-167714577 GTGGAGGAGCAGGGAGGGACCGG - Intergenic
917023623 1:170616454-170616476 GTATAGCAGAAAGTAGACACAGG + Intergenic
918462008 1:184786560-184786582 CTAGAGCAGCGAATAGGCACTGG + Intergenic
923146092 1:231199230-231199252 GTGGAGCACAGAGTAGGCACTGG + Intronic
1062760789 10:16745-16767 GTGGAGCAGTAAGTTAGCACTGG - Intergenic
1062768146 10:80790-80812 GAGGAGGAGCAAGAGGGCACTGG - Intergenic
1062837509 10:645432-645454 ATGGAGCAGAGAGGAGGCACAGG - Intronic
1063905349 10:10775289-10775311 GAGGCACAGCAAGGAGGCACTGG + Intergenic
1064392484 10:14953912-14953934 GTGGGACAGGAAGTAGGCGCGGG + Exonic
1068349320 10:55822745-55822767 TTGGAGCAGAAAGCAGGCAAGGG - Intergenic
1070733365 10:78846911-78846933 AGTGAGCAGCAAGTAGGCAAGGG + Intergenic
1073073075 10:100807066-100807088 GGGGAGCAGGAGGCAGGCACAGG - Intronic
1074818683 10:117163470-117163492 GTGGACCAGCACGTGGGCCCGGG + Intergenic
1075264412 10:120988525-120988547 GTGGACCAGCATGAAGGCAGTGG - Intergenic
1075521906 10:123148285-123148307 GTGGTGCAGCAGGCAGGCAGTGG - Exonic
1077338916 11:2017455-2017477 CAGGAGCAGCAAACAGGCACTGG - Intergenic
1081489721 11:43558031-43558053 GTGCAGCAGCAGGGAGGAACTGG - Intronic
1083756072 11:64792282-64792304 GGGGAGCAGGCAGTGGGCACCGG + Intronic
1085155053 11:74285914-74285936 CTGGAGCAGCAGGTAGGCGTTGG + Exonic
1085384627 11:76149970-76149992 GGGGAGCAGCAAGGAAGCAAGGG + Intergenic
1089809305 11:121118543-121118565 TCGGGCCAGCAAGTAGGCACAGG - Exonic
1089997533 11:122923032-122923054 GTGGAGCAGAGAGTGGGCAGAGG + Intronic
1091360729 11:134976929-134976951 GTGTAGCAGCCACTAGCCACAGG + Intergenic
1202821900 11_KI270721v1_random:72637-72659 CAGGAGCAGCAAACAGGCACTGG - Intergenic
1092848509 12:12606041-12606063 GAAGAGCAGCAAGTAGAAACTGG - Intergenic
1093233169 12:16573999-16574021 GAGAAGCAGCAATTAGGCAGTGG - Intronic
1094460878 12:30695781-30695803 GTGGCGCAGCAAGTGGCCGCAGG - Exonic
1094465434 12:30749188-30749210 GAGGAGCAGCAAGGAGGCTAGGG + Intronic
1095079085 12:37974944-37974966 GTGGAGCAGTTCGTAAGCACTGG + Intergenic
1099480747 12:83162873-83162895 GTGGAGCCCCAAGGAGGCAGTGG - Intergenic
1101939073 12:109085852-109085874 GTAGAACAGCAGGTAGGCGCTGG - Exonic
1101997792 12:109537410-109537432 GGGGAGCAGCGAGAAGCCACTGG - Intergenic
1104992238 12:132632351-132632373 ATTGAGCAGCAAGTGGGAACCGG + Exonic
1108172103 13:47752106-47752128 GTGGTGCACCAAGTAGCCACAGG - Intergenic
1110569695 13:76990948-76990970 CTGGAGCAGCAAGTGGGCAAAGG + Exonic
1111705762 13:91747527-91747549 CTGGAGCAGGAAGCAGGCAGTGG - Intronic
1112324680 13:98435739-98435761 GGGGAGCAGAAAGGAGGCATCGG + Intronic
1114030806 14:18578565-18578587 CTGGAGCAGTAAGTTAGCACTGG + Intergenic
1115727014 14:36228155-36228177 ATGGAGCACATAGTAGGCACTGG - Intergenic
1116286690 14:42982460-42982482 TTGGGGCATCAAGTAGGCACAGG + Intergenic
1118455090 14:65938236-65938258 ATGGAGTAGGAAGTAGGAACTGG + Intergenic
1118708540 14:68501588-68501610 CTGGAGCCGGAAGTAGGCCCTGG + Intronic
1118823235 14:69358510-69358532 GTGGAGCAGCAGAGTGGCACTGG + Intergenic
1120964454 14:90155278-90155300 GAGGAGCAGCAAGGAGGCCATGG + Intronic
1122247599 14:100414983-100415005 GGGGAGCAGCAAGGGGGCAGAGG + Intronic
1122792690 14:104191002-104191024 GGGGAGCAGGGAGGAGGCACGGG - Intergenic
1123008216 14:105334544-105334566 GTGGAGCTCTACGTAGGCACTGG - Intronic
1123799680 15:23806807-23806829 GAGAAGCAGCAATTTGGCACAGG - Intergenic
1125484755 15:40104169-40104191 CATGTGCAGCAAGTAGGCACGGG - Exonic
1125729211 15:41883337-41883359 GAGGAGCTGCAGGTGGGCACTGG - Exonic
1126808562 15:52378181-52378203 GTAGAGCAGAAAGTAGGAACAGG - Intronic
1127323664 15:57872705-57872727 GGGGAGCAGAAAGTAGGCAGGGG - Intergenic
1129382961 15:75179141-75179163 GTCCAGCAGCAAGTGGGGACAGG - Intergenic
1129632031 15:77270848-77270870 GTTGAGCAGGATGTAGGCATGGG + Intronic
1130996171 15:88905641-88905663 GTAGGGCAGCAACAAGGCACGGG - Intronic
1131419004 15:92287884-92287906 GGGGAGCAGCCAGGAGGCAGTGG - Intergenic
1132670325 16:1099881-1099903 GGGGAGCTGCATGTAGGCAGTGG - Intergenic
1132700019 16:1218356-1218378 GGAGAGCAACAAGGAGGCACGGG + Exonic
1133404838 16:5515226-5515248 ATGGAGCTGACAGTAGGCACAGG - Intergenic
1135107357 16:19661836-19661858 GTGGAGATGGAAGTAGGGACAGG - Intronic
1136516492 16:30771801-30771823 GTGGAACAGGAAGGAGGCACTGG - Intronic
1137837371 16:51605790-51605812 GAGGAACAGAAAGTAGGCTCAGG - Intergenic
1138331189 16:56216774-56216796 GTGGTTCAGCAGGTAGGCTCTGG + Intronic
1138484097 16:57324996-57325018 ATGGTGCAGCAAGAAGGCCCTGG - Intergenic
1140505751 16:75471149-75471171 GTTGAGCACCAACCAGGCACTGG - Intergenic
1142194069 16:88731566-88731588 GTGGAGCAGAGAGGAGGGACTGG + Intronic
1142195702 16:88738394-88738416 GAAGAGCAGCAGGTAGACACTGG + Exonic
1203061094 16_KI270728v1_random:972168-972190 GTGAAGCAGCAAGTGGCCATAGG + Intergenic
1142769357 17:2085528-2085550 GTGGAGTAGGATGGAGGCACCGG + Intronic
1143320299 17:6064232-6064254 GTGCACCAGCCAGTAGACACAGG - Intronic
1146225385 17:31061836-31061858 GTGGAGCTGCAAGTAGAAGCAGG - Intergenic
1147138760 17:38449978-38450000 GAGTAGAAGCAAGTAGGCACTGG - Intronic
1147602214 17:41753797-41753819 GTGGAGTAGAAAGAAGGCACTGG + Intergenic
1147999512 17:44379678-44379700 GTGCAGGAGCAGGTAGGGACAGG - Exonic
1151655913 17:75495907-75495929 GCAGAGCACCAAGTGGGCACTGG - Intronic
1152557044 17:81058613-81058635 TGGGAGCAGCAAGTGAGCACAGG - Intronic
1152953696 18:17099-17121 GTGGAGCAGTAAGTTAGCACTGG - Intergenic
1152961035 18:80287-80309 GAGGAGGAGCAGGAAGGCACTGG - Intergenic
1155458272 18:26045429-26045451 ATGGAACAGCAAGTATGCACTGG - Intronic
1155491801 18:26407291-26407313 GCCGAGCAGCAAGTTTGCACAGG + Intergenic
1160921581 19:1523403-1523425 GTGGAGCAGCAGGTGGACCCTGG - Intergenic
1161250815 19:3279287-3279309 GGGGAGGACCAAGGAGGCACTGG + Intronic
1163631401 19:18419639-18419661 GTGGAGCAGCATGTACGCCAAGG + Exonic
1164742876 19:30589719-30589741 GTGGAGCAGCAAGGAAGCTGGGG + Intronic
1165015871 19:32879620-32879642 GGGGAGCAGCAGGACGGCACAGG + Intronic
1165296841 19:34934178-34934200 CAGGAGCAGTAAGTAGGCTCAGG + Intronic
1167137091 19:47623318-47623340 GAGGAGCAGCAGGGAGGGACAGG - Intronic
1167436498 19:49481482-49481504 GTGGGGCAGCAAGGAGCCATGGG + Intronic
1167468202 19:49661253-49661275 GTGCAGCAGCCACTAGCCACAGG - Intronic
926367244 2:12144694-12144716 GTGGGGCAGCAGGTAGAGACAGG - Intergenic
926789592 2:16556776-16556798 ATGGAGGAGCAAGTAGAGACAGG + Intronic
928932342 2:36637321-36637343 GTGGAGCAACAAGCAGTCCCTGG + Intronic
929988900 2:46767579-46767601 GTGGATCAGCACTTAGGCTCTGG - Intergenic
930346142 2:50183878-50183900 GGGGAGCTGCAGGCAGGCACCGG + Intronic
931188511 2:59976903-59976925 GTGGAACAGCAAACAGGCACTGG + Intergenic
931263974 2:60644149-60644171 GTGGATAAGAAATTAGGCACAGG + Intergenic
932002444 2:67897037-67897059 GTGGAGGAGCCAGGCGGCACTGG + Intergenic
932423035 2:71612614-71612636 GTGGAGGAGGAAGAACGCACTGG - Intronic
934177765 2:89592039-89592061 CTGGAGCAGTAAGTTAGCACTGG + Intergenic
934288062 2:91666340-91666362 CTGGAGCAGTAAGTTAGCACTGG + Intergenic
937749227 2:125454634-125454656 GTGGTCCAGCATGTAGGCTCTGG - Intergenic
938140068 2:128787806-128787828 GTGGAGCAGCAGGTAGGTTTAGG - Intergenic
938213091 2:129485118-129485140 GTGGAGCAGCAAGCACTCAAAGG - Intergenic
938497397 2:131807202-131807224 CTGGAGCAGTAAGTTAGCACTGG - Intergenic
940702763 2:157066513-157066535 GAGAAGCAGCAAGTAGTAACAGG + Intergenic
944999049 2:205329105-205329127 GTTGAGCACCAAGTATGCACAGG + Intronic
946319142 2:218939346-218939368 GTGGCAAAGCGAGTAGGCACTGG + Intergenic
947421169 2:229942642-229942664 GTGGAGCAGCAAGTAGGCACTGG - Intronic
948004541 2:234596431-234596453 GTGTGGCAGGAAGTAGGTACGGG + Intergenic
948937684 2:241178190-241178212 GGGGAGCAGAAAGTGGGCCCAGG - Intronic
1171048588 20:21834560-21834582 AAGGAGCAGCAAGCAAGCACAGG - Intergenic
1171427104 20:25056185-25056207 GTGGGGCTGCAAGTGTGCACAGG + Intronic
1174663728 20:52237863-52237885 GTGGAGCAGTAAGGAGGCAATGG + Intergenic
1175933784 20:62505885-62505907 GTGGAGGGGCAAGTAGGAGCTGG - Intergenic
1180090231 21:45530567-45530589 GGGGAGCAGCAAGACGGCACAGG + Intronic
1180454920 22:15505621-15505643 CTGGAGCAGTAAGTTAGCACTGG + Intergenic
1181519824 22:23439108-23439130 GAAGACCAGCAAGTTGGCACAGG - Intergenic
1183099341 22:35574381-35574403 GAGAACCAGCAAGAAGGCACTGG - Intergenic
1183165472 22:36144264-36144286 GAGGAGCAGCAGGAAGGCTCGGG - Intronic
1185340833 22:50290376-50290398 CTGGAGCAGCAGGTGGCCACGGG - Exonic
949452277 3:4199155-4199177 GTGGAGCTGTGAGTAGGAACAGG - Intronic
953375117 3:42421915-42421937 GAGGAGGAGCCAGTAGGCAGAGG + Intergenic
954211215 3:49098496-49098518 GGGGAGCAGCAATTAGACCCGGG + Intronic
954957773 3:54537284-54537306 GTGGTGAAGCAAGTGGGCTCTGG + Intronic
955735099 3:62030588-62030610 GTTGACCAGCAAGTGAGCACTGG + Intronic
956201008 3:66705951-66705973 TTTGAGCAGCAAGTAGGTAGAGG + Intergenic
958962104 3:100520692-100520714 TTGGAGGAGCAGGCAGGCACGGG + Intronic
962265664 3:133942679-133942701 CGGGAGCAGGAAGTGGGCACAGG + Exonic
962354152 3:134679409-134679431 GTGGAGCATCATGCAGGCAGTGG + Intronic
963035175 3:141019546-141019568 GTGGAGCAGCAAGGCAGCAAGGG - Intergenic
965782041 3:172296352-172296374 GTGGAGCAAGAATTAGGAACAGG - Intronic
969960962 4:10944460-10944482 CAGGAGCAGCAAGCAGGCACAGG - Intergenic
970817902 4:20179295-20179317 TTGGAGCAGCCAGTGGGCCCTGG - Intergenic
972968222 4:44539139-44539161 ATGGAGCAGCAAGGAGGAAGAGG + Intergenic
975711920 4:77169465-77169487 GAAGAGCAGCATGTAGGCACAGG - Exonic
975803689 4:78090112-78090134 CTGGAACAGCAAGGAAGCACAGG - Intronic
979834800 4:125351910-125351932 GAGGAATACCAAGTAGGCACAGG + Intronic
979861687 4:125700868-125700890 GTGAAGCAGCAAGCAGGCAATGG + Intergenic
982273062 4:153611147-153611169 GTGGAGCAGCCAATCGGCAGAGG - Intronic
983062039 4:163171881-163171903 GGGAAGCTGGAAGTAGGCACAGG + Intergenic
983821485 4:172198764-172198786 TGGGAGAGGCAAGTAGGCACTGG - Intronic
991198196 5:63960286-63960308 GTGGAGCAGGAAGTGGGGAGGGG + Intergenic
991465105 5:66904379-66904401 GAGGAGCAGGAAATAGGCTCAGG + Intronic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
997582024 5:135024217-135024239 GTGGAGCAGGGAGGAGGCAGAGG - Intergenic
998554098 5:143106306-143106328 GAGGAGCAGCCAGAAGCCACAGG + Intronic
998804708 5:145907047-145907069 GTGGAGCAGCAAGGAGGCCGGGG + Intergenic
999077946 5:148815019-148815041 GTGGAGCATCCAGGAGACACAGG - Intergenic
1001715005 5:173808296-173808318 GTGGTGCAGCAAGTGGGGCCAGG - Intergenic
1003307488 6:4942859-4942881 GTGGAGCAGGATGTGGGTACAGG + Intronic
1003337169 6:5185076-5185098 GTGATGCAGCAAGTAAGTACAGG - Intronic
1003728566 6:8793948-8793970 GTGGAGAAACAGGGAGGCACTGG - Intergenic
1006305745 6:33217342-33217364 GTGAAGCAAGGAGTAGGCACAGG - Intergenic
1007293086 6:40801771-40801793 GAGGAGCAGCAAGCAGGAAGTGG + Intergenic
1008273004 6:49511578-49511600 GTGGAGCACAAAGAAGGCATCGG + Intronic
1013276448 6:108589576-108589598 GTGGACCTGCAAGTCTGCACTGG - Intronic
1015578808 6:134701660-134701682 GTAGAGCACCAAGTGGGCTCTGG - Intergenic
1015817447 6:137225115-137225137 GAGAAGCAGCAAGAAGTCACTGG - Intergenic
1019446962 7:1076378-1076400 GCGGAGCAGCATGCAGGCTCAGG - Intronic
1020409341 7:7873976-7873998 GTGGAGCTGTTAGTAGGCAGGGG - Intronic
1022958618 7:35403808-35403830 CTGAAGCAGCAATTAAGCACAGG + Intergenic
1023623102 7:42092367-42092389 CTGGAGCAGCAAGAGGACACAGG + Intronic
1025110381 7:56211514-56211536 GGGGAGCAGGAAGGAAGCACAGG + Intergenic
1029729399 7:102429582-102429604 GTGCAGAAGCAAGTGGGGACAGG + Intergenic
1030112829 7:106041173-106041195 GTGGAGCAGCAGATAGGTAGTGG - Intergenic
1033281740 7:140010768-140010790 AGGGAGCAGCAAGAAGCCACAGG + Intronic
1033318174 7:140315731-140315753 GTGGACCAGCCAAGAGGCACGGG + Intronic
1034109346 7:148521269-148521291 TGGGAGAAGCAGGTAGGCACGGG + Intergenic
1035398147 7:158548464-158548486 GTGGAGTGGCAGGTAGGAACGGG - Intronic
1036659268 8:10697586-10697608 ATGGAGCAGCCTGTAGGCACAGG - Exonic
1037282204 8:17254429-17254451 GTGGAGCAGCAGGTAGGCTAGGG - Intronic
1037969357 8:23161021-23161043 ATGGAGGTGCAAGTAGGAACAGG + Intronic
1039349528 8:36746496-36746518 GTGGAGGAGGCAGTAGGCATTGG + Intergenic
1042818964 8:72909420-72909442 GAGGAGCGGCAGGAAGGCACAGG + Intronic
1043976834 8:86593871-86593893 GTGGTGCAGCAAGCAGGACCTGG - Intronic
1047206308 8:122805167-122805189 GTGGGGCAGCAAGTGGGACCTGG + Intronic
1047469583 8:125156823-125156845 GGTGAACAGCAAGGAGGCACAGG - Intronic
1047785822 8:128153130-128153152 GTGGAGCAGCATTGAGTCACTGG - Intergenic
1049410659 8:142472436-142472458 GAGGAGCAGCAAGCAGGCTGGGG - Intronic
1049435681 8:142585188-142585210 GTGGAGCAGCGAGTCGGTGCCGG + Intergenic
1049777296 8:144412666-144412688 GCTGAGGAGCAAGTGGGCACCGG + Exonic
1054812920 9:69448998-69449020 GTTGAGCAGGAAGTATGCTCAGG + Intronic
1054813255 9:69451491-69451513 CTAGAGCAGGAGGTAGGCACAGG - Intronic
1060046496 9:120345603-120345625 GAGGAGCAGCAAATATGCATGGG + Intergenic
1062050283 9:134443531-134443553 CTGGAGGAGCAAGAAGGGACTGG - Intergenic
1062522477 9:136964020-136964042 AGGGAGCAGCAAGCAGGCTCGGG + Intergenic
1062737128 9:138143700-138143722 GAGGAGGAGCAGGAAGGCACTGG + Intergenic
1203771541 EBV:52319-52341 GAGGAGCAGCATGCAGGCTCGGG + Intergenic
1203691863 Un_GL000214v1:49697-49719 GGGGACCAGTGAGTAGGCACTGG + Intergenic
1203644432 Un_KI270751v1:54494-54516 GGGGACCAGTGAGTAGGCACTGG - Intergenic
1185450101 X:277143-277165 GTGGAGCAGGAAGGAGCCCCGGG - Intronic
1186321689 X:8433885-8433907 GTGCTGCAGGAAGTATGCACAGG + Intergenic
1187073314 X:15910382-15910404 GTGAATCAGCAAGTAGGCCATGG + Intergenic
1189705768 X:43757157-43757179 GTGGACAAGCAGGTGGGCACAGG - Intergenic
1192863765 X:75107874-75107896 GTATAGCACCAAGCAGGCACTGG + Intronic
1193134858 X:77959397-77959419 GTAGAGCTGCAAGTAGCAACAGG - Intronic
1193827101 X:86240284-86240306 GTGGATCAGCAAGTAGAATCTGG + Intronic
1196217575 X:113071830-113071852 GTAGAACATCAAGTAGGCTCTGG - Intergenic
1200106405 X:153715695-153715717 GTGGAGCAGAGAGGAGACACGGG + Intronic
1200204797 X:154308165-154308187 GTGGAGGAGGTAGGAGGCACTGG + Intronic
1200735428 Y:6788610-6788632 CTGGAGCTGAAAGTAGGCACAGG + Intergenic