ID: 947422399

View in Genome Browser
Species Human (GRCh38)
Location 2:229952753-229952775
Sequence AGTGTTGCCAAGAGGGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 2, 1: 0, 2: 1, 3: 10, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947422391_947422399 3 Left 947422391 2:229952727-229952749 CCTTATTCTGCAGCCACCAGTGG 0: 1
1: 1
2: 1
3: 13
4: 171
Right 947422399 2:229952753-229952775 AGTGTTGCCAAGAGGGTACCAGG 0: 2
1: 0
2: 1
3: 10
4: 97
947422395_947422399 -10 Left 947422395 2:229952740-229952762 CCACCAGTGGGGCAGTGTTGCCA 0: 2
1: 0
2: 0
3: 8
4: 138
Right 947422399 2:229952753-229952775 AGTGTTGCCAAGAGGGTACCAGG 0: 2
1: 0
2: 1
3: 10
4: 97
947422390_947422399 13 Left 947422390 2:229952717-229952739 CCATTAGGCACCTTATTCTGCAG 0: 1
1: 1
2: 0
3: 6
4: 137
Right 947422399 2:229952753-229952775 AGTGTTGCCAAGAGGGTACCAGG 0: 2
1: 0
2: 1
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947422399 Original CRISPR AGTGTTGCCAAGAGGGTACC AGG Intronic
902145360 1:14394283-14394305 AGTGATGGCAAGAGAGTCCCAGG - Intergenic
903794354 1:25917602-25917624 AGAGTTGCAAAGATGGTACACGG + Intergenic
907738800 1:57142749-57142771 AGTGTTTCCAAGAAGGCAGCTGG + Intronic
910978534 1:92934797-92934819 AGATTTGCCAAGAGAGTTCCTGG + Intronic
912489821 1:110056172-110056194 TGGGTTGCCAAGTAGGTACCAGG + Intronic
912938340 1:114023344-114023366 AGTTATGCCAACAGGCTACCTGG + Intergenic
915628132 1:157129623-157129645 AGTAGAGCCAAGAGGGTCCCAGG + Intronic
916597143 1:166254820-166254842 AGTGAAGCCAAGAGGATATCAGG - Intergenic
920395016 1:205638765-205638787 AGTGTTTCCGAGAGGGTGCCAGG - Intergenic
922997254 1:229974005-229974027 AGTGTTGCAAGGAAGGTATCAGG + Intergenic
1067174311 10:43931724-43931746 TGTGTGGCCAATAGGGTGCCTGG + Intergenic
1068450900 10:57186439-57186461 AGTGTTGCCAACAGGCAATCAGG + Intergenic
1071562463 10:86654976-86654998 TGTGTGGCCAGGAGGGGACCAGG - Intronic
1075625671 10:123962917-123962939 AGTGTTGCTAAGAGGGTCACAGG - Intergenic
1087483688 11:98733997-98734019 AGTGTGGCCAAGTGGGACCCTGG + Intergenic
1089851415 11:121499988-121500010 AGCGAGGCCAACAGGGTACCAGG - Intronic
1091028288 11:132161037-132161059 AGTTTTGACAAGAGGGTATCTGG + Intronic
1098230460 12:68367823-68367845 AGTGTGGCCATGAGGAGACCAGG - Intergenic
1098637610 12:72803404-72803426 AATGTTGCCCAGAAGATACCAGG + Intergenic
1105579201 13:21677564-21677586 ATTGTGGACAAGAGGGTACCAGG + Intronic
1108932796 13:55850189-55850211 AGTGGTGCCAAGAGAGAAACTGG + Intergenic
1112252697 13:97797910-97797932 AGTCAAGCCAAGAGTGTACCTGG + Intergenic
1113208151 13:107941630-107941652 CTTGTTGCCATGAGGATACCAGG + Intergenic
1113876483 13:113597863-113597885 AGTGTTGCACAGAGGGGCCCTGG + Intronic
1116045741 14:39740516-39740538 ACTGTAGCCAAGCTGGTACCTGG - Intergenic
1118510020 14:66461952-66461974 ATTGCTGCCAAGTTGGTACCAGG - Intergenic
1122348643 14:101075497-101075519 AGTGTGGCCAGGAGGGGAACTGG - Intergenic
1129600330 15:76994922-76994944 AGTGTGGCCAGGAGGGGCCCAGG - Intronic
1130087919 15:80794020-80794042 AGTGTTGCCAAGTGGGTTCCTGG + Intronic
1133271707 16:4613738-4613760 TGTGCTGCCCAGAGGCTACCTGG - Intronic
1139824759 16:69748188-69748210 AGTGTTCCACAGAGGGCACCAGG + Intronic
1140306557 16:73808129-73808151 AGTGTTCCCAGGAGGGAAACTGG - Intergenic
1142211321 16:88809958-88809980 ACTGTTGTCCAGAGGGTGCCTGG - Intronic
1143739418 17:8941726-8941748 GGTGTTCCCTAGAGGGTTCCTGG - Intronic
1144365786 17:14542718-14542740 AGTGTTGACAAGAGAGTAATGGG - Intergenic
1144942056 17:18948614-18948636 GGAGTGGTCAAGAGGGTACCTGG + Intergenic
1144944147 17:18961254-18961276 AGTGTTGCCATGAGGTCACCGGG - Intronic
1150777717 17:68094902-68094924 AGTGTTGCCAAGAGGGTACCAGG + Intergenic
1151358046 17:73571876-73571898 TGTGTTGTCAAGGGGGCACCTGG - Intronic
1151656595 17:75499133-75499155 AGTGTCGCCAAGGGAGTAACAGG - Intronic
1151850651 17:76687863-76687885 TGTGTTCCCAAGAGGGGCCCCGG + Intronic
1161161349 19:2763274-2763296 AGTGAGGCCAGGAGGGTCCCCGG - Intronic
1161919046 19:7252678-7252700 AGTGTTTCCAAGGGCTTACCTGG - Intronic
1163600891 19:18248396-18248418 AGAGTGGCCAAGAGGGTGGCCGG + Intronic
1163848963 19:19652866-19652888 AGAAATGCCAGGAGGGTACCAGG + Intronic
926226719 2:10972027-10972049 AGTGATGGCACGAGGCTACCAGG + Intergenic
926419994 2:12686672-12686694 AGTGTTGAAAACAGGGTCCCAGG - Intergenic
933782475 2:85811874-85811896 AGTGCTGCCAAGTGGGGAGCCGG - Intergenic
934574344 2:95390873-95390895 TGTGAGGCCAAGATGGTACCAGG + Intergenic
934589090 2:95530304-95530326 AGTGTTGCCAGGAGGCTGTCAGG - Intergenic
934845802 2:97660724-97660746 ATAGTCGCCCAGAGGGTACCTGG + Intronic
934989728 2:98912790-98912812 ACTGATGCCAAGTGGGTGCCTGG - Intronic
935045120 2:99475142-99475164 AGTTTTGCCATGAGAGTACAAGG + Intronic
935691278 2:105734486-105734508 AGTGATGCCAAGAGAGGAACGGG - Intergenic
936153536 2:110034193-110034215 AGTGTTTCCCAGAGGGTTCCTGG - Intergenic
936191145 2:110337222-110337244 AGTGTTTCCCAGAGGGTTCCTGG + Intergenic
937968769 2:127534259-127534281 AAGGTTCCCAGGAGGGTACCTGG - Intergenic
939156695 2:138533647-138533669 AGTTTTGCTAAGACTGTACCAGG - Intronic
947422399 2:229952753-229952775 AGTGTTGCCAAGAGGGTACCAGG + Intronic
1172481630 20:35275032-35275054 GGTGTTGGCAAAAGGGGACCAGG - Exonic
1173696913 20:45025053-45025075 AGCTTTGGCAAGAGTGTACCTGG + Exonic
1174292859 20:49521333-49521355 AGTGGAGCCAAGAGGGTACTTGG - Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176195219 20:63833682-63833704 AGTGTTGCCGAGGGGGAAGCGGG - Intergenic
1176206198 20:63889519-63889541 AGCATGGCCAAGAAGGTACCAGG - Intronic
1177853679 21:26377944-26377966 AGTGGTGGAAAGAGGGTAGCAGG - Intergenic
1181616633 22:24059468-24059490 AGTGTGGCCAAGAGTCTGCCTGG + Intronic
1183254661 22:36754573-36754595 AATGATGCCTAGAGGGTGCCAGG + Intergenic
949166259 3:944946-944968 AATGGTGTCAAGTGGGTACCAGG - Intergenic
950294015 3:11812506-11812528 AGTGTTCCCAAGTGGGTCCCTGG - Intronic
951745129 3:25970059-25970081 AGTGTTTCTGAGAGGGTACTTGG + Intergenic
953773877 3:45799434-45799456 AGTTATTCCTAGAGGGTACCTGG + Intergenic
955133150 3:56190389-56190411 AGTGGTGCCAGGAGAGTATCTGG + Intronic
960052186 3:113249614-113249636 AATGTTGCCAACAGGGAACAAGG + Intronic
960813093 3:121643847-121643869 AGTGGTGCCAAGATGGAACAGGG + Intronic
969486378 4:7474619-7474641 AGTGTCACCAAGAAGGTAGCTGG + Intronic
970275101 4:14390937-14390959 AGTGTTGCCCAGAGAGAACGTGG - Intergenic
974295175 4:59988747-59988769 AGTGTTGCCAAAACGCAACCAGG + Intergenic
1002302145 5:178263244-178263266 AGTGTCGCCAGGAGGGCCCCGGG + Exonic
1003753752 6:9092759-9092781 ACTGTTGCCAAGATGACACCAGG + Intergenic
1005825132 6:29627857-29627879 AGGGCTGCTAAGAGGGTGCCGGG + Intronic
1006519147 6:34561513-34561535 AGTGTGCCCAAGAGGGGCCCTGG - Intergenic
1007280288 6:40707286-40707308 AGTTTTGCCAAGAGAGAATCAGG + Intergenic
1008927232 6:56899841-56899863 ATTGTGGCCAACAGGGCACCAGG + Intronic
1013458773 6:110356662-110356684 AGTTTTGCCAAGGGCTTACCAGG - Intronic
1018649216 6:165977590-165977612 AGTGTTCCCATGAAGGCACCTGG + Intronic
1019058968 6:169242331-169242353 AGCTTTGCAAAGAGGGGACCTGG - Intronic
1019769764 7:2876390-2876412 AGTGTTGGCCATAGGGGACCAGG + Intergenic
1024843881 7:53619792-53619814 AGTTTTGCCACGAGAGTACATGG + Intergenic
1027632370 7:80622301-80622323 AGTGTGGCCAAGAGAGGCCCAGG + Intronic
1029102978 7:98149224-98149246 TGTGTTCCCAGGTGGGTACCAGG - Intronic
1030609958 7:111678665-111678687 AGGGATGGCAAGAGGGTATCTGG - Intergenic
1032285252 7:130534744-130534766 AGTGTGGCCAAGAGGGAAAGAGG + Intronic
1036810222 8:11862852-11862874 AATGTGGCCAAGATGGTAACGGG - Intronic
1039728497 8:40249174-40249196 AGTGTTGCCAAGAGGGAGATGGG - Intergenic
1041309088 8:56495913-56495935 AGTGGTGACAAGAGGGGACACGG - Intergenic
1041647022 8:60263563-60263585 CATGTTCCCAAAAGGGTACCTGG + Intronic
1047441227 8:124880294-124880316 ATGGTTGCCAAGTGGGTACAAGG + Intergenic
1048977098 8:139679210-139679232 AGTGATGCCAGGTGGGTTCCCGG + Intronic
1054996568 9:71397967-71397989 AAAGTTGCCAGGAGGGTACATGG - Intronic
1055926568 9:81516322-81516344 AGTGTTGTCAGGAGGGCATCTGG - Intergenic
1057524496 9:95786640-95786662 GCTGTTCCCAAGAGGGCACCTGG + Intergenic
1057948573 9:99351708-99351730 AGTGTTGCCAAGATACTACTAGG + Intergenic
1058691062 9:107521316-107521338 AGTGTGACCTAGAGGTTACCAGG + Intergenic
1059936000 9:119311490-119311512 AGTGTAGCAAAGAGGTGACCAGG - Intronic
1186514173 X:10153933-10153955 AGTGCTGTCCAGAGGGTCCCAGG + Intergenic
1190777225 X:53562562-53562584 CCTGTTGGCAAGAGGGAACCTGG + Intronic
1191641465 X:63432620-63432642 AGTGTAGCCAACAGGGTCCCTGG - Intergenic
1195990985 X:110682055-110682077 AGTGTTGCCAGGAGAGGCCCAGG + Intronic
1198698350 X:139368288-139368310 ATTATTCCCAAGAGTGTACCAGG + Intergenic