ID: 947432755

View in Genome Browser
Species Human (GRCh38)
Location 2:230045131-230045153
Sequence CGGGCTCCTTACCCATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 53}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947432755_947432763 27 Left 947432755 2:230045131-230045153 CCTTCAAATGGGTAAGGAGCCCG 0: 1
1: 0
2: 0
3: 1
4: 53
Right 947432763 2:230045181-230045203 ATTTCCTCACTCTACCAGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947432755 Original CRISPR CGGGCTCCTTACCCATTTGA AGG (reversed) Intronic
905541859 1:38766266-38766288 CAGGCTCCTTGCCCCTGTGAAGG - Intergenic
912210895 1:107555838-107555860 CTGTCTCCTTGCCCATTTGCTGG - Intergenic
915121565 1:153632675-153632697 CAGCATCCTTACCCATGTGAGGG - Intronic
919983519 1:202657437-202657459 CTGGCTTCTTAGGCATTTGAAGG + Intronic
920835079 1:209502993-209503015 GGGGCACCACACCCATTTGAGGG - Intergenic
924101893 1:240612120-240612142 CGGGCTCCTTTCACATCTGCAGG - Exonic
1064043589 10:11990430-11990452 CGGCCTCCTAACCCTTTTTAAGG - Intronic
1073051013 10:100667524-100667546 CGGGCTCCTTTCCCCACTGATGG + Intergenic
1080295603 11:30723628-30723650 CTGGATCCCTCCCCATTTGAGGG + Intergenic
1084750814 11:71203623-71203645 CGGGGTCCTTACCCAGCTCATGG + Intronic
1084872967 11:72110025-72110047 CTTGCTCCTGACCCAGTTGATGG - Exonic
1087105115 11:94400849-94400871 CGGGCCCCTTACCAAAGTGAAGG + Exonic
1092605134 12:10110465-10110487 CGTCCTCTTTACCAATTTGAAGG - Intronic
1099385233 12:82005954-82005976 CAGTCTCTTTACCCATTTAATGG - Intergenic
1107398832 13:40048597-40048619 GGGGCACCTGACCCATTTGGGGG + Intergenic
1117774972 14:59174433-59174455 CATGCTCATCACCCATTTGATGG - Intergenic
1126908992 15:53398894-53398916 CAGGCACCTTCCCCTTTTGAGGG - Intergenic
1128106305 15:65047842-65047864 CTGCCTACTTACTCATTTGAGGG - Intronic
1130258421 15:82336629-82336651 CCTGCTCCTTACCCCTTGGAAGG - Intergenic
1130596503 15:85253331-85253353 CCTGCTCCTTACCCCTTGGAAGG + Intergenic
1132517495 16:372599-372621 CCGGCTCCTTACCCACATGGAGG + Exonic
1145251284 17:21298239-21298261 GGGCCTCCTTCCCCCTTTGAAGG + Intronic
1146716108 17:35088710-35088732 CGGCCTGCTTACCCCTTTAAAGG - Intronic
1148392308 17:47281341-47281363 AGGGCTCCTTACCAAGTTGAGGG - Intronic
1151582880 17:74990111-74990133 CTGGCTCCTTTCCCATTTCTGGG - Intronic
1153822070 18:8840548-8840570 GGGGCTCCTGACCTAGTTGAGGG + Intergenic
1160806741 19:995266-995288 CCTGCTCCTGACCCATCTGACGG - Intronic
928935240 2:36669491-36669513 CTGTCTCCTGACCCATCTGAGGG + Intergenic
937491931 2:122378738-122378760 ACTGCTCCTTTCCCATTTGATGG - Intergenic
938113721 2:128589501-128589523 CGCGCTCCTTCTGCATTTGAGGG + Intergenic
946407581 2:219500005-219500027 CTGGCACCTCACCCTTTTGAGGG - Exonic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
1184678723 22:46057967-46057989 CGGGTCCCTTAACCATTCGAGGG - Intronic
949837385 3:8283776-8283798 CCGGCTTTTTGCCCATTTGAAGG + Intergenic
950458145 3:13104777-13104799 CTGGCCCCTGACCCATGTGAGGG + Intergenic
951168070 3:19506575-19506597 TGGGCTCCTCTCCCACTTGAGGG + Intronic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
968944275 4:3655378-3655400 CGGGCTCCTTATCCAGCTGGGGG - Intergenic
975059301 4:69978110-69978132 TGAGCTCCTTTCCCACTTGAAGG + Intergenic
983556011 4:169059793-169059815 CGGGCTTCCTACCCAGCTGATGG + Intergenic
1002692587 5:181060448-181060470 CTGGCTCCCTACCCTTTTGCCGG - Exonic
1006963568 6:37959001-37959023 CTGGGTCATTACCCATTTGTTGG + Intronic
1015264867 6:131280702-131280724 GGGGCTCCTTCCCCAGTTAAGGG - Intronic
1020825780 7:13026068-13026090 GAGGTTCCTTACCCATTTGTGGG - Intergenic
1025101479 7:56138938-56138960 CTGGCTTCCTTCCCATTTGAAGG + Intergenic
1027772495 7:82425183-82425205 GGGGCTCAATACCCCTTTGAAGG - Intronic
1035875941 8:3189796-3189818 CTGGCTCATGACCCATTTAAAGG - Intronic
1049189171 8:141277082-141277104 CGGGCTCCTCACCCCTGTGCCGG - Intronic
1050912068 9:11083731-11083753 ATTGCTCTTTACCCATTTGAAGG + Intergenic
1055373267 9:75623745-75623767 TGGGCTCCTCTCCCACTTGAGGG + Intergenic
1058792121 9:108458375-108458397 CAGGCTGCTTTCCTATTTGATGG - Intergenic
1061289963 9:129645125-129645147 CGGTCTCCTCACCTATGTGATGG + Intergenic
1194072969 X:89350552-89350574 AAGGCTCCTCTCCCATTTGAGGG + Intergenic
1200727208 Y:6686292-6686314 AAGGCTCCTCTCCCATTTGAGGG + Intergenic
1200728360 Y:6702067-6702089 AAGGCTCCTCTCCCATTTGAGGG + Intergenic