ID: 947432755

View in Genome Browser
Species Human (GRCh38)
Location 2:230045131-230045153
Sequence CGGGCTCCTTACCCATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 53}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947432755_947432763 27 Left 947432755 2:230045131-230045153 CCTTCAAATGGGTAAGGAGCCCG 0: 1
1: 0
2: 0
3: 1
4: 53
Right 947432763 2:230045181-230045203 ATTTCCTCACTCTACCAGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947432755 Original CRISPR CGGGCTCCTTACCCATTTGA AGG (reversed) Intronic