ID: 947432457

View in Genome Browser
Species Human (GRCh38)
Location 2:230043197-230043219
Sequence CAACAGGAGCAGCTTGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 6, 3: 16, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947432454_947432457 16 Left 947432454 2:230043158-230043180 CCTAAAAATGCTGCATCTGCATT 0: 1
1: 0
2: 1
3: 27
4: 292
Right 947432457 2:230043197-230043219 CAACAGGAGCAGCTTGCTCCAGG 0: 1
1: 0
2: 6
3: 16
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947432457 Original CRISPR CAACAGGAGCAGCTTGCTCC AGG Intronic
900000308 1:11190-11212 CTACAGGACCCGCTTGCTCACGG + Intergenic
900020022 1:181709-181731 CTACAGGACCCGCTTGCTCACGG + Intergenic
900294752 1:1943314-1943336 CAACACACGCAGCTGGCTCCCGG + Intronic
900346268 1:2211883-2211905 AAAAAGCAGCAGCTTGCTCTCGG - Intronic
900354245 1:2252409-2252431 CCCCAGAAGCAGCTTGGTCCCGG + Intronic
900431764 1:2606076-2606098 CAGCAGCAGCAGCTCGTTCCCGG + Intronic
901421062 1:9151533-9151555 CCCCAGGAGCAGCCTGCTCGTGG - Intergenic
902115463 1:14117376-14117398 CAACAGAAGAAGCTTGCGCAGGG - Intergenic
902720425 1:18300690-18300712 CAGAAAGAGCATCTTGCTCCTGG - Intronic
902744104 1:18461729-18461751 CAGCAGGAGCAGCTTGCTCTTGG + Intergenic
902756075 1:18550085-18550107 AAACAGGAGCAGATGGCTGCTGG - Intergenic
905249619 1:36639470-36639492 TTACAGGAGCAGCTTGTTCCAGG - Intergenic
905850546 1:41271146-41271168 GAACATGAGCAGTTTGCTGCTGG + Intergenic
906082719 1:43104113-43104135 CTACAGGTCCAACTTGCTCCTGG + Intergenic
906783687 1:48595608-48595630 CAAGAGGAGCTGCTGGCTGCTGG - Intronic
908418075 1:63932757-63932779 CAACAGGATCAGCTGGATGCAGG - Intronic
914865453 1:151424175-151424197 CAACAGGAGCTGTTTTCTCAGGG + Exonic
915259270 1:154664633-154664655 CAAAAGGAGCAGGGTCCTCCTGG - Intergenic
917028886 1:170668490-170668512 CACCCGGCGCAGCTGGCTCCCGG + Intronic
919482296 1:198105455-198105477 CACAGGGAGCAGCTTGCTGCTGG - Intergenic
920960919 1:210663388-210663410 AGACAGCAGCAGCTTGCTTCAGG - Intronic
921892176 1:220364871-220364893 CCCCATGATCAGCTTGCTCCAGG + Intergenic
922603941 1:226877387-226877409 GAATAGTAGCACCTTGCTCCAGG + Intronic
924957606 1:248944628-248944650 CTACAGGACCAGCTTGCCCACGG - Intergenic
1062787187 10:274736-274758 AAACAGGAGCAGATTCCTCATGG - Exonic
1063176080 10:3552134-3552156 AAACAGGTGCTGCTGGCTCCGGG + Intergenic
1065825955 10:29571832-29571854 CTAGACGAGTAGCTTGCTCCTGG + Intronic
1067134558 10:43596302-43596324 TACCAGGAGCAGCATGCTTCAGG - Intergenic
1067708425 10:48628208-48628230 CACCAGGCACAGCATGCTCCTGG - Intronic
1067757273 10:49014745-49014767 CCCTAGGAGCAGCTTTCTCCTGG + Exonic
1069558536 10:69413643-69413665 CCACAAGAGCAGCCTTCTCCTGG + Intronic
1069612876 10:69786930-69786952 CTTCAGGTGCAGCTTGTTCCAGG + Intergenic
1070006055 10:72425359-72425381 CAGCAGCTGCAGCTTGCTCAAGG + Intronic
1070311419 10:75276365-75276387 GAGGAGGAGCAGCTTCCTCCTGG - Intergenic
1070788866 10:79178040-79178062 CATCACAAGCAGCTTGCTGCTGG + Intronic
1070982113 10:80657433-80657455 CATCAGTAGCAGGTTGCTACTGG + Intergenic
1072065359 10:91864170-91864192 AAACAGGTGCTTCTTGCTCCTGG + Exonic
1072424085 10:95314603-95314625 TTACAGGATCAGCTGGCTCCAGG + Exonic
1076963449 10:133786146-133786168 CTACAGGACCAGCTTGCCCACGG - Intergenic
1079231311 11:18651221-18651243 CAGCAGCCGCAGCTTCCTCCCGG - Intergenic
1080555384 11:33411386-33411408 CAGCAGGAGCAGGCTGCCCCAGG - Intergenic
1083885492 11:65571539-65571561 CAGCAGGAGCAGGTGGCCCCTGG - Exonic
1086411399 11:86548114-86548136 CAGAAGGAGCAGCTTGCTCTGGG - Intronic
1086524187 11:87705278-87705300 TAACAAAAGCAGCTTGGTCCTGG - Intergenic
1089492727 11:118893943-118893965 CTACTGCAGCAGCCTGCTCCTGG + Exonic
1090161024 11:124495665-124495687 GAACAGAAGCAGATTGATCCTGG - Intergenic
1091286278 11:134410337-134410359 AAACAGGAACAGCGAGCTCCTGG + Intronic
1091373398 12:11321-11343 CTACAGGACCCGCTTGCTCACGG + Intergenic
1091797065 12:3303596-3303618 CAGCAGGAGCTGCTTGTCCCAGG + Intergenic
1102614601 12:114142379-114142401 GAACAGAAGCAGCTGGCTCCAGG - Intergenic
1104040203 12:125124990-125125012 CATCAAGAGCAGCATCCTCCTGG + Exonic
1104318872 12:127731323-127731345 CATGAGTGGCAGCTTGCTCCAGG + Intergenic
1104551604 12:129762114-129762136 CATCAGGAACAGATTGATCCAGG - Intronic
1109203760 13:59459286-59459308 CACCAGGAGCAGTAGGCTCCAGG - Intergenic
1110619174 13:77576478-77576500 CAACAGCAGCATCCAGCTCCAGG + Intronic
1113379690 13:109791269-109791291 AAACAGGGTGAGCTTGCTCCTGG - Intergenic
1113460018 13:110475688-110475710 CTACAGGAGCAGCGTGCAGCGGG + Intronic
1113797497 13:113066869-113066891 CAAAAGGACCAGCTTGGTCCAGG - Intronic
1116974701 14:51102833-51102855 CAACAGCAGCAGCATACTCTAGG - Intergenic
1116981923 14:51180717-51180739 TAGCAGGAGCAGCATGCTCCCGG + Intergenic
1119793433 14:77375177-77375199 CAAGAGGAAGAGCTTGCTCTGGG + Intronic
1120474402 14:84969377-84969399 CAAGAGGAAGTGCTTGCTCCAGG - Intergenic
1121013187 14:90533784-90533806 CAGCGGGAGCTGCTGGCTCCAGG + Exonic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1125782293 15:42280502-42280524 CAGCAGAAGCAGTTGGCTCCAGG + Intronic
1128358449 15:66944238-66944260 AAACAGGAGCTGTTTGCTGCCGG - Intergenic
1128789696 15:70423876-70423898 GAACAGGAGCAGCTTCCTCCTGG + Intergenic
1129771727 15:78207128-78207150 GAACAGGGACAGCTTGGTCCCGG - Intronic
1130286115 15:82556005-82556027 CAGCAAGAGCAGCTTGCTCTTGG + Exonic
1130585882 15:85181950-85181972 AAACAAGAACAGCTTACTCCTGG - Intergenic
1130901573 15:88210628-88210650 CACCTGGAGCAACTTGCCCCTGG + Intronic
1131827864 15:96334376-96334398 CAACACAAACAGCTCGCTCCAGG - Exonic
1132247478 15:100308948-100308970 CAAAATGGGCAGCTTGCTCAGGG + Intronic
1132453199 15:101979755-101979777 CTACAGGACCCGCTTGCTCACGG - Intergenic
1132453697 16:10871-10893 CTACAGGACCCGCTTGCTCACGG + Intergenic
1132846890 16:2004833-2004855 CGACAGGAGCCGCTTCCACCAGG + Intronic
1133136241 16:3714147-3714169 AAACAAGAGCTGCTTGCCCCAGG - Intronic
1133368044 16:5226504-5226526 AAACTGGAGCAGCTTGCCCAAGG + Intergenic
1134125564 16:11613626-11613648 CAACAAGAGCCACTTCCTCCTGG - Intronic
1136684647 16:31986947-31986969 CTACAGGAGCAGCTCAATCCTGG + Intergenic
1136867567 16:33769504-33769526 CACCAGGAGCAGCTTGTTCCGGG - Intergenic
1136884511 16:33923321-33923343 CTACAGGAGCAGCTCAATCCTGG - Intergenic
1138383141 16:56617477-56617499 CAAAAGGAGCAGCTGGCTCCAGG + Intergenic
1140863447 16:79039428-79039450 CAGGAGGAGCAGCTTCCTCCTGG + Intronic
1141031522 16:80592872-80592894 CATCACGACCAGCTTTCTCCTGG + Intergenic
1142048208 16:87939841-87939863 CAGCAGGAGCAGCCGGTTCCAGG - Intergenic
1142423749 16:89989596-89989618 CAACAGGAGCAGAAGGCCCCAGG - Intergenic
1203104594 16_KI270728v1_random:1346699-1346721 CACCAGGAGCAGCTTGTTCCGGG + Intergenic
1203128920 16_KI270728v1_random:1615669-1615691 CACCAGGAGCAGCTTGTTCCGGG - Intergenic
1143282820 17:5767426-5767448 CAACATTAGCAGCTAACTCCAGG - Intergenic
1144674329 17:17152317-17152339 CTTCATGAGCAGCTTTCTCCAGG + Intronic
1145395876 17:22494511-22494533 CAATAAGAAAAGCTTGCTCCAGG + Intergenic
1145971455 17:28958878-28958900 GAACAGGACTAGCTTCCTCCAGG + Intronic
1146055751 17:29580193-29580215 CAAGAGCAGTAGCTGGCTCCGGG + Intronic
1146950513 17:36902161-36902183 CATCAGGAGCCTCTTTCTCCAGG - Intergenic
1147931952 17:43987327-43987349 CATCAGAAGCAGCTGCCTCCAGG + Intronic
1148348668 17:46922721-46922743 AAACAGGAAAAGCTTGCGCCAGG + Intergenic
1151830022 17:76544145-76544167 CATCAGGAGCAGCTGCCTGCAGG - Intronic
1151849950 17:76684394-76684416 CACCAGGCGCAGCAGGCTCCTGG - Intronic
1151958925 17:77394827-77394849 AAACAGGAGCAGCCTGGACCTGG - Intronic
1152122629 17:78428147-78428169 CAGCAGTAGCAGCTCGCACCGGG - Intronic
1152342153 17:79731225-79731247 CACCAGGAGCAGCTTGTTCTGGG - Exonic
1156464071 18:37337481-37337503 CATCAGGAACAGCTGCCTCCTGG - Intronic
1160109393 18:76011553-76011575 CAGCTGGAGCAGGTTGGTCCAGG - Intergenic
1161316814 19:3621083-3621105 CAACAGGAGGGCCTTGCTCGGGG + Intronic
1162146379 19:8614597-8614619 CTTCAGGAACAGCTTGCTCAGGG - Intergenic
1163540910 19:17909632-17909654 CTTCAGGTGCAGCTGGCTCCAGG + Intergenic
1163674527 19:18648817-18648839 GAGCAGGAGGAGCTGGCTCCAGG - Intronic
1166650523 19:44570994-44571016 CAACAGCAGCAGCTCCTTCCAGG + Intergenic
1168728587 19:58606595-58606617 CTACAGGACCAGCTTGCCCACGG - Intergenic
927289441 2:21391119-21391141 CAAAAGGAGAAGTTTGCGCCTGG + Intergenic
930102450 2:47613850-47613872 CAAAAGGAGGAGATTCCTCCTGG + Intergenic
934852292 2:97708996-97709018 CTTCAGGAACAGCTTGCTCTGGG - Intergenic
935054437 2:99553245-99553267 CACCAGGAGGAGCTTGCTAGAGG - Intronic
935717942 2:105954980-105955002 GAAAAGGAGCAGCTTGCTTCAGG + Intergenic
936398404 2:112147858-112147880 CAACAGTAGCATCATGATCCCGG + Intronic
936569917 2:113604104-113604126 CTACAGGACCAGCTTGCCCACGG + Intergenic
937316640 2:120935900-120935922 CAAGAGGAGCTGCTGGCTCTGGG + Intronic
937900559 2:127016191-127016213 CCACAGCAGCTGCTTGGTCCTGG + Intergenic
944625888 2:201568420-201568442 CATCAGGAGCAGTTTGCTTTTGG - Intronic
946048322 2:216839726-216839748 CAAAAGAAGCAGGTTGCTCTTGG - Intergenic
947342730 2:229156932-229156954 CGACAGGAGCAGCGTGATCAGGG - Intronic
947432457 2:230043197-230043219 CAACAGGAGCAGCTTGCTCCAGG + Intronic
948696516 2:239735689-239735711 CCACAGGAGCAGCTGTCTTCAGG - Intergenic
949088845 2:242182237-242182259 CTACAGGACCAGCTTGCCCACGG - Intergenic
1168924826 20:1570940-1570962 CAACTGGATGAGCTGGCTCCTGG - Exonic
1168928681 20:1603945-1603967 CAACTGGATGAGCTGGCTCCTGG - Intronic
1168941275 20:1713149-1713171 CCACAGGAGGAGCATCCTCCAGG + Intergenic
1168969697 20:1922488-1922510 CAACTGGATGAGCTGGCTCCTGG + Exonic
1172061720 20:32191004-32191026 CAACAGGAGTTGGTTCCTCCTGG + Intergenic
1173396777 20:42687648-42687670 CTTCAGGAGCACCTTGTTCCAGG + Intronic
1174556630 20:51400164-51400186 CAACAGGATCACCTTGCTGTAGG - Intronic
1174718806 20:52789014-52789036 CACCACCAGCAGCTTTCTCCAGG + Intergenic
1175243905 20:57569798-57569820 TAACAGTAGCAGCTGGGTCCTGG + Intergenic
1175910748 20:62404508-62404530 CAAAAGGGGCTGCTAGCTCCTGG - Intronic
1180264068 21:46698519-46698541 CTACAGGACCAGCTTGCCCACGG - Intergenic
1180729625 22:17971840-17971862 GGAAAGGAGGAGCTTGCTCCAGG + Intronic
1182470157 22:30543498-30543520 CAACTGGATGAGCTGGCTCCTGG + Intronic
1182656863 22:31897607-31897629 CAACATCAGCTGCTTGCTCAAGG + Exonic
1183667379 22:39253650-39253672 CAACAGGAGCAGCGAGCGCCCGG + Intergenic
1183953785 22:41367471-41367493 CAGCAGGAGGTGCTTGCTCCAGG - Intronic
1185430301 22:50806876-50806898 CTACAGGACCAGCTTGCCCACGG - Intergenic
950141105 3:10616122-10616144 TAACAGGGACAGCTTGTTCCTGG - Intronic
953650697 3:44800383-44800405 CAACTGGCGGAGCTTGCTTCAGG + Exonic
956331067 3:68109626-68109648 CAAGAGGAGCAGCCTCCTCTTGG - Intronic
956463753 3:69498204-69498226 CAACAGCACCAGCTTGATTCTGG - Intronic
956481239 3:69675813-69675835 CAGCAGCAGCATCTGGCTCCAGG - Intergenic
960057466 3:113285471-113285493 CCACAGCAGCAGGCTGCTCCTGG - Exonic
961484240 3:127206428-127206450 CAACAGGAGCACCCTGTCCCTGG + Intergenic
962267150 3:133951968-133951990 CCAAAGGAGCAGCTTTCTCTTGG + Intronic
967254109 3:187572190-187572212 CAAGAGGAGCAGCCTGCTCTGGG - Intergenic
968934859 4:3604695-3604717 TAACAGGAGTAGCCTGGTCCTGG - Intergenic
969310257 4:6348808-6348830 CTTCAGGTGCAGCTTGATCCAGG - Intronic
978469987 4:109054908-109054930 CAACAGCTGCAGCTGGCTCTTGG + Intronic
980865900 4:138553243-138553265 CAGCAGGTGCCGCTTGCCCCAGG + Intergenic
982845348 4:160246087-160246109 CCACAGGAGGAGCATCCTCCAGG - Intergenic
985466674 4:190203444-190203466 CTACAGGACCAGCTTGCCCACGG - Intergenic
985856440 5:2430988-2431010 GAAAAGGAACAGCTTGCTGCTGG - Intergenic
986962728 5:13235023-13235045 CACCAGCAGCAGCATGCTACAGG + Intergenic
989170682 5:38468376-38468398 CAACAGCATCAGCTGGCTTCTGG + Intergenic
991145467 5:63297720-63297742 CAACAGGAGAATCTTTCTCCAGG - Intergenic
991594267 5:68287081-68287103 CAACAGCAGCAACTAGCTTCAGG - Intronic
992141277 5:73799507-73799529 GAACAGGAGCATCATGTTCCAGG - Intronic
996744067 5:126830216-126830238 CAGCAGGTGCAGCCAGCTCCGGG + Intronic
997610781 5:135214091-135214113 AAGCAGCAGCAGCTGGCTCCAGG + Intronic
999922817 5:156341167-156341189 GAAAAGGAGCTGCTTCCTCCTGG + Intronic
1000273510 5:159710405-159710427 GAAGAGGAACAGCTTGCTCATGG + Intergenic
1001020135 5:168175788-168175810 GAGCAGGAGAAGCTTGCTCCGGG - Intronic
1001939401 5:175729871-175729893 AAGCAGGAGCTGCTTGCACCAGG + Intergenic
1003245478 6:4378659-4378681 GAAGAGGAGAAGCTTGGTCCCGG - Intergenic
1005495620 6:26385241-26385263 CAACAGGGGCAGCGTGGCCCTGG + Exonic
1006118953 6:31792396-31792418 CAACAGCAGCAGCCACCTCCAGG - Exonic
1006628055 6:35411404-35411426 GAAGTGGTGCAGCTTGCTCCAGG - Intronic
1006792773 6:36714595-36714617 GAACTGGAGCAGCCTCCTCCTGG - Intronic
1006897520 6:37480383-37480405 CCTCAGGAGCAGCTTCCTTCAGG - Exonic
1009523421 6:64713561-64713583 CATCAGCAGCAGCTTGCATCAGG + Intronic
1011394622 6:86892740-86892762 CTACAGGAGGAGCATCCTCCAGG + Intergenic
1011715826 6:90104363-90104385 CAAGAGGAGCACCTCGCTTCTGG - Intronic
1013596932 6:111668899-111668921 CAACAGGAGCAGGTTTTTCATGG - Intronic
1016714229 6:147204602-147204624 CAACAGCAGCAGCATCCGCCTGG + Exonic
1017543869 6:155430308-155430330 CCTCATGAGCAGCATGCTCCTGG - Intronic
1017716108 6:157214506-157214528 TAACAGGAGCTGCTTACACCAGG - Intergenic
1018080836 6:160258400-160258422 CAACAGGAGCCGCCTGCCACTGG - Exonic
1020551380 7:9609940-9609962 CAAGAGGACAAGCTTGGTCCAGG + Intergenic
1020889715 7:13863429-13863451 TAACAGGTGCATCTTGCTTCTGG + Intergenic
1023831293 7:44040238-44040260 CAACAGGAGCAGGGTGCGGCTGG + Intergenic
1023852292 7:44157240-44157262 CACCAGGAACAGCTTGGTGCTGG - Intronic
1024999930 7:55307336-55307358 CATCAGCAACTGCTTGCTCCTGG - Intergenic
1025081094 7:55983771-55983793 CAACAGGAGCTGATTCTTCCTGG - Exonic
1025230579 7:57201259-57201281 CAACATCAGCAGCCTGGTCCTGG - Intergenic
1026213151 7:68324514-68324536 CAATAGGAGCACCTTCCCCCAGG + Intergenic
1026302270 7:69108391-69108413 AGACAGGAGCATCTTGCACCTGG - Intergenic
1026790102 7:73325808-73325830 CAACAGGAGCAGATAGGTGCTGG + Intronic
1027104652 7:75397897-75397919 CAACAGGAGCAGATAGGTGCTGG - Intronic
1029741623 7:102494544-102494566 CAACAGGAGCAGGGTGCGGCTGG + Exonic
1029759614 7:102593713-102593735 CAACAGGAGCAGGGTGCGGCTGG + Exonic
1029776980 7:102689623-102689645 CAACAGGAGCAGGGTGCGGCTGG + Intergenic
1035623274 8:1051149-1051171 CAAGGGGAGCAGCTTCTTCCTGG + Intergenic
1036215711 8:6878133-6878155 AAACAGGAGGAGCTGGCACCAGG - Intergenic
1036453805 8:8891814-8891836 CATCAGGAGCAGCTTGAGCCGGG + Exonic
1039478780 8:37856495-37856517 CAACACAGGCAGCTTGCCCCTGG - Intergenic
1039884481 8:41647330-41647352 CAGCAGGGGCAGCTGGCACCTGG - Exonic
1043375433 8:79644244-79644266 CATCAGGAACAGCTGGATCCAGG + Intronic
1047252472 8:123191294-123191316 CACGGGGAGCAGCTTGCTCTAGG + Intronic
1047544054 8:125797972-125797994 CAGCAGGAGCCCCATGCTCCTGG - Intergenic
1047756976 8:127926448-127926470 CAACTGGAGCTGCTTCATCCGGG + Intergenic
1049239698 8:141530940-141530962 CAACAGCAGCTGATTGGTCCAGG - Intergenic
1049345926 8:142138635-142138657 CAACACCACCAGCTTGCTCTTGG + Intergenic
1049883116 9:11303-11325 CTACAGGACCCGCTTGCTCACGG + Intergenic
1050091742 9:2022042-2022064 CAACTGGAACTTCTTGCTCCAGG - Intronic
1050942193 9:11473324-11473346 CAGCAGCAGCAACTTGCTCTTGG + Intergenic
1052172663 9:25420642-25420664 CAACAGGATTATCTTGCTGCAGG + Intergenic
1054455314 9:65427283-65427305 TAACAGGAGTAGCCTGGTCCTGG + Intergenic
1056571474 9:87820574-87820596 CAACAGGAACAACTTGAACCAGG - Intergenic
1057024755 9:91726281-91726303 CCACAGGGGCAGCATGGTCCAGG + Intronic
1060736065 9:126067234-126067256 CCACAGCAGCAGCTGACTCCAGG - Intergenic
1060917129 9:127397966-127397988 CAAGAGGCTCAGCTTGCGCCCGG - Exonic
1061193264 9:129094386-129094408 CAGCAGGCTCAGCTTGCCCCAGG - Intergenic
1061368799 9:130186543-130186565 CAGCAGGAACAGCATGTTCCAGG + Intronic
1062633900 9:137479846-137479868 CAACAGGAACAGCCTTCTGCAGG - Intronic
1203565251 Un_KI270744v1:83465-83487 GATCAGGTGCGGCTTGCTCCAGG + Intergenic
1190775450 X:53549000-53549022 CAACAGGAGCAGCTTGGGGATGG + Exonic
1195040619 X:101010634-101010656 CCACAGGTACAGCTTGCTGCAGG + Exonic
1199825904 X:151498932-151498954 CAACAGAAGTAGCTTGCCCCTGG + Intergenic
1200402697 X:156028846-156028868 CTACAGGACCCGCTTGCTCACGG - Intergenic