ID: 947432755 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:230045131-230045153 |
Sequence | CGGGCTCCTTACCCATTTGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 55 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 53} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
947432755_947432763 | 27 | Left | 947432755 | 2:230045131-230045153 | CCTTCAAATGGGTAAGGAGCCCG | 0: 1 1: 0 2: 0 3: 1 4: 53 |
||
Right | 947432763 | 2:230045181-230045203 | ATTTCCTCACTCTACCAGCCTGG | 0: 1 1: 0 2: 2 3: 11 4: 220 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
947432755 | Original CRISPR | CGGGCTCCTTACCCATTTGA AGG (reversed) | Intronic | ||